ID: 1197195449

View in Genome Browser
Species Human (GRCh38)
Location X:123695106-123695128
Sequence TTATATATGACTAAGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197195449_1197195452 12 Left 1197195449 X:123695106-123695128 CCCTCTTTCTTAGTCATATATAA 0: 1
1: 0
2: 0
3: 30
4: 345
Right 1197195452 X:123695141-123695163 GAGAAAGAACCAAGAAGCTGAGG 0: 1
1: 0
2: 4
3: 42
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197195449 Original CRISPR TTATATATGACTAAGAAAGA GGG (reversed) Intronic
900809297 1:4789073-4789095 TTATATATGACTCAGATTTACGG - Exonic
901272376 1:7962210-7962232 TTTTTAATGACTGAGAAAGATGG - Intronic
901579943 1:10233994-10234016 ATATATATGGCTACCAAAGAGGG + Intronic
902328071 1:15715684-15715706 TAATATATGACTGGGAAAAATGG + Intronic
904099605 1:28013368-28013390 ATAATTATGAATAAGAAAGAGGG - Intronic
904152122 1:28450501-28450523 TAATAAAGGACTAAGAAAGATGG - Intronic
904550652 1:31314211-31314233 TTATATATTACTATCAAGGATGG + Intronic
906820600 1:48926195-48926217 TGAGATAAGACTAAGATAGAAGG + Intronic
909683245 1:78316345-78316367 TTCTATATAACTAAGACAAATGG - Intronic
911232635 1:95377136-95377158 TCTTATTTTACTAAGAAAGAAGG - Intergenic
911237157 1:95423795-95423817 TTATATGTGGCAAAGAAAGTGGG + Intergenic
911265610 1:95739642-95739664 TTCTACAGGACAAAGAAAGAGGG - Intergenic
912879756 1:113398614-113398636 TTACACATGACTATGAAAAATGG + Intronic
913184216 1:116353614-116353636 TAGGAGATGACTAAGAAAGAAGG - Intergenic
914964023 1:152237008-152237030 TTATATATGAGAGAGAGAGAGGG + Intergenic
915191055 1:154150788-154150810 TTATATATGCCTTATAAAGTAGG + Intronic
917416912 1:174820181-174820203 GTATATATGAAGAAGACAGAAGG + Intronic
917745922 1:178007113-178007135 TTATATAGGAAGAAGAATGAAGG + Intergenic
919019336 1:192084269-192084291 TTATGTCTAACTAAGAAAGAGGG + Intergenic
919335577 1:196227325-196227347 AGATATATGAATAGGAAAGATGG + Intronic
919467208 1:197936558-197936580 ATATATATTTTTAAGAAAGAAGG + Intergenic
920866900 1:209760486-209760508 TACTATATGACTGAGGAAGAAGG - Intronic
921950036 1:220920014-220920036 TTAGGTATTAATAAGAAAGAGGG + Intergenic
922076357 1:222248517-222248539 TTTTCTATGCCTAACAAAGATGG - Intergenic
923523383 1:234753561-234753583 TTACATTAGACCAAGAAAGAAGG + Intergenic
923638224 1:235722885-235722907 TTAATTAGGACTAAGAAATATGG + Intronic
1062788101 10:282146-282168 TTAAATCAGACAAAGAAAGATGG + Intronic
1063795798 10:9512844-9512866 TCGTATAGGACTAAGAAAGCAGG + Intergenic
1064002328 10:11674054-11674076 TAATAAATGACTAAGAATCAGGG - Intergenic
1065749526 10:28873087-28873109 TTATTTATGATTATGAATGATGG + Intronic
1067980341 10:51077303-51077325 ATATGTATGTTTAAGAAAGATGG - Intronic
1068252700 10:54464269-54464291 TTATAAATGACTAAAACAAAAGG + Intronic
1068385332 10:56318845-56318867 TTATATATAATTAAGGGAGAAGG - Intergenic
1069206109 10:65688207-65688229 ATGTATCTCACTAAGAAAGATGG + Intergenic
1070074035 10:73117615-73117637 TTACATATGTTTAAGAAAAAAGG + Intronic
1070759898 10:79017573-79017595 TTGTATATGACTAAGAATATTGG - Intergenic
1071464859 10:85929817-85929839 TTAAATATGATTAAGAAATATGG - Intronic
1071755919 10:88539073-88539095 TTCTAAAAGACTAAGGAAGATGG + Intronic
1071781404 10:88849891-88849913 ATATATATTTTTAAGAAAGAAGG - Intronic
1072254703 10:93610195-93610217 TTTTATAAGATTATGAAAGATGG + Intergenic
1074840176 10:117343618-117343640 TTATATTTGACAAGGAAAGCTGG - Intronic
1077760998 11:5097812-5097834 TTATAAATGTGTAAGAAAGAGGG + Intergenic
1079227113 11:18616278-18616300 TTCTATATGACTAAGCAAGTGGG + Intronic
1080110788 11:28565220-28565242 TTATATATGACTGTTACAGAAGG - Intergenic
1080229639 11:30005115-30005137 TTAGAAATGACTAATAAATATGG - Intergenic
1080252194 11:30246052-30246074 AGAAATGTGACTAAGAAAGAAGG + Intergenic
1080284501 11:30593440-30593462 TGGGATATGACGAAGAAAGAGGG - Intergenic
1082696833 11:56377581-56377603 TTTTATAGGACTAAGCAATATGG + Intergenic
1083117618 11:60478089-60478111 TTGTGTATGTCTAAGAAAGTAGG - Intergenic
1086393094 11:86386183-86386205 TTATATAAGACTATGAAGGAAGG - Intronic
1086587102 11:88465430-88465452 TTATTTATGACTGAGAAAAGAGG + Intergenic
1086590077 11:88504930-88504952 TTATAGATGTTTTAGAAAGATGG - Intronic
1086788836 11:91008515-91008537 TGATAAATTACTAAGAAAGAAGG - Intergenic
1087335923 11:96844674-96844696 TTATATCTTAGTAAGAATGAGGG + Intergenic
1088572706 11:111239047-111239069 TTATGTATCACTGAGAATGAAGG - Intergenic
1089407165 11:118207625-118207647 TTATAGATGACTACAAAAAATGG + Intronic
1089917368 11:122171271-122171293 TTATATATGAGTGAGAAAACAGG + Intergenic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090742729 11:129680329-129680351 TAATATAAGCCTAAGAAATAGGG + Intergenic
1090747611 11:129719971-129719993 TTATTGATGACTAGGAAGGAAGG - Intergenic
1091009604 11:131986836-131986858 TTATTTAAGACTAAGGAATAAGG - Intronic
1091048385 11:132346383-132346405 TTAAATAAGATTAAGTAAGAAGG - Intergenic
1092808186 12:12246942-12246964 TTGTTTTTGACTAAGAAAGTTGG - Intronic
1093187902 12:16042717-16042739 TTATATGGGACCAAGAAACAAGG - Intergenic
1093375613 12:18423705-18423727 TTGTATATGGATAAGAAATAAGG - Intronic
1094589017 12:31803725-31803747 TTATTTATGACTATGCAAGTGGG - Intergenic
1094732106 12:33188974-33188996 TTATATCTGTCCAAGAAACAGGG - Intergenic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095692280 12:45103814-45103836 TTCTCTTTGACTAATAAAGATGG + Intergenic
1096053284 12:48629717-48629739 TTCACTATGACTAAGAAATAGGG + Intergenic
1097041047 12:56156133-56156155 TTTTATATTACTAATAGAGATGG - Intronic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1098803275 12:74988372-74988394 TTATAAGTGACTAAGACATAGGG + Intergenic
1099566584 12:84256016-84256038 TTTTATATGTGTAAGCAAGAAGG - Intergenic
1101166829 12:102045984-102046006 TTAAGTATGATTAAGAAAGCTGG + Intronic
1101271287 12:103147992-103148014 TTCTGTATGACTAATAAAAAAGG - Intergenic
1104066501 12:125311219-125311241 TTCTCTATGACTAACAAACAGGG - Intronic
1105237379 13:18570849-18570871 TTATAAATGACAAAGCCAGAAGG - Intergenic
1107310134 13:39068131-39068153 TCATATATGTGTATGAAAGAAGG + Intergenic
1107763214 13:43704226-43704248 ATATATATGACTAAGATAACAGG + Intronic
1109033608 13:57226626-57226648 TTAACTATGACTAATAAAAAAGG + Intergenic
1109084180 13:57949579-57949601 ATATATATGAATAAGATAAAGGG - Intergenic
1109574750 13:64240332-64240354 TTATAGAAGACAAAGAAAGGAGG + Intergenic
1109877537 13:68426147-68426169 TTATATATGACAAATAAGGAAGG + Intergenic
1110297184 13:73881156-73881178 ATATATATGACTTATAAAAATGG - Intronic
1110616414 13:77547047-77547069 TTAGATATCAGTAAGAAAGAAGG + Intronic
1111398306 13:87697499-87697521 TTATATTTGAAGAAGACAGAAGG + Intergenic
1111600329 13:90465038-90465060 TTATAAATGATAAAGAAATACGG - Intergenic
1112545925 13:100370663-100370685 TTAAATATGCCTAGGAAAAAGGG - Intronic
1112600696 13:100852872-100852894 TCATTTATAACTAAAAAAGATGG + Intergenic
1113161418 13:107385598-107385620 ATATCTATGACAAAGAAAGGAGG + Intronic
1113213059 13:108004461-108004483 ATATATATCACTAGGAAAGCAGG - Intergenic
1114837329 14:26218551-26218573 TTATTTATGTGTAAGAAAAACGG - Intergenic
1114876611 14:26727567-26727589 ATATTTATGACTAAGATACAAGG - Intergenic
1114979938 14:28150163-28150185 TTATAAATTACTAAGAAGAAAGG + Intergenic
1114998094 14:28385287-28385309 TTATAAAGGACTAAGAATCATGG + Intergenic
1115147947 14:30248261-30248283 TGATATATAATGAAGAAAGAGGG - Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1117336907 14:54763722-54763744 GTACACATGACTAAGAAAGTCGG + Intronic
1117470119 14:56036149-56036171 TTATAAATGAGAAAGCAAGAAGG + Intergenic
1117858483 14:60062236-60062258 TTATACATGACTAGCAAATATGG - Intronic
1120667601 14:87325333-87325355 TTATATATGAATACCAAGGATGG + Intergenic
1123739570 15:23223397-23223419 TTTTATAAGACTAAGAGAAAAGG - Intergenic
1124290791 15:28452369-28452391 TTTTATAAGACTAAGAGAAAAGG - Intergenic
1124292445 15:28465189-28465211 TTTTATAAGACTAAGAGAAAAGG + Intergenic
1124669581 15:31626347-31626369 ATATATGTGACAAAGAAAGTAGG + Intronic
1124917605 15:33991743-33991765 TAACCTATGACTAAGAAACAAGG + Intronic
1124961813 15:34403817-34403839 TAATATATAACTAAGACTGAAGG + Intronic
1124978438 15:34550038-34550060 TAATATATAACTAAGACTGAAGG + Intronic
1125280658 15:38039197-38039219 ATATGGATGACTAAGAAAAATGG + Intergenic
1129571064 15:76684070-76684092 ATAAATATGAATAGGAAAGATGG + Intronic
1130242883 15:82213199-82213221 TTATATAAGACTAAGCCTGATGG - Intronic
1130457552 15:84128087-84128109 TTATATAAGACTAAGCCAGATGG + Intergenic
1130859332 15:87872717-87872739 TTATAGAAGACAATGAAAGAAGG - Intronic
1131306579 15:91249395-91249417 TTATCTATGAGTGAGAAAAAAGG - Intronic
1133536325 16:6705696-6705718 TTATAAATGAGAAATAAAGAGGG + Intronic
1135121546 16:19770588-19770610 AGAGATATGACTAAGAAAGAGGG - Intronic
1137221475 16:46455813-46455835 TTATAAATGACAGAAAAAGAAGG - Intergenic
1140651168 16:77090179-77090201 TTAAATAAGACTGATAAAGATGG + Intergenic
1140791879 16:78399657-78399679 TTATATAAGACTTGGAAAAAGGG + Intronic
1143831699 17:9657334-9657356 TTTTATATTACTAATAGAGATGG - Intronic
1145767275 17:27467413-27467435 ATATAGATGACTAAGAGAAATGG + Intronic
1146458781 17:33027214-33027236 GGAGATATGACTATGAAAGAAGG - Intronic
1149508655 17:57217944-57217966 AAATTGATGACTAAGAAAGAAGG - Intergenic
1153130277 18:1847982-1848004 TTCTCAATGACCAAGAAAGATGG + Intergenic
1154950710 18:21206794-21206816 TTATATATTAATAAGTAATATGG - Intergenic
1155866252 18:30968829-30968851 TTATTAATGAATAACAAAGAAGG - Intergenic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156371992 18:36479653-36479675 TAATATATGTCTAAGAATAATGG - Intronic
1157563710 18:48665445-48665467 TTATATAAAACTATAAAAGAAGG - Intronic
1159392577 18:67812489-67812511 TTATATATAACTAGGCCAGAAGG + Intergenic
1160087348 18:75789012-75789034 TTATATTTTACTAATAAAAATGG - Intergenic
1161642563 19:5433443-5433465 TTATACATCATTAAAAAAGAGGG + Intergenic
1165548150 19:36559754-36559776 TTATATATCAGTAAAACAGAGGG + Intronic
1166500127 19:43333817-43333839 AGATATAAGACTTAGAAAGAGGG + Intergenic
1168135774 19:54350051-54350073 TTAAACATGACTAAGAAAGCCGG - Intergenic
926449477 2:12984650-12984672 ATATATATCACTCGGAAAGAGGG - Intergenic
928077377 2:28277498-28277520 TTATATTTGCCAAAGAAACATGG + Intronic
928586757 2:32767143-32767165 GTATATTTGTCTAAGAAATAGGG + Intronic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
931049388 2:58393607-58393629 TTTTGTATGGTTAAGAAAGATGG + Intergenic
931149108 2:59553199-59553221 TTACATATTTCTAAGGAAGAAGG - Intergenic
931357158 2:61547380-61547402 TCATAAATAACTAAGAAATAGGG + Intergenic
932835825 2:75035728-75035750 TCATATATCCCTAAGGAAGAAGG - Intergenic
932945981 2:76231824-76231846 TTCTATGAGACTAGGAAAGAGGG - Intergenic
935400155 2:102651835-102651857 TTATATATGATCGAGAAAAAGGG - Intronic
937000340 2:118460223-118460245 TTATGAAGGACTAAGAAATAGGG + Intergenic
938047294 2:128133312-128133334 TTCTACATGACAAAAAAAGAGGG - Intronic
938512397 2:131963653-131963675 TTATAAATGACAAAGCCAGAAGG + Intergenic
938697346 2:133846384-133846406 TTACATATTACTAAGAAGTATGG + Intergenic
938697834 2:133850591-133850613 CTACATATTACTAAGAAATACGG + Intergenic
938946652 2:136218244-136218266 TGATATATGACTACAATAGAAGG - Intergenic
939021865 2:136966819-136966841 ATGTATAGGACTTAGAAAGAAGG - Intronic
939148397 2:138444218-138444240 ATATATATAAGTAATAAAGAGGG + Intergenic
939658474 2:144856955-144856977 TTTTATATGAACAAGAAAAATGG - Intergenic
940646749 2:156400011-156400033 TTATATATGACTAAGCTACAGGG + Intergenic
942372633 2:175301698-175301720 TTTCATGGGACTAAGAAAGATGG + Intergenic
942629479 2:177940010-177940032 TTATATATCTCTAAAACAGAAGG - Intronic
943266940 2:185743502-185743524 TTTTATATTACAAAGAAAAAAGG - Intronic
943267624 2:185755211-185755233 TTATAAATGATTAAGACAGCGGG - Intronic
945358939 2:208872168-208872190 TTATATAAGACTAAGGGAAAGGG + Intergenic
948277624 2:236721755-236721777 TCATAAAAGACAAAGAAAGATGG - Intergenic
948333848 2:237192835-237192857 TTATATTTTAATAGGAAAGATGG + Intergenic
1169469288 20:5869956-5869978 ATATATATTTCTAAGAAATAAGG - Intergenic
1170003408 20:11640014-11640036 TTACATATCAATAAAAAAGAAGG + Intergenic
1172171980 20:32941880-32941902 TTAGATATTACTAAAAATGATGG + Intronic
1172318791 20:33979529-33979551 TTTTATATCACTAAGTCAGATGG + Intergenic
1173017841 20:39242952-39242974 AGATATTTGACTAAGAAAAAAGG + Intergenic
1173377109 20:42495777-42495799 TTATATATGAAAAGGAAACATGG - Intronic
1176781366 21:13199131-13199153 TTATAAATGACAAAGCCAGAAGG - Intergenic
1177299985 21:19231074-19231096 TTATATATGTCTTGGAAATAAGG + Intergenic
1177547914 21:22582781-22582803 CTATATTTTACTCAGAAAGATGG - Intergenic
1177979063 21:27888268-27888290 TTATAAATGACAAAGCCAGAAGG - Intergenic
1178159671 21:29897186-29897208 TTATTAATGACTTAGAAAGTGGG + Intronic
1182759906 22:32713963-32713985 TTATGTGTGACTACGAAGGAGGG + Intronic
949582899 3:5408780-5408802 TTATATGGGACAAAGAGAGAGGG + Intergenic
950941052 3:16891866-16891888 TTAAAGATTACTAAGAGAGAAGG - Intronic
951224563 3:20106237-20106259 TTTTGTATGTCTAATAAAGATGG - Intronic
951254855 3:20437054-20437076 CCATATATGTCTAAGAAAGGAGG + Intergenic
951370985 3:21847525-21847547 TTTTAGATTACTAAAAAAGAGGG + Intronic
951568175 3:24033900-24033922 TTGTAAAAGACAAAGAAAGACGG - Intergenic
952781584 3:37105663-37105685 TTATATATTAATAAAAAAGCTGG + Intronic
955011578 3:55021733-55021755 TTAGAGATGAATAAGAATGAAGG - Intronic
955180350 3:56662302-56662324 TTAAATATGAAAAAGAAATAAGG + Intronic
955543553 3:60003256-60003278 CTATATATGGCTTAGAAGGAAGG - Intronic
955772026 3:62394848-62394870 AAATATATGACTAATAATGAAGG - Intergenic
955834076 3:63034961-63034983 GTATAAATGACTAATAAATAAGG - Intergenic
956684722 3:71815114-71815136 TAAAATATTACAAAGAAAGATGG - Intergenic
956984512 3:74682516-74682538 TTATTAATCACTAAGATAGAAGG - Intergenic
957192932 3:77033407-77033429 TTAAACATGACTCAGAATGAGGG + Intronic
957269771 3:78014457-78014479 TTATATGGGATTCAGAAAGAAGG - Intergenic
957945902 3:87062595-87062617 ATATAAATGACTAAGAATTAAGG - Intergenic
958476508 3:94590820-94590842 TTAAATATGAGAAAGAAAGGTGG - Intergenic
958705599 3:97650563-97650585 GTATATATGACTGAGCCAGATGG - Intronic
958804206 3:98790020-98790042 ATATATATTAACAAGAAAGAAGG + Intronic
958997943 3:100927381-100927403 TTATATATCACTTAGAAACCAGG - Intronic
959106737 3:102073292-102073314 ACAGATATGACCAAGAAAGAAGG - Intergenic
959311160 3:104739373-104739395 ATATATAACACTAAGAAAAATGG + Intergenic
960124139 3:113979629-113979651 TTAGAGAGGACTAAGAGAGAAGG - Intronic
960285020 3:115818755-115818777 ATATATATATATAAGAAAGAAGG + Intronic
960782829 3:121339003-121339025 TTCTAAAAGACTGAGAAAGAAGG + Intronic
961289934 3:125838474-125838496 TCTTTTATGACTAAGAAAGGTGG - Intergenic
962556720 3:136560216-136560238 TTATATTCAACTAAGAAAGAAGG + Intronic
962745242 3:138392734-138392756 TTATATGTGTCTTTGAAAGAAGG + Intronic
963833781 3:150035818-150035840 TCAAAAATGACTAAGAGAGAGGG + Intronic
964981869 3:162693114-162693136 TTATATATTACATAGAAAAATGG - Intergenic
965067972 3:163876988-163877010 TTACATATGACTTAAAAACAAGG - Intergenic
965799140 3:172473778-172473800 TTATATATAAAAAAGAAAAAGGG + Intergenic
966033871 3:175385895-175385917 TTCTATATGCCCAAGGAAGAGGG + Intronic
966089905 3:176120743-176120765 TTATATATCACTAAGACATTAGG + Intergenic
966233211 3:177671754-177671776 TTTAAAATGACTTAGAAAGAGGG - Intergenic
966367878 3:179210386-179210408 TTATATATACATAAGAGAGAAGG - Intronic
966453362 3:180087526-180087548 ATATATATGACTAATATATATGG + Intergenic
966584948 3:181612499-181612521 TTATATATTACTGAGAATAAAGG - Intergenic
966830674 3:184005584-184005606 TTATTTTTGACTAAAAGAGAGGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967617332 3:191586353-191586375 TAATATATTACTAATAAAGGAGG - Intergenic
968788918 4:2645828-2645850 TTATATTGTATTAAGAAAGACGG - Intronic
969007346 4:4031104-4031126 TCTTTTATGACTAAGAAAGGTGG + Intergenic
971246427 4:24933076-24933098 TCTTCTATGACTAACAAAGAGGG + Intronic
971621928 4:28865537-28865559 TGATTTATGAGTAAGAAAGCTGG - Intergenic
971642573 4:29154529-29154551 TTAAATAAGTCTAATAAAGAAGG + Intergenic
971836721 4:31774933-31774955 TTATATATCCCTCATAAAGAAGG + Intergenic
971839857 4:31836773-31836795 TTTTATAGTACTAAGAAAAATGG - Intergenic
972097801 4:35370103-35370125 CTATCTATGAATCAGAAAGAGGG - Intergenic
973029313 4:45315680-45315702 ATACAGATAACTAAGAAAGAAGG + Intergenic
973057285 4:45676961-45676983 CTAAATATGAATAGGAAAGAAGG - Intergenic
973153274 4:46914477-46914499 ATATATATGACAATTAAAGATGG + Intergenic
973177567 4:47226600-47226622 TTATATAAAACACAGAAAGAGGG + Intronic
974782446 4:66570877-66570899 TTAGATGTGACAATGAAAGAAGG - Intergenic
974782880 4:66576158-66576180 ATATATATGTCTAGCAAAGATGG + Intergenic
975154186 4:71052996-71053018 TTATAAATGAACAAGAAAGTAGG - Intergenic
976456067 4:85247858-85247880 TTATATAGGAAGAAGAATGAAGG - Intergenic
978238983 4:106492831-106492853 TGATATAAAACTAAGAAAGAGGG - Intergenic
978615394 4:110588366-110588388 TTATATAAGGATATGAAAGAAGG - Intergenic
978834002 4:113125689-113125711 TTATAAATGATTAAGACAGTTGG + Intronic
979958767 4:126990196-126990218 TAAAATGTGACTAAGAAAGCTGG - Intergenic
980479491 4:133369319-133369341 TTATATATGCATAAGGAACAAGG + Intergenic
980906578 4:138954077-138954099 TTATATATGAGTCAGAAGAAGGG + Intergenic
980939748 4:139262440-139262462 ATATATATAGCTAAGAAAGAAGG + Intergenic
981130226 4:141150327-141150349 TTGGATATGAGTATGAAAGAAGG - Intronic
982434506 4:155368356-155368378 TTACATACCACTAAGGAAGAAGG - Intronic
982503065 4:156183662-156183684 TTAAATCTGAATAATAAAGAAGG - Intergenic
982555035 4:156850879-156850901 TTATATATGGCAAAATAAGAAGG + Intronic
982810897 4:159824769-159824791 TTCTATTTGACTGTGAAAGATGG + Intergenic
983176264 4:164591401-164591423 TTATATAGGAACAAGAAAGTTGG + Intergenic
983244879 4:165276357-165276379 TCATTTATGACAAAGACAGAGGG - Intronic
986143803 5:5057442-5057464 TTATATTTTACCAATAAAGAGGG - Intergenic
986811441 5:11363867-11363889 ATATATATCATTAGGAAAGAAGG + Intronic
987044622 5:14095537-14095559 TCATATACTACTGAGAAAGAAGG + Intergenic
987678058 5:21101074-21101096 TTATATATTTATAAGAAAGAAGG + Intergenic
987775148 5:22355859-22355881 TTATTTATGACTAAACAATAGGG + Intronic
988441149 5:31234721-31234743 TAATAGAGGCCTAAGAAAGAAGG - Intronic
988997842 5:36731284-36731306 TTATATCTGTCTCACAAAGATGG - Intergenic
991062285 5:62390044-62390066 TTCTATATAACTAAGACAAATGG - Intronic
991473591 5:66996313-66996335 TTATATACGAATAAAAACGATGG - Intronic
991669029 5:69028704-69028726 ATATATATGACAAAGGAAGGAGG + Intergenic
992998860 5:82359658-82359680 TTATTTATTATTAAGAAATAGGG - Intronic
993040349 5:82807405-82807427 ATAAATATAACTAGGAAAGAGGG - Intergenic
993564526 5:89456844-89456866 TTATATATAAGTAAAAAATAAGG - Intergenic
993887501 5:93433165-93433187 TTATATCTCACTAAGAGATAAGG - Intergenic
995318703 5:110805812-110805834 TTATAAATGACCAACAAAGATGG + Intergenic
996235037 5:121116915-121116937 ATACAAATGACTAAGAGAGATGG - Intergenic
997319312 5:132964172-132964194 GTTTAAATGACGAAGAAAGAGGG - Intergenic
997331476 5:133065658-133065680 TTATATATGAGTAAGATGAAAGG - Intronic
999608366 5:153341944-153341966 TTCTATATTACTAAAAAAGGAGG + Intergenic
1000424839 5:161078525-161078547 CTATATATGTGTAAGCAAGAAGG + Intergenic
1000466200 5:161580670-161580692 TGATGTAAGACTAAGAATGAAGG - Intronic
1000810367 5:165854022-165854044 TTACATAACATTAAGAAAGATGG - Intergenic
1000868102 5:166539951-166539973 GTATATATTACTAAAATAGATGG - Intergenic
1003760006 6:9168846-9168868 TAATATATGACTAATAAATCAGG - Intergenic
1003975767 6:11342960-11342982 CTAAATATGAAAAAGAAAGAGGG + Intronic
1004113102 6:12739840-12739862 TTATATATCACTAAAAAATAAGG - Intronic
1004944926 6:20601926-20601948 TTATGTATGATTGAGAAAGGAGG + Intronic
1005095215 6:22107143-22107165 TTACACATGAATAAGCAAGATGG + Intergenic
1007343917 6:41213716-41213738 TTATCTGTGACTAAGACAGGGGG - Intergenic
1008685360 6:53920391-53920413 TTATACATCATTAAAAAAGAAGG + Intronic
1008766756 6:54926491-54926513 CTAAATATGACTGAGAAACAAGG + Exonic
1008866699 6:56220551-56220573 TTCTGTATAACTAAGAAAGATGG + Intronic
1009873214 6:69473757-69473779 ATATCTTTGACTAGGAAAGAAGG - Intergenic
1010011609 6:71053970-71053992 TTATTTAAGACTTAGAAAGAAGG + Intergenic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1011099087 6:83701777-83701799 TTAAAAATGAATAATAAAGAAGG + Intronic
1011947209 6:92920989-92921011 TTATTTTTGTCTAAAAAAGAAGG + Intergenic
1012145906 6:95681254-95681276 TTATAAATCAGTCAGAAAGAAGG - Intergenic
1012743278 6:103048330-103048352 TGATCTTTGACAAAGAAAGATGG - Intergenic
1012795340 6:103752655-103752677 TTATATTTCACTATGAAATAGGG - Intergenic
1012908878 6:105097361-105097383 TTATAAATGACCAAGAAAATGGG + Exonic
1013162988 6:107564050-107564072 TTATATAAGACAAAGAGAAATGG + Intronic
1013520917 6:110932724-110932746 TTATATTTAACTTAGAATGAAGG + Intergenic
1014874304 6:126637884-126637906 TTAAATATGACTAAGCAGGTTGG - Intergenic
1015821412 6:137265060-137265082 CTATATATGTCCAAGAGAGATGG + Intergenic
1016038452 6:139407216-139407238 TTTTATCTGACAAAGAAAGCAGG - Intergenic
1017372292 6:153726201-153726223 TTATATATGACTATGGAATGAGG - Intergenic
1019833392 7:3356585-3356607 TTTTATCTGACCAAGAAAGTAGG + Intronic
1020939611 7:14515682-14515704 TTCTAGATGACAAAGACAGAAGG - Intronic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1022291940 7:29013507-29013529 TTATATCTGCCTTAGAAAGATGG - Intronic
1023536905 7:41222996-41223018 TTAAAAATGACTAAGAAGAAGGG - Intergenic
1025061038 7:55808472-55808494 ATATATATTTCTAAGAAAAAAGG - Intronic
1026485883 7:70820636-70820658 ATATATATGTCTAGCAAAGAAGG + Intergenic
1027716053 7:81671586-81671608 ATATATAAGACTAAGACATAAGG + Intergenic
1028398022 7:90393521-90393543 TGAGATATGACTAACAAAAAGGG + Intronic
1028616178 7:92769758-92769780 TTACAAATTACTAAGAAAAATGG + Intronic
1028904889 7:96141783-96141805 TTATATGTTACCAAGAAAAAAGG + Intronic
1029796530 7:102900406-102900428 ATATATGTGACCAAGAAAAAAGG - Intronic
1029895938 7:103984682-103984704 TTATATAGGACTATGAAAATTGG - Intronic
1030237612 7:107283508-107283530 TCATATATCACTAACAAATATGG + Intronic
1030735296 7:113041106-113041128 TTATAGATGACTGAGAAAGTGGG - Intergenic
1030778457 7:113566538-113566560 TTGTACATGACTGAGAAATATGG - Intergenic
1031448147 7:121880331-121880353 TTATTCATTAGTAAGAAAGAAGG + Intronic
1031670301 7:124534870-124534892 TTCTATTACACTAAGAAAGATGG + Intergenic
1032163039 7:129525335-129525357 TTATGTACCACTAAGAGAGAAGG + Intergenic
1033304684 7:140215871-140215893 TTATATATGTCTAATCATGAGGG + Intergenic
1034297934 7:149990730-149990752 TTATCTCTGAGTAAGAAACAAGG + Intergenic
1034374241 7:150628781-150628803 TTAGATATGACTGGGGAAGAAGG + Intronic
1034384718 7:150730906-150730928 TTATTGATTACTGAGAAAGAAGG - Intronic
1034808090 7:154106123-154106145 TTATCTCTGAGTAAGAAACAAGG - Intronic
1039660092 8:39452027-39452049 TTCTATATGACTAAGAACATAGG - Intergenic
1040633952 8:49250092-49250114 CTTTATGTGACAAAGAAAGATGG + Intergenic
1041081047 8:54215275-54215297 TTAAAAAGGACTAGGAAAGAAGG - Intergenic
1041133408 8:54728577-54728599 TTATTTATTAAGAAGAAAGATGG + Intergenic
1042214920 8:66421437-66421459 AGATAAATGACTCAGAAAGAGGG + Intergenic
1042358294 8:67853725-67853747 TTATTTATGATTAAAAAATAAGG + Intergenic
1042662955 8:71175930-71175952 TGACATATGTTTAAGAAAGATGG + Intergenic
1042977341 8:74484503-74484525 TGATATATAGCTATGAAAGAAGG + Intronic
1043522630 8:81063064-81063086 TTATTCATGACTAAGAAAAGGGG - Intronic
1043874660 8:85471779-85471801 TTATATATTATTATGAAAAAAGG + Intronic
1044733567 8:95253810-95253832 CTATATATGCATAAGAAAGCAGG - Intronic
1045441689 8:102219730-102219752 TTATATATGTCTAAGGAAAAAGG + Intronic
1045690332 8:104753777-104753799 GTCTATATGACTAGGAGAGAAGG - Intronic
1046217532 8:111168720-111168742 TTTAATATCAGTAAGAAAGATGG + Intergenic
1046349097 8:112982790-112982812 TTTTATATTATTCAGAAAGAAGG - Intronic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1046647700 8:116803966-116803988 ATGTATATGACTAGGAAATACGG + Intronic
1047287209 8:123497428-123497450 TTAGATTTTAGTAAGAAAGAGGG - Intergenic
1048542244 8:135353215-135353237 TCATTTATGATTTAGAAAGAAGG - Intergenic
1048550176 8:135426768-135426790 TTATTTAGGAATAAGAAGGAAGG + Intergenic
1051540800 9:18215048-18215070 TTACATATTACTTTGAAAGAGGG + Intergenic
1051597019 9:18834402-18834424 TTATAAATGAATAACAAAGAAGG - Intronic
1051993300 9:23180418-23180440 TTATATATTGATAAGGAAGATGG - Intergenic
1052555646 9:30013264-30013286 TTAAATTTCTCTAAGAAAGAAGG + Intergenic
1055128662 9:72749783-72749805 TTTTACAGGAATAAGAAAGATGG + Intronic
1055358071 9:75458429-75458451 TTGTAAATGACTAGGAAAGGAGG + Intergenic
1055504827 9:76937348-76937370 GAATATATGACTTAGAAAAAAGG - Intergenic
1057667050 9:97054272-97054294 TTATATGTTATTAAGAAATAAGG + Intergenic
1057930949 9:99192455-99192477 ATTTATGTGACTAAGAAAAATGG + Intergenic
1058255639 9:102759434-102759456 TTTTGTATGACAAAGAATGATGG - Intergenic
1058395169 9:104544246-104544268 CTATCTCTGACTAAGAAATAAGG - Intergenic
1059870220 9:118564620-118564642 TTAAATATGAATAACACAGATGG - Intergenic
1062639853 9:137513529-137513551 TTATTTATGACTCAGGAATAAGG + Intronic
1186642879 X:11474530-11474552 TTCTGTATGACTAAGAAAAAGGG - Intronic
1186858089 X:13644866-13644888 TTACATATGCATAAGATAGAGGG + Intergenic
1186869649 X:13758129-13758151 TTTGATATGACTGAAAAAGATGG + Intronic
1187119143 X:16386754-16386776 TAATATATGACAAAGTTAGATGG - Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1187598772 X:20803485-20803507 ATATATATGAATAATAAAGTAGG + Intergenic
1188135224 X:26486093-26486115 TTATAAATAAATAAGAAATATGG - Intergenic
1188975788 X:36673889-36673911 TTATGTAAGACTAAAGAAGAAGG - Intergenic
1190766025 X:53476293-53476315 TGATATAAGAATAAGAAAGGGGG - Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193909927 X:87291697-87291719 TCATTTATGACTAAGAAGGTTGG - Intergenic
1194245141 X:91501378-91501400 ATTGATATTACTAAGAAAGAAGG + Intergenic
1195520980 X:105828272-105828294 TTAAACATGAGTATGAAAGATGG + Intronic
1195642431 X:107191296-107191318 TTATCTATGAATGAGAAATATGG - Intronic
1195815503 X:108881290-108881312 TTATTTATGACTCATAAATAAGG + Intergenic
1195990511 X:110677627-110677649 TTACATGTGAGTAAGAAAGGAGG - Intronic
1196742752 X:119039791-119039813 TTATATTTGTCTAAGGTAGAAGG + Intergenic
1197195449 X:123695106-123695128 TTATATATGACTAAGAAAGAGGG - Intronic
1197250655 X:124213207-124213229 TTATATATATATGAGAAAGAGGG - Intronic
1197953987 X:131927026-131927048 TTATACAAGACAGAGAAAGAAGG + Intergenic
1202164669 Y:21974390-21974412 TTTGATATGACTGAAAAAGATGG + Intergenic
1202226687 Y:22611984-22612006 TTTGATATGACTGAAAAAGATGG - Intergenic
1202316434 Y:23583678-23583700 TTTGATATGACTGAAAAAGATGG + Intergenic
1202554330 Y:26086380-26086402 TTTGATATGACTGAAAAAGATGG - Intergenic