ID: 1197188595

View in Genome Browser
Species Human (GRCh38)
Location X:123618830-123618852
Sequence CCCTGGACAGGAATACTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197188595 Original CRISPR CCCTGGACAGGAATACTCGG TGG (reversed) Intronic
908030097 1:59989958-59989980 GCCTGGACAGGAAAACCAGGTGG - Intronic
908179037 1:61585902-61585924 CCCTGGCAAGCAATACTGGGCGG - Intergenic
908537652 1:65092966-65092988 CGCTGGAGAGGAAAACTGGGGGG + Intergenic
909272642 1:73643695-73643717 CCCTTGACAGGAATACTGAGAGG - Intergenic
910835176 1:91501208-91501230 CCCTGGCCACGAGTACTGGGCGG - Exonic
922433453 1:225580138-225580160 CTCTGGGCATGAATACTAGGAGG - Intronic
924397362 1:243636514-243636536 CTCTGGACAGGAATATTTTGAGG - Intronic
924651658 1:245934234-245934256 CCCTGGACAGAAAAACTGGAAGG + Intronic
1062975730 10:1681086-1681108 CCCTGGACAGGAATAATGTAAGG + Intronic
1069772015 10:70906139-70906161 CCATGGACAGGAAATCTCGGTGG - Intergenic
1073451333 10:103611191-103611213 CCCTGGTCAGGAATGCCCAGTGG - Intronic
1076881901 10:133243709-133243731 CAGTGGACAGGAACCCTCGGGGG + Intergenic
1080886901 11:36376277-36376299 CCCGGGACAGGAAAAGTGGGAGG + Intronic
1083639819 11:64139455-64139477 CCCTGGACAGGGCTCCTCTGCGG - Intronic
1086224221 11:84488298-84488320 CACTGGAAAGGAATCCTGGGAGG + Intronic
1087345166 11:96962824-96962846 CCATGGAAAGGAATAATCAGTGG + Intergenic
1095749007 12:45690325-45690347 TTCTGGACAGGAATACACAGTGG + Intergenic
1095951438 12:47783961-47783983 CCCTGGTCAGGAAGCCTGGGAGG + Intronic
1104640623 12:130464741-130464763 CCCTGGACAGAGAGACTCAGAGG - Intronic
1104731658 12:131108632-131108654 CCCAGGACATGGATACTGGGAGG + Intronic
1104929423 12:132329919-132329941 CCCTGGCCAGGCATTCCCGGAGG - Intergenic
1108454540 13:50599645-50599667 CCCTGGACATGCATACTCCTGGG + Intronic
1113598527 13:111551573-111551595 CCCAGGACAGGAACATTCGGTGG - Intergenic
1117406830 14:55411943-55411965 CCCGGGACAGGAACACGCGGCGG - Intergenic
1126736190 15:51734290-51734312 GGCAGGACAGGAATACTCTGGGG - Intronic
1128533377 15:68470574-68470596 CCCAGGACAGGGAGACTTGGAGG - Intergenic
1130088998 15:80803520-80803542 CCCTGGACGGGAAGACAAGGTGG + Intronic
1132688686 16:1172787-1172809 GCCTGGACAGGAGCCCTCGGGGG - Intronic
1137709306 16:50555371-50555393 CCCTGGACAGGTATGTTGGGTGG + Intronic
1149617688 17:58015181-58015203 CCCTGGAAATGATTACTTGGGGG + Intergenic
1152641494 17:81451280-81451302 CCCTGGGAAGGGATACTCTGGGG - Intronic
1163721084 19:18898598-18898620 CCCTGGACAGGGACATTAGGAGG - Intergenic
1167360194 19:49025948-49025970 CCCTAGACAGGACCACTCGGGGG + Intronic
1167360891 19:49029833-49029855 CCCTAGACAGGACCACTTGGGGG - Intronic
1167362761 19:49038964-49038986 CCCTAGACAGGACCACTCGGGGG + Intergenic
1167365118 19:49050703-49050725 CCCTAGACAGGACCACTCAGGGG + Intergenic
1167367370 19:49061847-49061869 CCCTAGACAGGACTACTCGGGGG + Exonic
925546861 2:5025705-5025727 CCCTGGAAAGGGACACTTGGGGG - Intergenic
927207236 2:20618363-20618385 CCCAGGAGAGGAATACTGAGTGG - Exonic
927956007 2:27207764-27207786 CCCTGGACAGTATCACTCCGTGG - Exonic
929934501 2:46284976-46284998 CCCAGGCCAGGAATGCTCAGAGG + Intergenic
935133556 2:100279105-100279127 CCCAGGACAGGAAGTCGCGGTGG - Exonic
940159315 2:150694067-150694089 CCCTGGAAAAGAAGACTCCGGGG + Intergenic
944624790 2:201559519-201559541 CTCTGGGCAGGAATACTCCCAGG + Intronic
944903732 2:204242028-204242050 CCCTGGACAATTATACTTGGTGG + Intergenic
948890151 2:240903499-240903521 CCCTGGAAAGGCATCCTGGGGGG + Intergenic
1169462131 20:5804909-5804931 CCCTGAACAGGAAATCTTGGTGG + Intronic
1176002964 20:62841949-62841971 GACTGAACAGGAATCCTCGGGGG - Exonic
1178000867 21:28161049-28161071 ACCTGGACAGTATTACTCTGTGG + Intergenic
953422163 3:42762538-42762560 CCCTGGACACCAAGACTCAGGGG + Intronic
954956820 3:54528687-54528709 TCCTGGACAGGAATAATTAGAGG - Intronic
967259606 3:187629146-187629168 CCCTGGCCAGGGAGACTGGGAGG - Intergenic
972896534 4:43628328-43628350 CCCAGCACAGGAATACCTGGAGG - Intergenic
979010160 4:115356362-115356384 CCCTGGACAGGAATGCCCGGAGG - Intergenic
982824573 4:159986209-159986231 CCATGGCCAGGAATAATCAGGGG - Intergenic
983093805 4:163538849-163538871 CCCAGGACAGGATTACCGGGAGG - Intronic
995142282 5:108748415-108748437 GCCTGGAAGGGACTACTCGGCGG - Intronic
999113487 5:149141754-149141776 CGCTGGGCAGGAATAGTCCGGGG + Exonic
1000171700 5:158708544-158708566 TCCTGGCCTGGAATACTCTGAGG - Intronic
1002708213 5:181177593-181177615 CCCTGGACAGGGCTACTCGGAGG + Intergenic
1003366610 6:5481214-5481236 GCCTGGGCAGGAACACACGGAGG - Intronic
1008359785 6:50602276-50602298 ACCTGGACAGGAATATTTTGAGG - Intergenic
1010215101 6:73394596-73394618 GCCTGGAAAGGAATACACAGTGG + Intronic
1011550808 6:88529544-88529566 CCCTGGGTAGGAACACTCTGAGG + Intergenic
1014854599 6:126383807-126383829 TCCTAGACAGTAATACTGGGAGG + Intergenic
1017110174 6:150924910-150924932 GCCTGGAAAGGAATACTCAGCGG + Intronic
1017885802 6:158598594-158598616 CACTGTCCAGGAATACTGGGGGG - Intronic
1019162309 6:170076747-170076769 CCCAGGTGAGGAATACTCGAAGG + Intergenic
1024858203 7:53806258-53806280 CCCTGGACACTAATGCTCAGTGG - Intergenic
1025854738 7:65267131-65267153 CCCCAGATGGGAATACTCGGAGG + Intergenic
1027442182 7:78231310-78231332 CCATGGAGAGGAATACTCTTTGG + Intronic
1033113627 7:138605830-138605852 CCCTGGACCGCAATGCTGGGTGG - Intronic
1033407995 7:141089293-141089315 CACTGGACAGGCAGACTTGGAGG + Intronic
1037752171 8:21689811-21689833 CCCTGATCAGGAATCCTCAGGGG + Intergenic
1044124137 8:88437121-88437143 CCCTGCACTGGAATACCCAGTGG + Intergenic
1045047501 8:98293790-98293812 CCCGGGAGAGGAAGACTGGGCGG + Intronic
1046034937 8:108829476-108829498 CTCTGGCCAGGTATACTGGGGGG + Intergenic
1049778515 8:144417055-144417077 CCCTGGACAGGCAGCCTCGGTGG + Intergenic
1050740357 9:8812712-8812734 CTCTGGAGAGGAGGACTCGGTGG + Intronic
1058259053 9:102808153-102808175 CCCATGACAGGAACACTGGGAGG - Intergenic
1060982764 9:127803167-127803189 CCCTGGACTGGGGGACTCGGGGG + Intronic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1189251602 X:39604517-39604539 ACATGGAAAGGAATACTTGGAGG + Intergenic
1195762688 X:108263871-108263893 CCATGGACATGAAAACACGGAGG - Intronic
1197188595 X:123618830-123618852 CCCTGGACAGGAATACTCGGTGG - Intronic
1197705499 X:129631744-129631766 CCTTGCCCAGGAATACTCAGTGG + Intergenic
1197719557 X:129735875-129735897 CCATGGACTGGAATAGCCGGTGG - Intergenic