ID: 1197189861

View in Genome Browser
Species Human (GRCh38)
Location X:123634167-123634189
Sequence TTGTATATAAATATGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197189861 Original CRISPR TTGTATATAAATATGGGGGA AGG Intronic
901718895 1:11179339-11179361 TTTTATATAACACTGGGGGAGGG - Intronic
904847963 1:33435039-33435061 GTGTATATATGGATGGGGGAAGG - Intergenic
905779396 1:40694429-40694451 TTGTAAACAAAAATGAGGGAGGG - Intronic
905780768 1:40707190-40707212 TTTTATATATATATGGTAGAAGG + Intronic
906222431 1:44092000-44092022 TTCTTTTTAAATTTGGGGGAGGG - Intergenic
908356582 1:63329268-63329290 TTTTATGTTAAAATGGGGGAGGG - Intergenic
908745281 1:67370558-67370580 TGGTTTATAAACATGGGGGCAGG + Intronic
909128297 1:71703830-71703852 TCATATATAAATATTGGGGGGGG + Intronic
909872703 1:80763386-80763408 TTGTATTTAAATTTCAGGGAGGG + Intergenic
910308501 1:85795953-85795975 GTGTTTAAAAATATGTGGGATGG + Intronic
910562853 1:88611032-88611054 ATGTAAATAAAAATGAGGGAAGG - Intergenic
911009194 1:93261721-93261743 TAATATGTGAATATGGGGGATGG - Intronic
913245633 1:116867798-116867820 TTGTATAGAATTATAGGTGATGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
914460686 1:147880898-147880920 TTGTGTAGTAATATGGGGTAAGG + Intergenic
914573039 1:148937559-148937581 TTGTGTATATATTTGGGGGCTGG + Intronic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
917107656 1:171509595-171509617 CTGTATACAAATCTGGGGGCAGG - Intronic
917506220 1:175629494-175629516 CTGTATAGAGATGTGGGGGAGGG + Intronic
917694045 1:177501000-177501022 TTGTACATATTTATGGGGTATGG - Intergenic
917740532 1:177958099-177958121 TTCAAAATAAGTATGGGGGAAGG + Intronic
918340568 1:183565060-183565082 TTCAAAATAAAAATGGGGGAAGG + Intronic
919065770 1:192691420-192691442 CTGTATATAAAACTGGGGGTTGG - Intergenic
919211680 1:194495205-194495227 TTGTATTTTAAAATGGGAGAAGG - Intergenic
919342896 1:196336461-196336483 TTGTATATAATTATAGGCCATGG - Intronic
919392314 1:197002620-197002642 TTGTATGTAAAGATGGACGATGG + Exonic
920425822 1:205874423-205874445 TTGTATAGAATTATTGGTGATGG - Intergenic
920875943 1:209835906-209835928 TTGTATATAAATATAGGCACAGG - Intronic
923173341 1:231438019-231438041 TTGTACATATTTATGGGGTATGG - Intergenic
924141215 1:241025597-241025619 ATGAAACTAAATATGGGGGAGGG + Intronic
924919367 1:248611637-248611659 TTGTATATTTTTATGGGGTATGG - Intergenic
1063716035 10:8528136-8528158 CAATATATAAATTTGGGGGAGGG - Intergenic
1063796131 10:9515914-9515936 TTTCATATAAATTTGGGGGCTGG + Intergenic
1064069348 10:12212834-12212856 TTGCATATACATAATGGGGATGG - Intronic
1064360106 10:14656554-14656576 TTTTATACCAATGTGGGGGAAGG + Intronic
1065314732 10:24452057-24452079 TTTTATATAAATTTGGGGGTAGG + Intronic
1065508608 10:26455183-26455205 TTAAATATAAATATGGGCCATGG + Intronic
1068352029 10:55860781-55860803 TTTTATATTTTTATGGGGGAGGG - Intergenic
1068385332 10:56318845-56318867 TTATATATAATTAAGGGAGAAGG - Intergenic
1070467479 10:76738300-76738322 TTGTATACATTTATGGGGTATGG - Intergenic
1071275057 10:84046181-84046203 TATTTTATAAATATGGTGGAGGG + Intergenic
1072988816 10:100169483-100169505 TGGTATATAAATATATGGAAAGG + Intronic
1073716286 10:106111474-106111496 TAGTAACCAAATATGGGGGAGGG + Intergenic
1073753380 10:106555280-106555302 ATGTGTATAAATATGGAGGGAGG + Intergenic
1074477607 10:113786813-113786835 TAGCATATAAATATAGGGCATGG + Intergenic
1074764402 10:116690080-116690102 TTCTGTATAATAATGGGGGATGG + Intronic
1075049706 10:119174059-119174081 TTGTATCAAAAAATGGGGAAAGG + Intronic
1076330578 10:129662101-129662123 TTGTAAATAAGAATGGGGGTGGG + Intronic
1080223932 11:29938613-29938635 TTATATATTTATGTGGGGGAGGG - Intergenic
1080364933 11:31562873-31562895 ATATTTAGAAATATGGGGGAGGG - Intronic
1080953853 11:37069038-37069060 TTGTACATAAATATGATGGTAGG + Intergenic
1081833568 11:46135384-46135406 TTTGATATATATTTGGGGGAAGG + Intergenic
1082815418 11:57505024-57505046 TTGTCTATAAATGTTGGGGTTGG - Intronic
1082874513 11:57974249-57974271 TTGTTTATAAAAATAGGGGCAGG + Intergenic
1086491847 11:87363670-87363692 ATGTATATAAAAATGAGGAATGG - Intergenic
1086546695 11:88004029-88004051 TTTTATATATATATGGGAGAAGG + Intergenic
1087260075 11:96001525-96001547 TTGTATATGTGTTTGGGGGATGG - Intronic
1088344896 11:108811879-108811901 TTAATTATAAATATGGGGGGGGG + Intronic
1089144260 11:116312984-116313006 TTGGGGATAAAAATGGGGGAAGG + Intergenic
1089878019 11:121744812-121744834 TTGTAAAAAAATGTGGGGGGGGG - Intergenic
1090148327 11:124352757-124352779 AAGTATACAAATTTGGGGGAGGG + Intergenic
1090283557 11:125479546-125479568 TAGCATATAAATTTGGGGGGTGG - Intronic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1092580811 12:9838947-9838969 TAATATATAAATTAGGGGGAGGG - Intronic
1092891093 12:12969937-12969959 CTGTATATAAATACAGTGGAAGG - Intergenic
1094315585 12:29135286-29135308 TTGTATAGAATTATTGGTGATGG + Intergenic
1094678269 12:32643636-32643658 GCGTATATATATATGGGGAAAGG - Exonic
1094800916 12:34034886-34034908 ATGTATATTAATATGGCTGAAGG - Intergenic
1097378995 12:58873012-58873034 GTGGATGTAAATATGAGGGAAGG - Intronic
1099091634 12:78317699-78317721 TTGTACATATTTATGGGGTATGG + Intergenic
1099647686 12:85380370-85380392 ATGTATATAAATATATGAGAAGG + Intergenic
1099835681 12:87907911-87907933 TTGTATAGAATTATTGGTGATGG + Intergenic
1102597347 12:114002953-114002975 TTGTATTTGGAGATGGGGGAGGG - Intergenic
1102852086 12:116257290-116257312 GTGTATGTTACTATGGGGGAAGG - Intronic
1102928731 12:116846448-116846470 TTGTAGAGACATATGGGGCATGG + Intronic
1102939246 12:116924319-116924341 TTGTACATATTTATGGGGCACGG + Intronic
1104105946 12:125659413-125659435 TTGTATATGTATCTGGGGCAGGG + Exonic
1107112424 13:36712271-36712293 GTGTATATAAAGATGGGTGTGGG - Intergenic
1107273521 13:38649571-38649593 ATGAATATAAATAGAGGGGAGGG + Intergenic
1108196074 13:47996565-47996587 TGGAATATAATTATGGGGAAGGG - Intronic
1109861751 13:68208759-68208781 ATTTCTATAAATATGGGTGATGG - Intergenic
1112523140 13:100116613-100116635 TGGTATCTAAAAATTGGGGAAGG - Intronic
1112953079 13:105026531-105026553 ATGTATATTTATATGTGGGAAGG - Intergenic
1113306977 13:109089616-109089638 TTCTAAATCAATATGGGAGATGG - Intronic
1114234918 14:20815173-20815195 TTGTATAGAATTATTGGTGATGG + Intergenic
1115459330 14:33642274-33642296 TTTAATATTAATCTGGGGGATGG - Intronic
1115482518 14:33875290-33875312 TTTTATTTAATTTTGGGGGAGGG - Intergenic
1115765070 14:36614829-36614851 ATGTATATAAATATGGGTTAGGG + Intergenic
1116438544 14:44922985-44923007 TTGTACATACTTATGGGGTACGG - Intergenic
1116619990 14:47189209-47189231 TTCTATATATGGATGGGGGAGGG - Intronic
1117169203 14:53074411-53074433 TTGCTTTTAAATATGGGGGAGGG - Intronic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1119373444 14:74167706-74167728 TTTTTTATAGAGATGGGGGAGGG + Intronic
1119890733 14:78180153-78180175 TTTAAAATAAACATGGGGGAGGG + Intergenic
1120686119 14:87539914-87539936 TTGTTTATAAATAGATGGGATGG - Intergenic
1121808751 14:96858596-96858618 TTAGATATAAATATGGGGATAGG - Intronic
1121812324 14:96902125-96902147 GTGTCTGTAACTATGGGGGAGGG - Intronic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125063473 15:35453276-35453298 GTGTATATATATATGGAAGAAGG - Intronic
1125677276 15:41509155-41509177 TTGACTACAAAAATGGGGGATGG + Intronic
1125986721 15:44060425-44060447 TTGTAGATATATATGGTGCAGGG - Intronic
1126593684 15:50364974-50364996 TCCTACATAAAAATGGGGGAGGG - Intergenic
1127445049 15:59052966-59052988 TAATACATAAATATTGGGGATGG + Intronic
1128851191 15:70958518-70958540 ATGTACACAACTATGGGGGAAGG + Intronic
1129871352 15:78943941-78943963 TTTTAAATAAATAGGTGGGAAGG + Intronic
1130392149 15:83466416-83466438 ATATATATATATATGGGGAAAGG + Intronic
1131551588 15:93361998-93362020 CTGGAAATAAACATGGGGGAGGG - Intergenic
1132496999 16:268607-268629 TTGTCTATAAATCGGGGGGGAGG + Exonic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1134626015 16:15723348-15723370 TTATAAATAAATATGTGGGCCGG + Intronic
1137068880 16:35880876-35880898 TTCTATTTAAAAATGGGGGATGG - Intergenic
1138799371 16:60008338-60008360 TTCTATATAAAGATGATGGAAGG + Intergenic
1139176192 16:64691149-64691171 AAGTTTATAAATATGAGGGAGGG - Intergenic
1140731125 16:77857385-77857407 TTTTCTATAAATGTGTGGGAAGG + Intronic
1141202671 16:81909985-81910007 TTATATATATAAAAGGGGGATGG + Intronic
1143835133 17:9685697-9685719 TTGTACATATTTATGGGGTACGG + Intronic
1145908459 17:28529014-28529036 ATGTATATAAATGGGGAGGAGGG + Intronic
1148939629 17:51197104-51197126 ATATATATATATATGGAGGACGG + Intronic
1149080816 17:52654953-52654975 TTGTATATAACAATGGGGTTTGG + Intergenic
1149197940 17:54145480-54145502 TTGTTTATAAATTTGGTGCATGG + Intergenic
1149836021 17:59913550-59913572 TTGTCTTTCAGTATGGGGGAGGG + Intronic
1150177359 17:63073690-63073712 GAGTATATACATATGGGGGAGGG + Intronic
1150287198 17:63961098-63961120 CTGTATGTAAATATAGGGCACGG - Intronic
1153383181 18:4460976-4460998 TTGTATATATTTATGGAGCATGG + Intergenic
1155455566 18:26008474-26008496 TTTTATATAAAAAGGGGGCATGG + Intergenic
1155559836 18:27063847-27063869 TTGTATTCAAATCTGGGTGAGGG + Intronic
1156632162 18:38983327-38983349 TTGGATAGAAAGATAGGGGATGG - Intergenic
1157417811 18:47520662-47520684 TTTTATATATATATAGGGGAGGG - Intergenic
1157463938 18:47928529-47928551 TTGTGTAGGAATATTGGGGATGG - Intronic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1158802909 18:60933804-60933826 TTGTATAAAAATAAGAGTGATGG + Intergenic
1158814403 18:61077027-61077049 CTGAATATAAATATAGAGGATGG - Intergenic
1159332962 18:67025116-67025138 CTGTATTTAAATAAAGGGGAAGG + Intergenic
1159791757 18:72790292-72790314 TTGTTTATATTTATGGGGTACGG - Intronic
1160164583 18:76498803-76498825 CTGTATTTGAATATGGAGGAGGG + Intergenic
1163704643 19:18805015-18805037 TTTTATGTAAATATGAAGGAAGG - Intergenic
1164105013 19:22103360-22103382 TTATTTATAAAGATGTGGGAAGG + Intergenic
1166074325 19:40404895-40404917 CTGAATTTAACTATGGGGGAGGG + Intronic
1166430590 19:42723342-42723364 TTTTATATCTATATGGGTGAAGG + Intronic
1166592396 19:44011466-44011488 TTGTACATATATATGGGATATGG + Exonic
924970583 2:123671-123693 TTCTATATACAAATGGGGGCAGG - Intergenic
925791630 2:7494396-7494418 TTGTAGAAGAATATGGGAGAAGG + Intergenic
925994883 2:9283957-9283979 TAATATATGAATCTGGGGGAAGG + Intronic
926519610 2:13895036-13895058 TTGTATATGTATATGGTGGTTGG + Intergenic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
927662781 2:25006899-25006921 GTGTATATATTTATGGGGTATGG + Intergenic
928039476 2:27860594-27860616 GTATATATATATGTGGGGGAAGG + Intronic
928840645 2:35600324-35600346 TTGTAAATAAAGATGGGGGAGGG + Intergenic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
930250421 2:49028523-49028545 TTGGAGATAAATATGTGGCATGG + Intronic
930903539 2:56537318-56537340 TTGTATATGAATATGTGTTATGG - Intergenic
931076126 2:58714730-58714752 TTATAAATAACTATGGGGAAGGG - Intergenic
932158974 2:69443632-69443654 TTGTATAGAAGTATTGGTGATGG + Intergenic
932454759 2:71842350-71842372 TGGAAAATAAATATGGGGGCTGG - Intergenic
932804085 2:74768204-74768226 AAATATATAAGTATGGGGGATGG + Intergenic
939370106 2:141287945-141287967 TTATATATACATATGTGAGATGG - Intronic
940375894 2:152958085-152958107 TTATTTATAAAAATGGGTGATGG - Intergenic
940594985 2:155779732-155779754 ATCTACATATATATGGGGGAAGG + Intergenic
941187747 2:162338221-162338243 TTGTACATAAATATGAAGGGGGG + Intronic
941475519 2:165947161-165947183 ATATATATATATATGGGGGAGGG - Intronic
941957660 2:171220861-171220883 TTTTATTTAAATATGTGGGTAGG - Intronic
942207049 2:173629594-173629616 TTGTATATTAATATAAGAGAGGG - Intergenic
942237068 2:173921233-173921255 ATTTGTATAAAAATGGGGGAAGG - Intronic
942706358 2:178777048-178777070 TTCTATAAAAAGTTGGGGGAGGG + Exonic
942788766 2:179733945-179733967 ATATACATACATATGGGGGAAGG - Intronic
944344611 2:198647112-198647134 TTGTATTTGAATATTTGGGAGGG + Intergenic
946097240 2:217285797-217285819 TGGTATCTAAACATGGGGAATGG - Intronic
947328949 2:229008123-229008145 TTATGAATAAATAAGGGGGAAGG - Intronic
1168901411 20:1368217-1368239 TTTTATAAAAATGTTGGGGATGG + Intronic
1170324381 20:15140044-15140066 TTGTATAGAAAAATGTGGGTGGG + Intronic
1170456524 20:16538579-16538601 TTATAGATCAATATGGGGGGAGG + Intronic
1171287685 20:23955405-23955427 TTGTGTATAAATAGGGCAGAAGG - Intergenic
1173198425 20:40935101-40935123 TTATTTATATATTTGGGGGATGG - Intergenic
1175374161 20:58513510-58513532 TTGTTTAGAAATTTGGGGGCTGG + Intronic
1176926716 21:14758875-14758897 TTGTATCTACATAGGGGAGAGGG - Intergenic
1177030740 21:15980286-15980308 TTGTATAGAATTATTGGTGATGG + Intergenic
1177399726 21:20587273-20587295 ATATATATATATATGCGGGAGGG + Intergenic
1177399794 21:20587900-20587922 GTATATATATATATGGGGGCAGG + Intergenic
1177456156 21:21342752-21342774 TTGTAGATAAGTATGTGGGGTGG + Intronic
1180134418 21:45852892-45852914 TTTTATAGAAAAATGGGTGAAGG + Intronic
1182387807 22:29961179-29961201 AAGCATATAAATTTGGGGGAAGG - Intronic
1182503501 22:30765507-30765529 TTTATTATAAAAATGGGGGAAGG - Intronic
1183248864 22:36714077-36714099 TTGTTGATAAATGTGGGGTAGGG + Intergenic
1183932528 22:41244172-41244194 CTGTATATATATATGGGTGGGGG - Intergenic
1183991157 22:41597837-41597859 TGGTTTATAAAGATGGGGGAAGG - Intergenic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
952197650 3:31092964-31092986 TTGTTCACAAATCTGGGGGAAGG - Intergenic
952916496 3:38249164-38249186 TTTTATATAAATAATGGAGAGGG - Intronic
953693969 3:45143680-45143702 CTGGCTATCAATATGGGGGAAGG - Intronic
953725865 3:45398388-45398410 TTTTATGTACATATGTGGGATGG - Intronic
955127829 3:56131939-56131961 TTGTACATATTTATGGGGTACGG - Intronic
955767341 3:62358779-62358801 CTGAATATAAATATGGGGTGTGG + Intergenic
956151640 3:66249812-66249834 TTGTATATAAAGATGAATGAAGG + Intronic
956199300 3:66689775-66689797 TTGTTTATAAAAATGTGGGTTGG - Intergenic
957978021 3:87472435-87472457 TTCTAAATAAATTTGGGGAAGGG + Intergenic
959355164 3:105317552-105317574 TAGCATATGAATCTGGGGGAGGG + Intergenic
960906547 3:122607426-122607448 TTATCTATAAATATGGATGATGG + Intronic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962423634 3:135249931-135249953 TGGTAAATAATTGTGGGGGATGG - Intronic
963755883 3:149234843-149234865 TTGTAAAGAAGTATGGGGGAGGG + Intergenic
964130729 3:153283332-153283354 TTCCATAAAAATATGGGGAAGGG - Intergenic
964217135 3:154298315-154298337 ATGTTTATAATAATGGGGGAAGG + Intronic
964883666 3:161454026-161454048 TTGTACATATTTATGGGGGATGG + Intergenic
965596200 3:170413818-170413840 TTTTTTATAGAGATGGGGGAGGG - Intergenic
966468797 3:180263525-180263547 TTACATAAAAATATGAGGGATGG - Intergenic
967263723 3:187671419-187671441 TTGTATATCTATATGTGGAAAGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968937008 4:3616647-3616669 ATCTTTATAAATATGGGGGAAGG - Intergenic
970300401 4:14675412-14675434 TTGTAAATAAACATGGGGATGGG - Intergenic
970976350 4:22047184-22047206 TTATACATTAATATGGGGAATGG + Intergenic
971357144 4:25905465-25905487 TTGTATCTTAACATGGTGGAAGG - Intronic
971488462 4:27186646-27186668 TTTTATTTAAATTTGGGGGGTGG - Intergenic
971890378 4:32512400-32512422 TTGTACATATTTATGGGGGTAGG + Intergenic
972767995 4:42169457-42169479 TTGTATATAAATCCTAGGGAAGG + Intergenic
972779928 4:42278556-42278578 TTGCATTTAAATAATGGGGAGGG + Intergenic
972895821 4:43619077-43619099 TTGTAAAAAATTATGGAGGAGGG + Intergenic
973283180 4:48382887-48382909 TTGTCTGTAAATCTGTGGGATGG - Exonic
974095416 4:57358620-57358642 TAGTACATAAAAAAGGGGGAGGG + Intergenic
974807115 4:66894716-66894738 TTGTGTTTAAAAATTGGGGAAGG - Intergenic
975975183 4:80087594-80087616 TTTTATATATTTATGGGGTATGG - Intronic
977146441 4:93446969-93446991 TTGTATATAAATTTTGGAGTTGG - Intronic
977989637 4:103425268-103425290 TTTTAGATAAATAAGTGGGATGG + Intergenic
979403962 4:120286078-120286100 TTGTATTAAAATATTTGGGAAGG - Intergenic
979451301 4:120873987-120874009 TTGTACATATTTATGGGGTATGG + Intronic
980015725 4:127647801-127647823 TTGTATATAAATGTAGGAAAAGG - Intronic
980220991 4:129914983-129915005 TTGTATATATGTAAGAGGGAGGG - Intergenic
980662104 4:135874852-135874874 GTAGATATAAATATGGGGGATGG + Intergenic
981346251 4:143680209-143680231 ATATATATATATATAGGGGAAGG - Intronic
982875530 4:160644054-160644076 TTGATTTTAAATATAGGGGAAGG - Intergenic
982949359 4:161670184-161670206 TTGCATATACATATGAAGGAAGG + Intronic
984006893 4:174322714-174322736 TTCTATCATAATATGGGGGATGG - Intronic
984712067 4:182894166-182894188 TTGTGCATAGATTTGGGGGAGGG - Intronic
986098379 5:4582631-4582653 TCTTATATAAACATGGGGTAGGG + Intergenic
986920255 5:12671609-12671631 GTGTATATATGTGTGGGGGATGG + Intergenic
987151920 5:15050415-15050437 TTGTATATATTTATGGGGATGGG + Intergenic
988199614 5:28051594-28051616 TTGTATAGAATTATTGGTGATGG - Intergenic
989182173 5:38589301-38589323 TTGTAAAAAAACATGGGGAAAGG - Intronic
989192461 5:38684653-38684675 TTGGATCAAAATATGGTGGAAGG - Intergenic
989404151 5:41041661-41041683 GTATATATAAATGTGGAGGAAGG - Intronic
990470235 5:56108586-56108608 ATGTATACAAATATGAGTGAGGG + Intronic
990729925 5:58797018-58797040 TTGTTTGGAAATATGAGGGAAGG - Intronic
990966481 5:61454051-61454073 TTGAATAAATAAATGGGGGAAGG - Intronic
991722857 5:69509934-69509956 TTCTAATTAAATCTGGGGGAGGG + Intronic
992718165 5:79531864-79531886 TTTTATATATATATGGGGATGGG - Intergenic
992833366 5:80616915-80616937 TTTTATACAGAAATGGGGGAAGG + Intergenic
993332275 5:86615946-86615968 ACCTATGTAAATATGGGGGAGGG - Intergenic
994830711 5:104779291-104779313 ATGTGTATACATATGGGGGCAGG - Intergenic
995071925 5:107932998-107933020 TTGTATAGGAAGATGGGTGAAGG + Intronic
995727355 5:115195209-115195231 TTGTATATAAGTATGTGTGTAGG + Intergenic
995817264 5:116185289-116185311 CTAGATATAAATATGTGGGAAGG + Intronic
996073347 5:119160141-119160163 ATATATATATATATGGGGGGAGG + Intronic
996126541 5:119731930-119731952 TTGACTTTAAATATGGGAGATGG + Intergenic
996776211 5:127135465-127135487 GTGTGTTTATATATGGGGGAGGG - Intergenic
997153597 5:131526930-131526952 TTGTATATATAGAGGGGGGTGGG + Intronic
997567387 5:134899346-134899368 ATATATATAAATATATGGGATGG - Intronic
997780907 5:136657545-136657567 TTGTGTATAAATTTGAGGAAAGG - Intergenic
998164428 5:139834930-139834952 ATATATATATATATGGGTGATGG - Intronic
1000361498 5:160451860-160451882 TTGTATATATATGTGGGGGCGGG + Intergenic
1000402028 5:160839201-160839223 TTGTGTAAAAATTTTGGGGAAGG + Intronic
1000853398 5:166368717-166368739 TTGTACATATTTATGGGGTACGG - Intergenic
1001195051 5:169665374-169665396 TTATATATAAATATGGTAGTGGG + Intronic
1001739611 5:174041329-174041351 TTGTACATATGTATGGAGGATGG + Intergenic
1004739722 6:18447111-18447133 TTTTATATAAATAAGGGTAAGGG + Intronic
1005380408 6:25228612-25228634 TTGGTTCAAAATATGGGGGAGGG - Intergenic
1006621844 6:35370775-35370797 TTTTAGATAAATATGTGGAATGG + Intronic
1007133461 6:39498651-39498673 TTATGTATAAAAATGGGGGCTGG + Intronic
1007797367 6:44360820-44360842 TTGTTGAAAAATATTGGGGAAGG - Intronic
1008850728 6:56017929-56017951 TTATTTACAAATATGGAGGAAGG + Intergenic
1008933652 6:56966405-56966427 TTTTTTATAAATATGAGGGAAGG + Intronic
1010585937 6:77658683-77658705 TTGTATATAATGATTGGTGATGG + Intergenic
1010884920 6:81224483-81224505 TTGTAAATAAACATGTGGAATGG - Intergenic
1010923875 6:81719751-81719773 TTCTATATAAATATGAGAAATGG + Intronic
1011228162 6:85130523-85130545 TTATATAAAAATATTGGGGCTGG - Intergenic
1012673415 6:102085698-102085720 TTGTAAATATATATGAGGCAAGG + Intergenic
1013150682 6:107443034-107443056 TTGAATATAAATCCTGGGGAGGG + Intronic
1013247117 6:108297401-108297423 TTTTATTTAAAGATGGGGGCAGG - Intronic
1014178448 6:118355829-118355851 TTATTTATATATAGGGGGGAGGG - Intergenic
1014848304 6:126307737-126307759 TTGTATATAAACATATGTGAGGG - Intergenic
1015240927 6:131022423-131022445 TTGAATATAAAGCTGGTGGAGGG - Intronic
1015423370 6:133037137-133037159 GCTAATATAAATATGGGGGAGGG + Intergenic
1015634605 6:135263315-135263337 TGGTATACAAATGTGGTGGAAGG + Intergenic
1015746046 6:136510803-136510825 TAGTATATACATATAGGGGTTGG + Intronic
1017606792 6:156143465-156143487 TTTTATATATAAATGGGGCAGGG + Intergenic
1018104373 6:160468871-160468893 TTGTATATTAATATGTGAGTTGG + Intergenic
1018640586 6:165900588-165900610 GTGTATATACACATGGGGGTTGG - Intronic
1019067937 6:169318191-169318213 GAGTTTATAAAAATGGGGGAAGG - Intergenic
1019838563 7:3415687-3415709 TTATATATAAATATATGGTAAGG - Intronic
1019870730 7:3758365-3758387 TTGAATATATAAATGGGAGATGG - Intronic
1019945870 7:4328885-4328907 TTCAATATAAATTTGGTGGAGGG - Intergenic
1019979339 7:4609688-4609710 CTGTATTTTAATATGGGGGCCGG + Intergenic
1020547462 7:9550926-9550948 TTTTATATAAACATGGAGTACGG - Intergenic
1020751756 7:12149323-12149345 GTGTATATAATAATGGGAGAGGG + Intergenic
1021258903 7:18429437-18429459 TTTTCTATAAAAATGGGTGAAGG - Intronic
1024565810 7:50679638-50679660 TTCCATATGAAAATGGGGGAAGG - Intronic
1026952359 7:74356083-74356105 ATGTAGATAACTTTGGGGGATGG + Intronic
1027528151 7:79296986-79297008 TTGTACATATTTATGGGGTATGG - Intronic
1029237067 7:99129690-99129712 TTAGCTATAAAAATGGGGGAAGG - Intronic
1030649279 7:112099786-112099808 ATATTTATAAATATGAGGGAGGG - Intronic
1031795031 7:126162365-126162387 ATGTACATATATATGGGGTATGG + Intergenic
1032590105 7:133183940-133183962 GTGTGTATATATTTGGGGGAGGG - Intergenic
1032745913 7:134785827-134785849 TTTTATATGAACATGGGAGAAGG + Intronic
1034156982 7:148964053-148964075 TTGTGAATAAATATGAGGGCTGG - Intergenic
1037011831 8:13852946-13852968 TTATATATACATATGGCAGAGGG - Intergenic
1037053610 8:14408005-14408027 ATATGTATAAATAAGGGGGAAGG + Intronic
1037851019 8:22328427-22328449 TTGTATATGAATTTGAGAGAAGG + Intronic
1038023575 8:23570212-23570234 TTGTAAATAAAAAGGGGGAAAGG - Intronic
1039184493 8:34901406-34901428 ATATATATAAATATTGGAGAAGG + Intergenic
1039358569 8:36848868-36848890 CTGTATATATGTGTGGGGGAGGG + Intronic
1040389216 8:46935257-46935279 TTTAATATAGATATGGGTGAGGG + Intergenic
1041916997 8:63148023-63148045 TTGTATAGAATTATGAGTGATGG + Intergenic
1043268222 8:78294006-78294028 TTGTACAAAAATATTAGGGAGGG + Intergenic
1043509438 8:80934852-80934874 TTGTACATATTTATGGGGTATGG + Intergenic
1043868337 8:85400801-85400823 TTGTAAACAAATATCTGGGATGG + Intronic
1043959297 8:86397346-86397368 TTGTATATATTTATGGGGTATGG + Intronic
1044351870 8:91176107-91176129 ATATATATATATATGAGGGATGG - Intronic
1044975352 8:97659277-97659299 TTATTTATGCATATGGGGGAAGG - Intronic
1047580858 8:126213839-126213861 TTGAATAAAAATGTGGAGGAGGG + Intergenic
1049302686 8:141879926-141879948 TTGCATATAACTGTGGGGCAGGG + Intergenic
1050364398 9:4860861-4860883 TTGTATTTATATGTGAGGGATGG + Exonic
1052351094 9:27459012-27459034 TTGTCTTTAAACATGGGGGGGGG - Intronic
1054768909 9:69066872-69066894 ATATATATATATATGGGGGACGG + Intronic
1055141668 9:72883389-72883411 TTGTAGAAAAATATGAGAGAAGG - Intergenic
1056244988 9:84686025-84686047 ATGTGTATATATATGGGGGTGGG - Intronic
1057188538 9:93072705-93072727 ATGTGAATAAATCTGGGGGATGG + Intronic
1057955586 9:99404864-99404886 TTGTACATATTTATGGGGTAGGG + Intergenic
1058896286 9:109403536-109403558 TTTTAAATAAATTTGGGAGATGG + Intronic
1059476601 9:114552458-114552480 GTGTATATAAATTTTGGGTAGGG - Intergenic
1186130064 X:6456656-6456678 GTATATATATATATGGGGGTGGG + Intergenic
1186427428 X:9473996-9474018 TAGTCTCTAAATTTGGGGGAAGG + Intronic
1186505910 X:10091951-10091973 TTGTGTACAGATATGGGGAAAGG - Intronic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1188669115 X:32861514-32861536 CTGTTTATAAAAATGAGGGAAGG + Intronic
1191934243 X:66409271-66409293 TTGTATCTACATTTGGGGGCAGG - Intergenic
1193780236 X:85692634-85692656 ATATAAATAAATATGGGGGAAGG + Intergenic
1194538520 X:95140810-95140832 TTATATAAAAATCTGGGGGAGGG - Intergenic
1195318097 X:103698324-103698346 CTGTATATATGTGTGGGGGATGG + Intergenic
1195806456 X:108773145-108773167 TTATATATATTTATGAGGGAGGG - Intergenic
1196396480 X:115268024-115268046 GTGTTTATATGTATGGGGGAGGG - Intergenic
1196609078 X:117690368-117690390 TAATATATAAATTTGGGGGAGGG + Intergenic
1197125164 X:122936789-122936811 TTGTATATAATTATGGGGTAGGG + Intergenic
1197189861 X:123634167-123634189 TTGTATATAAATATGGGGGAAGG + Intronic
1197748362 X:129948123-129948145 TTGGATCTGAATGTGGGGGATGG + Intergenic
1198751421 X:139939972-139939994 TTATATAGAAATATGGGGCCGGG + Intronic