ID: 1197190853

View in Genome Browser
Species Human (GRCh38)
Location X:123646629-123646651
Sequence GTGTATGTATTTTCCCATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197190853_1197190857 14 Left 1197190853 X:123646629-123646651 CCTTTATGGGAAAATACATACAC 0: 1
1: 0
2: 2
3: 11
4: 215
Right 1197190857 X:123646666-123646688 ATTGGCAGGTTAAAAAGGTATGG 0: 2
1: 0
2: 1
3: 18
4: 165
1197190853_1197190855 0 Left 1197190853 X:123646629-123646651 CCTTTATGGGAAAATACATACAC 0: 1
1: 0
2: 2
3: 11
4: 215
Right 1197190855 X:123646652-123646674 TCAATTTGTTTTTAATTGGCAGG 0: 1
1: 0
2: 7
3: 77
4: 671
1197190853_1197190856 9 Left 1197190853 X:123646629-123646651 CCTTTATGGGAAAATACATACAC 0: 1
1: 0
2: 2
3: 11
4: 215
Right 1197190856 X:123646661-123646683 TTTTAATTGGCAGGTTAAAAAGG 0: 1
1: 0
2: 1
3: 31
4: 337
1197190853_1197190854 -4 Left 1197190853 X:123646629-123646651 CCTTTATGGGAAAATACATACAC 0: 1
1: 0
2: 2
3: 11
4: 215
Right 1197190854 X:123646648-123646670 ACACTCAATTTGTTTTTAATTGG 0: 1
1: 0
2: 2
3: 39
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197190853 Original CRISPR GTGTATGTATTTTCCCATAA AGG (reversed) Intronic
901372779 1:8814733-8814755 GTGTATATAGTTTCCAATACTGG + Intronic
901964226 1:12852911-12852933 CTGGCTGTATTTTCCCATAGGGG + Intronic
905003059 1:34688568-34688590 AAGTATGCATGTTCCCATAAGGG + Intergenic
906999569 1:50836648-50836670 GTATATGTATTTGGCCAGAAAGG - Intronic
908101380 1:60794798-60794820 ATGTATGTGTTTTCCCATTTAGG - Intergenic
908707253 1:66971920-66971942 ATGACTGTATTTTCCCACAAAGG - Intronic
909966259 1:81914600-81914622 CCGTATGTATTTTACCCTAATGG - Intronic
910256724 1:85255848-85255870 CTGTATTTGTTTTCCAATAAAGG + Intronic
911290219 1:96048379-96048401 GTGTATGTATTTTCTGTGAATGG + Intergenic
913355397 1:117915843-117915865 TTTTATGTATTTTCCTATCAAGG + Intronic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
916430300 1:164721443-164721465 GTGTGTGTATTTTCTTATACAGG + Intronic
917306028 1:173626407-173626429 GTGTATCTCTTTTCCCATTCTGG + Intronic
917798753 1:178551843-178551865 CTGTCTGTTTTTCCCCATAAGGG + Intergenic
918980234 1:191547982-191548004 GGGAATGTATTTTCAAATAAAGG - Intergenic
919018534 1:192072937-192072959 CTGGATATATTTTTCCATAATGG - Intergenic
919182190 1:194100914-194100936 GACTATGTACTTTACCATAAAGG - Intergenic
919700361 1:200625034-200625056 TTGTAGGTATTTTCCTAAAATGG + Intronic
921157754 1:212451513-212451535 GGGATTGTATTTTCCCAAAATGG - Intergenic
923428876 1:233900771-233900793 CTGCATACATTTTCCCATAATGG - Intergenic
924378978 1:243443738-243443760 GTGTCTGTCTGTTTCCATAATGG + Intronic
1063757772 10:9034493-9034515 GTGTATGAATTTTACCTTACAGG + Intergenic
1064633904 10:17344633-17344655 GTGTAGATATTTTCCCACGAAGG - Intronic
1068311680 10:55285442-55285464 GTGAATATATTTTCCATTAATGG + Intronic
1068435656 10:56988312-56988334 GTGAATTTATTTTCCCATCGTGG + Intergenic
1071950587 10:90699197-90699219 GTGGTTGTAATTTCCCATGATGG + Intergenic
1074333828 10:112547627-112547649 GTGGAAGTATATTCCTATAATGG - Intronic
1074594076 10:114843948-114843970 TTACTTGTATTTTCCCATAAAGG + Intronic
1076279729 10:129236138-129236160 GTCTATATAATTTCCCGTAATGG + Intergenic
1076772026 10:132671019-132671041 TTGGATGTCTTTTCCCGTAAGGG + Intronic
1079021395 11:16912104-16912126 TACTATGTATCTTCCCATAAAGG + Intronic
1080512976 11:32993534-32993556 GTGTATGAAGATGCCCATAATGG - Intergenic
1080995838 11:37600232-37600254 GTGTATGTTATTCCACATAAAGG - Intergenic
1082626531 11:55494267-55494289 GTGTATGTAATTTCCCCATATGG + Intergenic
1085554566 11:77408518-77408540 GTGTGTGTATTTCTCCATAGTGG - Intronic
1087557417 11:99738947-99738969 GTGTATGTATTTGTGGATAAGGG + Intronic
1088968393 11:114749280-114749302 GTGTATGTATATATGCATAATGG - Intergenic
1089791462 11:120947914-120947936 GTGTATCTATTTTCACTTACTGG - Intronic
1090072584 11:123556892-123556914 GTGTTTATAATTTCCCATAGAGG - Intronic
1091504510 12:1053436-1053458 GTGTATGTATTTTTTCATCGTGG + Intronic
1093791720 12:23258933-23258955 ATGTATGGAGTTTCCCATAAAGG - Intergenic
1096273758 12:50188263-50188285 CTGTATGTAATTTCCCAAAGTGG + Intronic
1096949032 12:55445266-55445288 AAGTATGTATTTTCCTGTAATGG + Intergenic
1097534757 12:60854370-60854392 ATATATGTATTTTCCCATTCTGG - Intergenic
1098085613 12:66839305-66839327 GTATACTCATTTTCCCATAATGG - Intergenic
1098263377 12:68694218-68694240 GTGCCTGTATTTTCCCAGAGTGG + Intronic
1099296512 12:80834806-80834828 GTTTATATAATTTTCCATAATGG - Intronic
1099515904 12:83596472-83596494 TTCTATGTATCATCCCATAAAGG - Intergenic
1099799641 12:87441327-87441349 GGGTATGTCTTTTATCATAAAGG + Intergenic
1101780977 12:107835206-107835228 GTGTATTTAGTTTACCATATTGG - Intergenic
1102120923 12:110440457-110440479 TTGTATGTGTTTTCCCTTTATGG - Intronic
1108285183 13:48899489-48899511 GTGTGTGTACTTTCCCTTCATGG + Intergenic
1108490531 13:50976979-50977001 GTGTATGTTATTTCCTATATTGG + Intergenic
1109859797 13:68181984-68182006 GAATATGCATTTTCCCATGATGG + Intergenic
1110769321 13:79320088-79320110 GTGTATGTATTTTACCATATGGG - Exonic
1111041493 13:82755586-82755608 GTGTATGTACGTCACCATAACGG + Intergenic
1111898852 13:94175899-94175921 ATATATATATTTTCCCAAAAGGG + Intronic
1115610310 14:35042656-35042678 ATTTTTGTATTTTCCCAGAAAGG - Intergenic
1116148857 14:41111450-41111472 TTGTATTTATTTTTCAATAATGG - Intergenic
1116466641 14:45240939-45240961 GTTTAAATATTTTCCAATAATGG + Intronic
1117364194 14:55009211-55009233 GTGTTTGTATTTTAGCATAATGG - Intronic
1120432890 14:84441986-84442008 GTGTATGGATTTTAAAATAAAGG - Intergenic
1123739000 15:23216945-23216967 GTGAATGTGTTTTCTTATAACGG - Intergenic
1124784899 15:32670606-32670628 GTGTGTTCATTTTCCCATTATGG + Intronic
1126149661 15:45512175-45512197 GTGTCTGTATTGTCCCATAATGG + Intronic
1126297674 15:47159224-47159246 GTGTCAGGATTCTCCCATAATGG + Intergenic
1126378662 15:48022916-48022938 CTGAATGTATTTTCATATAAAGG - Intergenic
1127837717 15:62804248-62804270 GTGTCTGTAGTTTCCCAGGATGG - Intronic
1135474530 16:22762597-22762619 GGGTATGAATTGCCCCATAAAGG + Intergenic
1136658102 16:31725498-31725520 CTCTATGCTTTTTCCCATAATGG + Intronic
1140520639 16:75578135-75578157 GTAAAAGTAATTTCCCATAAAGG - Intergenic
1146762810 17:35492950-35492972 GTGTTTTTTTTTTCCCCTAAGGG - Intronic
1147649199 17:42052315-42052337 CTGTCTGTCTTTTCCCATTATGG - Intronic
1149249425 17:54750822-54750844 GTGTAGGTATTCTCACATGATGG - Intergenic
1149943003 17:60891240-60891262 GTGGATGTATTCTCACATATGGG + Intronic
1156917381 18:42477628-42477650 ATGTATGTATCTTCACATTAGGG - Intergenic
1161728272 19:5943381-5943403 GGCGATGCATTTTCCCATAAAGG + Intronic
928057152 2:28068549-28068571 GTGTTTTTATTTTTCCAAAATGG - Intronic
929249949 2:39742269-39742291 GTGTATGTATTTGGATATAAGGG - Intronic
931851848 2:66259205-66259227 TTGTGTGTATTTTCCCTTGAGGG + Intergenic
933357366 2:81229063-81229085 ATAATTGTATTTTCCCATAAAGG - Intergenic
933390368 2:81659203-81659225 ATGTATTTATTGTCTCATAAAGG - Intergenic
933910463 2:86936328-86936350 GTGTTTGTATTATTCCTTAAAGG - Intronic
934022264 2:87967081-87967103 GTGTTTGTATTATTCCTTAAAGG + Intergenic
934236798 2:90239280-90239302 GTATTTGAATTTGCCCATAATGG + Intergenic
936414420 2:112291556-112291578 GTGTTTGTATTATTCCTTAAAGG - Intronic
937656624 2:124384333-124384355 ATGTATATATTTTTCCATATGGG - Intronic
939486595 2:142820434-142820456 GTCTTTGTGTTTTCCCCTAAGGG + Intergenic
939538716 2:143465558-143465580 TTGTATTTATTTTAGCATAAAGG + Intronic
939730184 2:145774744-145774766 ATGACTGTATTTTCCCACAAAGG + Intergenic
940040154 2:149351664-149351686 GTGTATGTATTGTTCCAGGAAGG + Intronic
940177554 2:150895486-150895508 GTGTATGTGTTTTACTTTAATGG - Intergenic
941018928 2:160387754-160387776 GTGTATGCATTTGCACATTATGG - Intronic
943192172 2:184692668-184692690 TTTTATTGATTTTCCCATAAGGG + Intronic
945622905 2:212164583-212164605 ATTTATTTATTTTCCCAAAATGG - Intronic
947885697 2:233568959-233568981 GTGTTTATCTTTTCCCTTAAAGG - Intergenic
1171161428 20:22927770-22927792 CTGTCTGTAATTTCCCACAATGG + Intergenic
1174509067 20:51037478-51037500 GTTTATGGATTTTTCCATCAAGG - Intergenic
1175023844 20:55880589-55880611 GTGTGTGTATTTTCCCAGCTTGG - Intergenic
1177473676 21:21591812-21591834 CTGTATGTATTTGCCTTTAATGG - Intergenic
1178481259 21:32981235-32981257 GCTTATTCATTTTCCCATAAGGG + Intergenic
1183806185 22:40213240-40213262 TTATATATATTTTACCATAATGG + Intronic
949257098 3:2061427-2061449 GTTTCTGTGTTTTCCAATAAAGG - Intergenic
949714485 3:6913482-6913504 TGGTAAGTATTTTCACATAACGG - Intronic
949851497 3:8425202-8425224 GTGCATCTATTTTCTCATATTGG - Intergenic
950913003 3:16614697-16614719 ATGTTTGTTTTTTCCCATGAAGG + Intronic
951630808 3:24717791-24717813 TTGAATGTGTTTTCCAATAATGG - Intergenic
951724643 3:25743578-25743600 GTGTGTGTCTCTTTCCATAATGG + Intronic
951934418 3:28005798-28005820 TTGTATTTTTTTTCCCATAGGGG - Intergenic
952162234 3:30705523-30705545 GTGTATGGAATTTCCCTTAAAGG - Intergenic
956946727 3:74231656-74231678 GTGTGTGCACTTTCCAATAATGG + Intergenic
957308936 3:78494128-78494150 TTGTATGCATTCTCCCAAAACGG - Intergenic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
960504356 3:118474546-118474568 TTGTGTGCATTTTCCCAAAAAGG + Intergenic
960518785 3:118631466-118631488 TCGTATGTATTTTCCAAAAATGG + Intergenic
960555803 3:119029159-119029181 GTGTGTGTATTATCCCCAAAAGG - Intronic
961745001 3:129059052-129059074 GGGTATGTATTTACCCATATGGG + Intergenic
962947974 3:140189448-140189470 GTGTATGTATTATCTCATTGTGG + Intronic
964119514 3:153168088-153168110 TGGTATGCATTTTCCCAGAATGG - Intergenic
964373613 3:156028092-156028114 CTGTATGTATTTTCCAATAGTGG - Intergenic
964774331 3:160258924-160258946 TTGTATTTATTTTCCCATCTCGG - Intronic
966654300 3:182337430-182337452 GTTTATCTATTTTCCTTTAATGG - Intergenic
967747385 3:193072388-193072410 GTGTATGTGTTTTACTTTAATGG + Intergenic
967762292 3:193240286-193240308 TTTTATGTATTTTGTCATAATGG - Intergenic
968814834 4:2816854-2816876 GTTTATGTCTATACCCATAAGGG + Intronic
969153205 4:5187659-5187681 GTGTAAATAGTTTCTCATAATGG + Intronic
969885003 4:10207588-10207610 GAGAATGTATTTTTCCAGAATGG + Intergenic
969971947 4:11057011-11057033 GTGAATCTATTTTTCAATAATGG + Intergenic
972004790 4:34087313-34087335 GTGTGTGTGTTTTCTCATATTGG + Intergenic
973927904 4:55758604-55758626 CAGTATGTGTTTTCCCACAAAGG + Intergenic
974072104 4:57133317-57133339 TTGTTTTTATTTTCACATAAGGG - Intergenic
975080852 4:70278774-70278796 GTGTATGTATTTCTCAATATTGG - Intergenic
975248437 4:72148135-72148157 GTGTGTGTATTTTCCCCAAATGG + Intergenic
976898293 4:90139283-90139305 CTGTATATATTTTCCCTTATAGG + Intronic
977373791 4:96173518-96173540 GAGTATGTTTATTGCCATAAAGG + Intergenic
977479554 4:97558120-97558142 CTGTGTGTATTTTATCATAAGGG - Intronic
977921575 4:102650074-102650096 GTTCATTTCTTTTCCCATAAAGG + Intronic
978113317 4:104989062-104989084 GTGTGTGTATTTTGCGATAAGGG - Intergenic
979700635 4:123663313-123663335 GTGTATATATTGTGGCATAAAGG - Intergenic
980195397 4:129581938-129581960 GTGAAATTATTTTCCTATAAAGG - Intergenic
981267882 4:142808089-142808111 GTGTGTGTATTTTATCATGAAGG - Intronic
981340133 4:143612306-143612328 TTGTATGAAATTTCTCATAAAGG - Intronic
982621084 4:157706697-157706719 TTATATGAATTTCCCCATAATGG - Intergenic
983293674 4:165838394-165838416 ATGTATATGTTTTCCCATAATGG - Intergenic
985248364 4:187998553-187998575 GTGTAGGCACATTCCCATAATGG - Intronic
985894722 5:2741449-2741471 GTGAATGTATTTTTCCTTAAAGG + Intergenic
986584120 5:9297058-9297080 TTTCATGTATTTTCTCATAATGG - Intronic
986966170 5:13274499-13274521 GTGTATGTGTTTGCCAATATTGG - Intergenic
990414754 5:55575454-55575476 GTGTGTGTATTGTTCCAGAAAGG + Intergenic
991087958 5:62665636-62665658 GAGTATTAATTTTCCCATAGAGG - Intergenic
991519221 5:67476937-67476959 GTGTGTGTGTTTCCTCATAATGG - Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
994335884 5:98565778-98565800 GTATATGTGTTTTCCTTTAAAGG + Intergenic
994501489 5:100584175-100584197 GTGTTTGTCTTTTCCCTTCAAGG + Intronic
994607655 5:101989812-101989834 GTGTTTATATTTTCCCTTCAAGG + Intergenic
996290671 5:121848634-121848656 GTGTATGTATATGTCCTTAAGGG - Intergenic
997784478 5:136696581-136696603 GTGTATGATTTTTCACTTAATGG - Intergenic
997883418 5:137610880-137610902 CTGTTTGTGCTTTCCCATAAAGG + Intergenic
998987465 5:147776586-147776608 GTTTAAATATCTTCCCATAATGG + Intronic
1003270716 6:4605560-4605582 GTGTATGTCTGTTTCCAAAAGGG - Intergenic
1004006672 6:11643189-11643211 GTATATTGATTTTCCCATCACGG + Intergenic
1005763534 6:28988913-28988935 GTGTGTCTTTTTTCCCATTAGGG - Intergenic
1006039541 6:31242727-31242749 TTGTATGTATTTTCCAAAGACGG + Intergenic
1007334838 6:41148236-41148258 ATGTATGTATTTGCCCATATTGG - Intergenic
1008273566 6:49517670-49517692 GTGTATGTATTTATACATACAGG - Intronic
1010356657 6:74942276-74942298 GTGTATGCATTCTACCAGAAAGG - Intergenic
1010653385 6:78480964-78480986 GTATATGTATTTGTTCATAATGG - Intergenic
1011920456 6:92569327-92569349 GTGTATGTATTTCCCATGAAGGG + Intergenic
1012096767 6:94972173-94972195 GTGTTTATATTTTCCCTTCAAGG + Intergenic
1014971881 6:127826808-127826830 GTGTATCTATTTTCCAAAGAGGG + Intronic
1015889777 6:137958757-137958779 CTGTATGTATTTTATCACAAGGG - Intergenic
1016271008 6:142290375-142290397 GTGTCTGTATATTCCCATCCTGG - Intergenic
1016511408 6:144847422-144847444 GTTTTTGTTTTTTCCCAAAAAGG + Intronic
1016901723 6:149109359-149109381 GTGTGTGTATTTTTGAATAAAGG - Intergenic
1018417801 6:163616315-163616337 GTGTGTGTATTTTTCTGTAAGGG - Intergenic
1019640517 7:2101175-2101197 GTGTATGAATGTTCCCACAGTGG - Intronic
1020452127 7:8332050-8332072 GTGTATCTATTTTTCCTTTATGG + Intergenic
1020488385 7:8747998-8748020 GAGTAAATATTTTTCCATAATGG + Intronic
1021126481 7:16855978-16856000 GAGAATGTATTTTACCATCATGG - Intergenic
1023087459 7:36585715-36585737 TTGTTGGGATTTTCCCATAAAGG - Intronic
1023402663 7:39801677-39801699 GTGTATAAATCTTTCCATAAGGG + Intergenic
1023802570 7:43847739-43847761 GTGACTGTATTTTCCCAAAGAGG + Intergenic
1024193704 7:47038240-47038262 GTGTGTGCATTTTCCAAGAATGG - Intergenic
1024312754 7:47984662-47984684 TTGTATATATTTTACCATACTGG + Intergenic
1024646959 7:51378955-51378977 GTGTATAAATCTTTCCATAAGGG - Intergenic
1027671738 7:81108147-81108169 GTGTATGTGTTTTCTTATAGAGG - Intergenic
1028125400 7:87107033-87107055 GTGTGTGTGTGTCCCCATAAAGG + Intergenic
1028715896 7:93967877-93967899 GTGTGTTTCTTTGCCCATAAAGG + Intronic
1031060195 7:117042830-117042852 TTGCATGAATTTTCCCTTAAAGG - Intronic
1031656096 7:124357689-124357711 GTCTATGTATTTCCCTAAAATGG - Intergenic
1031807249 7:126323038-126323060 GTGTATGTGTGTTTCAATAAAGG + Intergenic
1031984454 7:128154261-128154283 GTGTATCTATTTCCCTAGAAGGG + Intergenic
1032267044 7:130376889-130376911 GTGTTTGTATTTTCAGAAAAGGG - Intergenic
1033329769 7:140408292-140408314 GAGTATTTATTTTCTCATCATGG + Intronic
1035903557 8:3484563-3484585 GTTTATGGGCTTTCCCATAAAGG - Intronic
1036011140 8:4725999-4726021 TTGTAAGAATTTTCTCATAATGG + Intronic
1036946390 8:13099018-13099040 TTGTGTATATTTTCCCATAATGG - Intronic
1037021694 8:13979644-13979666 ATGTATGTATTTGCACATATAGG - Intergenic
1037736026 8:21566818-21566840 GTGTATGTATTTTTTTTTAAAGG - Intergenic
1038336402 8:26649137-26649159 GTTTATTTATTTTCCCAAATTGG - Intronic
1040642759 8:49358902-49358924 TTGTGTGTATTTTACCATATTGG + Intergenic
1041194908 8:55391534-55391556 GTGTATTTTTCTTCACATAAAGG - Intronic
1041612157 8:59863583-59863605 GTCAATATATTTTCCCATGAAGG + Intergenic
1042928249 8:73988739-73988761 GTGTTTCTAGTTTCCTATAATGG - Intergenic
1043424715 8:80137108-80137130 ATGTTTGTATTTTTCCAAAATGG + Intronic
1043984008 8:86672408-86672430 GTTTGTGTATTTTCTCAGAAAGG - Intronic
1044810341 8:96054503-96054525 ATGGAGGTATGTTCCCATAAAGG - Intergenic
1045832690 8:106483071-106483093 TTGTATTTCTTTTCCCCTAATGG - Intronic
1046121954 8:109858358-109858380 TTGTATTAATTTTCTCATAATGG - Intergenic
1046892148 8:119434267-119434289 GTGTAAGGTTATTCCCATAAAGG + Intergenic
1047150492 8:122256284-122256306 GTGTATGTATTTTTCCCAGATGG - Intergenic
1047325495 8:123831809-123831831 CTGTATGGATTTTCCCATTTTGG + Intergenic
1050674138 9:8032811-8032833 GTGTATGTATCTCCCCAGCATGG + Intergenic
1055263637 9:74470217-74470239 GTGTAGGTCTTTTCCCAAACTGG - Intergenic
1059578700 9:115520092-115520114 TTGTGTGTATTTTCAGATAACGG + Intergenic
1059591117 9:115663295-115663317 ATGTATGCATTTTACCTTAATGG + Intergenic
1060924860 9:127449200-127449222 GTGGCTGTGTTTTCCCTTAAAGG - Intronic
1188000498 X:24976008-24976030 GTGTATGTACTTTCTTATTAAGG - Intronic
1188746372 X:33849771-33849793 GTGTATGTATGTGCACAGAATGG - Intergenic
1189487112 X:41442484-41442506 GTGGTTTTTTTTTCCCATAAAGG - Intergenic
1191699476 X:64024218-64024240 GTCTATGAATTTTCTCATTATGG + Intergenic
1193482206 X:82041942-82041964 GTGTGTGTGTTTTCTTATAATGG + Intergenic
1193959245 X:87903079-87903101 GTGCATGGAATTTCCCATGAAGG + Intergenic
1195125185 X:101801919-101801941 GTCTAAGTATTTTCCCATGTGGG + Intergenic
1197190853 X:123646629-123646651 GTGTATGTATTTTCCCATAAAGG - Intronic
1199316509 X:146385053-146385075 GTGGATGTATTTTCTCCTAGAGG + Intergenic
1200381450 X:155841803-155841825 GTGTATTTATTTTGTAATAAAGG + Intergenic
1201864452 Y:18634196-18634218 GTGTGTGTGTTTCCCCATATGGG - Intergenic
1201868870 Y:18686182-18686204 GTGTGTGTGTTTCCCCATATGGG + Intergenic