ID: 1197199073

View in Genome Browser
Species Human (GRCh38)
Location X:123733133-123733155
Sequence GGGTGGAGAGGAAAGTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1676
Summary {0: 1, 1: 0, 2: 11, 3: 172, 4: 1492}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199073_1197199087 22 Left 1197199073 X:123733133-123733155 CCGCCCCACTTTCCTCTCCACCC 0: 1
1: 0
2: 11
3: 172
4: 1492
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1197199073_1197199082 -3 Left 1197199073 X:123733133-123733155 CCGCCCCACTTTCCTCTCCACCC 0: 1
1: 0
2: 11
3: 172
4: 1492
Right 1197199082 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1197199073_1197199079 -8 Left 1197199073 X:123733133-123733155 CCGCCCCACTTTCCTCTCCACCC 0: 1
1: 0
2: 11
3: 172
4: 1492
Right 1197199079 X:123733148-123733170 CTCCACCCAGCGGAAACCCGAGG 0: 1
1: 0
2: 1
3: 3
4: 73
1197199073_1197199086 12 Left 1197199073 X:123733133-123733155 CCGCCCCACTTTCCTCTCCACCC 0: 1
1: 0
2: 11
3: 172
4: 1492
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199073_1197199089 23 Left 1197199073 X:123733133-123733155 CCGCCCCACTTTCCTCTCCACCC 0: 1
1: 0
2: 11
3: 172
4: 1492
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199073 Original CRISPR GGGTGGAGAGGAAAGTGGGG CGG (reversed) Intergenic
900154944 1:1200207-1200229 AGGGGGAGAGGGAGGTGGGGGGG - Intergenic
900204837 1:1427418-1427440 GGGTGGAGAGGGGAGCGGGCGGG - Intronic
900344758 1:2205330-2205352 GGGTGGGGCGGAACGTGGGCGGG - Intronic
900420450 1:2553867-2553889 GGATGAAGAGGAAACTGCGGGGG - Intergenic
900552641 1:3264431-3264453 AGGAGGAGAGGAAAGGGGAGAGG + Intronic
900552655 1:3264483-3264505 AGGAGGAGAGGAAAGGGGAGAGG + Intronic
900871073 1:5303716-5303738 TGGAGGAGGGGAAAATGGGGAGG + Intergenic
900999346 1:6140651-6140673 GGGTGGACATGAATGTTGGGGGG - Intronic
901018561 1:6244962-6244984 AGGTGGAGGGGAAAGGAGGGAGG - Intronic
901061804 1:6475199-6475221 GGGTGGGAAGGAGGGTGGGGAGG - Intronic
901061820 1:6475236-6475258 GGGTGGGAAGGAGGGTGGGGAGG - Intronic
901193839 1:7428659-7428681 TAGTGGAGAGGACAGTGTGGGGG - Intronic
901402772 1:9025843-9025865 GGGTGGAGGGGGCAGTGGGGAGG - Intronic
901458413 1:9377005-9377027 GGGTGGGGCGGGAGGTGGGGCGG + Intergenic
901648473 1:10729100-10729122 GGGAGGAGAGGGAAGGGGTGGGG + Intronic
901763347 1:11484759-11484781 GGGTGGTAAGGACAGTGGGAAGG + Intronic
902063105 1:13661772-13661794 TGGGGGTGAGGAAGGTGGGGAGG - Intergenic
902083356 1:13836974-13836996 GGGTTCAGGGGAAGGTGGGGTGG - Intergenic
902182282 1:14698312-14698334 GGGTGGAGACCCAGGTGGGGTGG + Intronic
902188900 1:14746657-14746679 GGGTGGAGAGGGAGATGGTGAGG + Intronic
902364123 1:15959626-15959648 GGGAGGAGAGGAAGGGAGGGAGG + Intronic
902408587 1:16199849-16199871 AAGTGGAGGGGAAAGTAGGGAGG - Intronic
902906728 1:19563806-19563828 GGGTGGGGAGGAAAAGCGGGAGG + Intergenic
902959602 1:19953775-19953797 GGGTGGGGAGCAGAGTTGGGAGG - Intergenic
903014699 1:20354282-20354304 GGGTGGAGGGAAGGGTGGGGAGG + Intronic
903055194 1:20631485-20631507 GGCTGGAGTGGAGAGTGGAGTGG + Intergenic
903365790 1:22804871-22804893 GGGGAGAGAGACAAGTGGGGAGG - Intronic
903375924 1:22865969-22865991 GGGTGGAGGGGAGACTGTGGTGG - Intronic
903479093 1:23639986-23640008 GGGTTTTCAGGAAAGTGGGGAGG + Intronic
903542011 1:24101869-24101891 GTGTGAACAGGACAGTGGGGTGG + Intronic
903622475 1:24707836-24707858 GGGTGGAGGGGGAGGGGGGGTGG + Intergenic
903657225 1:24956810-24956832 GGATGGAGTGGAAAGGGGTGGGG - Intronic
903914099 1:26750570-26750592 GGGTGAGGAGGAAAGTGTGAGGG + Intronic
904038418 1:27570974-27570996 GGGGGGATGGGAGAGTGGGGGGG - Intronic
904326091 1:29727835-29727857 GGGTGGAGTGGAGAGTGGGATGG + Intergenic
904433449 1:30479538-30479560 GGGTGGAGGGAAGAGTGGGCTGG - Intergenic
904565393 1:31425440-31425462 CTGTGGGGAGGGAAGTGGGGCGG + Intronic
904622818 1:31785442-31785464 GGGTGGAGACAAGGGTGGGGAGG + Intergenic
904813334 1:33178340-33178362 GGAGGGAGAGGCAGGTGGGGTGG + Intronic
904950385 1:34233563-34233585 GGGAGGAGAGACAAGTGGAGTGG + Intergenic
905187912 1:36209957-36209979 AGGTAGAGAGGGAAGTGGGAGGG + Intergenic
905223479 1:36464661-36464683 GGGTGGAGAGGGGATTGGGTTGG - Intergenic
905256418 1:36688394-36688416 GGGAGGAGAGGGAGGAGGGGAGG + Intergenic
905404834 1:37725710-37725732 GGGTGGAGATGAAGGGGGGAAGG + Intronic
905433361 1:37940610-37940632 GGGTGGAGAGTCAACTGGGGTGG + Intronic
905463134 1:38134166-38134188 GGGAGGAGAGGAGAGAGGAGAGG + Intergenic
905524224 1:38624258-38624280 GGGTGGAGAGGAACTGGGGGAGG + Intergenic
905535813 1:38720980-38721002 AGGAGGAGAGGAAAGAGGAGAGG - Intergenic
905789162 1:40781317-40781339 GGGTGGAAAGGAAACTGCTGAGG + Intergenic
905806487 1:40881246-40881268 GGGTGGAGAGGAATGTGGCTGGG - Intergenic
905894661 1:41537672-41537694 TGGTGGAAAGTAAACTGGGGAGG + Intronic
905904083 1:41605156-41605178 GGGTGGAGAGGGGAGGGGAGGGG + Intronic
905914555 1:41675793-41675815 GGGTGTAGAGGAAAGTGTGCAGG + Intronic
905918104 1:41699792-41699814 GGGTGGGGAGGAAAGTGGTGGGG - Intronic
906055267 1:42911095-42911117 GGGTGTAGAAGAAAGAGGAGAGG + Intergenic
906175692 1:43770230-43770252 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
906175700 1:43770250-43770272 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
906509154 1:46401056-46401078 GGGAGGAGGGGAAATTGGGGAGG + Intronic
906509163 1:46401077-46401099 GGGAAGAGGGGGAAGTGGGGAGG + Intronic
906616415 1:47235621-47235643 GGGTGGCGAGGAGGGAGGGGAGG + Intergenic
906715436 1:47965208-47965230 GGGTGGAGGGGGGGGTGGGGGGG + Intronic
906909516 1:49932689-49932711 TTGTGGGGAGGAAAGTGGGTTGG - Intronic
907108575 1:51906137-51906159 GGATGGGTAGGAATGTGGGGAGG - Intergenic
907170620 1:52459926-52459948 GGGGGGAGAGGAGAGGGAGGAGG + Intronic
907303802 1:53503028-53503050 GGACAGAGAGGAGAGTGGGGAGG + Intergenic
907401429 1:54227186-54227208 GGGGGGTGAGGATTGTGGGGAGG + Intronic
907824230 1:57999954-57999976 GGGAGGAAAGGGGAGTGGGGAGG + Intronic
908212235 1:61912682-61912704 GGGAGGGGAGGGAAGAGGGGAGG + Intronic
908262447 1:62349514-62349536 GAGAGGAGGGGGAAGTGGGGAGG + Intergenic
908356880 1:63330512-63330534 CTGTTGAGAGGAAAGTGGGAGGG - Intergenic
908426148 1:64009398-64009420 GGGAGGCGAGGAAAGAGGTGTGG + Intronic
908561477 1:65310235-65310257 GGGTGGAGAAGAGAGGGGAGCGG + Intronic
908681998 1:66672545-66672567 GGGTGAAGAGGAGAGGGGAGAGG - Intronic
908796436 1:67834337-67834359 GGGTGGAGAGAAAAGAGGTGAGG + Intergenic
909177093 1:72374399-72374421 GGGAGGAGAGGAGAGGGGAGGGG + Intergenic
909583396 1:77262940-77262962 GGGAGGAGAGGACAGGGGAGGGG - Intergenic
910140415 1:84021030-84021052 GGCTGGAGGGGAAAGTGGAAGGG + Intergenic
910166861 1:84337257-84337279 GTGTGGAGGGAAATGTGGGGTGG - Intronic
910178065 1:84452486-84452508 AGGTAGAGAGGAAAGAAGGGGGG + Intergenic
910714123 1:90211949-90211971 GGGTGGAGAGGAATGAAGGAAGG - Intergenic
911158750 1:94661502-94661524 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
911995297 1:104758237-104758259 GGGTGGGGGGGAATGGGGGGAGG + Intergenic
912455209 1:109792449-109792471 GGGTGGAGATGAAGCTGAGGTGG - Intergenic
912703426 1:111895122-111895144 GGGAGGAGGGAGAAGTGGGGAGG + Intronic
912717015 1:111989986-111990008 GGGAGGAGAGGAGAGTCCGGGGG + Intergenic
912799033 1:112709855-112709877 GCGTGGAGTGGAAAGAGTGGGGG + Intronic
913272942 1:117111797-117111819 GGGTGTGGGGGAAGGTGGGGGGG + Exonic
913376995 1:118163634-118163656 GGATAGAGAGGAAAGAGGAGTGG - Intronic
914247684 1:145897924-145897946 GGGTTGAGAGGAAAGCAAGGAGG + Intronic
914450714 1:147788971-147788993 AGGTGAAGAGGAAAGTGAGGAGG + Intergenic
914716785 1:150260426-150260448 GGGTGGAAAGGAAGCTGGGTGGG + Intronic
914739210 1:150449558-150449580 GGAGGGAGAGGAAAGGAGGGAGG - Intronic
914756177 1:150562657-150562679 GAGGGCAGAGGAATGTGGGGAGG + Intergenic
914784746 1:150818060-150818082 GGGTGGAGAGGGAGGAAGGGGGG + Intronic
914875735 1:151511642-151511664 GGGAGGAGGGGAGATTGGGGCGG + Intronic
914876190 1:151514045-151514067 GGTTACAGAGGACAGTGGGGCGG - Intronic
914882192 1:151556005-151556027 GAGTTAAGAAGAAAGTGGGGGGG - Intronic
914958732 1:152187937-152187959 GGGTGGAGAAGAAATAGGGAGGG - Intergenic
915196440 1:154193373-154193395 GGAAGGAGTGGAAAATGGGGGGG + Intronic
915215677 1:154339234-154339256 GTGTGAAGAGGAGAGTTGGGAGG + Intronic
915426750 1:155833711-155833733 GAGGGAAGAGGAGAGTGGGGAGG + Intronic
915594499 1:156888399-156888421 TGGTGGAGAGGAAAGGAGAGCGG + Intergenic
915692518 1:157703853-157703875 GTGTGGAGATTTAAGTGGGGAGG + Intergenic
915974431 1:160375644-160375666 GGGTGGAGAGGGAAGGGAGGTGG - Intergenic
916577543 1:166081084-166081106 GGGCGGAGGGGAAAGTGGGAGGG - Intronic
916810199 1:168298780-168298802 GGGAGGAGAGGAGAGGAGGGAGG - Intronic
916878137 1:168992286-168992308 GGGAGAAGAGGGAAGTAGGGAGG + Intergenic
917061645 1:171048369-171048391 GAGGGGAGAGGAGAGTGGGAAGG - Intronic
917500436 1:175580097-175580119 TGCTGGGGAGAAAAGTGGGGAGG + Intronic
917643665 1:177008403-177008425 GAGAGGAGAGGAAGGGGGGGTGG + Intronic
917726976 1:177837608-177837630 GGGAAGAAAGGACAGTGGGGAGG - Intergenic
917895261 1:179481125-179481147 GTGGGGTGGGGAAAGTGGGGAGG - Intronic
918065076 1:181095088-181095110 GTCTGGAGAGGAAAGAGGAGAGG - Intergenic
918084498 1:181234126-181234148 GGGAGGAGAGAAAAGAGGGGAGG + Intergenic
918199365 1:182252892-182252914 GGCTGGAAAGGAAAGTAGGGAGG + Intergenic
918246128 1:182660952-182660974 GCTTGGAGAGGGATGTGGGGAGG + Intronic
918313728 1:183305315-183305337 GGATAGAGTGGAAGGTGGGGAGG + Intronic
918497502 1:185156810-185156832 GAGTGGGGAAGCAAGTGGGGAGG + Exonic
918543547 1:185657630-185657652 GGGAGGAGAGGAGAGGGGTGGGG - Intergenic
918722299 1:187868672-187868694 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
919411158 1:197245203-197245225 GTGGGGTGAGGGAAGTGGGGAGG - Intergenic
919724427 1:200872887-200872909 GGGTGGGCAGGAAAGAGGGGAGG - Intergenic
919739534 1:200973582-200973604 GGGTGGAGGACAAAGTGGAGGGG + Intronic
919785323 1:201254828-201254850 GAGTGGGGTGGAAAGTGGGCTGG + Intergenic
920126235 1:203695700-203695722 GGTGGGAGATGAAAGTGGGGGGG - Intronic
920161715 1:204003683-204003705 GGGAGGAGAGGAGAGTGGTTGGG + Intergenic
920222888 1:204417009-204417031 GGGAGGAGAGGGAAGGGGAGAGG + Intergenic
920309927 1:205043055-205043077 GGGTGGGGACGGAAGTGGGGTGG + Intergenic
920347992 1:205318924-205318946 AGGTGGAGAGAAAATTGGGATGG + Intronic
920379552 1:205527763-205527785 GGGGGAAGAGAAATGTGGGGTGG - Intronic
920518325 1:206603050-206603072 GGGGGAAGAGGAGAATGGGGAGG - Exonic
920556710 1:206909600-206909622 GGGTGGAGCTGGGAGTGGGGCGG - Intronic
920821965 1:209389742-209389764 GGGTGGAGAGGCAAGGATGGGGG + Intergenic
920832608 1:209479047-209479069 GGAGGGAGAGGAGAGAGGGGAGG + Intergenic
921056320 1:211545210-211545232 GGATGAGAAGGAAAGTGGGGAGG - Intergenic
921177656 1:212608317-212608339 GGGGGGCGGGGAAGGTGGGGAGG - Intronic
921238801 1:213155140-213155162 GAAAGGAGAGGAAAGTGGGGAGG - Intronic
921936404 1:220800897-220800919 GGGCAGAGAGGGGAGTGGGGGGG - Intronic
922218461 1:223539726-223539748 GGGTGGGGAGAAGACTGGGGAGG + Intronic
922222400 1:223618613-223618635 GTGTGGGGAGGGGAGTGGGGAGG + Intronic
922333887 1:224603073-224603095 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
922455513 1:225770818-225770840 GGGTGAAGGGGAAATTGGAGCGG + Intergenic
922580735 1:226695885-226695907 GGGAAGAGAGGGAAGCGGGGAGG + Intronic
922621517 1:226992060-226992082 GGGAGGAGAGGAGAGAAGGGTGG + Exonic
922726204 1:227924125-227924147 GGGTGTGAAGGCAAGTGGGGTGG - Exonic
922879389 1:228969308-228969330 GGATGGAAAGCAAAGTGGGGAGG - Intergenic
923482488 1:234397538-234397560 GGGAGGAGGGGAAAGAGGGAGGG + Intronic
923624959 1:235606454-235606476 GGGTGGAGAGCCAGGTGGTGAGG + Intronic
924726711 1:246678266-246678288 GGGTGGGGAGGAGAGGTGGGGGG - Intergenic
1062960958 10:1573421-1573443 GTGTGGAGCGGAAACTGGTGAGG + Intronic
1063037032 10:2296629-2296651 GGCTGGAGAGGAGGATGGGGAGG - Intergenic
1063123943 10:3124007-3124029 CGGTGGATAGGAGGGTGGGGCGG - Intronic
1063428249 10:5966108-5966130 GGGGAGGGAGGAAGGTGGGGTGG + Intronic
1063441310 10:6075593-6075615 GGGTGGAGGGGACTGTGGGGTGG - Intergenic
1063441317 10:6075610-6075632 GGGTGGAGGGGACTGTGGGGTGG - Intergenic
1063441324 10:6075627-6075649 GGGTGGAGGAGACTGTGGGGTGG - Intergenic
1063441329 10:6075644-6075666 GGGTGGAGGGGACTGCGGGGTGG - Intergenic
1063441343 10:6075678-6075700 GGGTGGAGGAGACTGTGGGGTGG - Intergenic
1063441348 10:6075695-6075717 GGGTGGAGGGGACTGCGGGGTGG - Intergenic
1063441355 10:6075712-6075734 GGGTGGAGGGGACTGGGGGGTGG - Intergenic
1063698042 10:8356615-8356637 GAGAGGAGAGGAAAGGAGGGAGG - Intergenic
1063847551 10:10148033-10148055 GGGTGGAGAGAATAAAGGGGAGG - Intergenic
1064010037 10:11728190-11728212 GGGTGGGGAGGAGATTGAGGAGG + Intergenic
1064082425 10:12319396-12319418 GGGAGGAGAGGGAAGGGGAGGGG - Intergenic
1064082437 10:12319421-12319443 GGGAGGAGAGGGAAGGGGAGGGG - Intergenic
1064231203 10:13529924-13529946 GAGTAGAGAGGAAAAAGGGGAGG + Intergenic
1064627151 10:17273171-17273193 GGGTGGTGAGGGTGGTGGGGAGG - Intergenic
1065103497 10:22355371-22355393 GGGCTGAGAGGAAGGTGGGATGG - Intronic
1065245110 10:23748537-23748559 GGGAGGAGAGGAGAGGGGAGAGG + Intronic
1065488367 10:26255912-26255934 GGATGGGGAGGAAGGAGGGGAGG + Intronic
1065856959 10:29838848-29838870 GGGTGAAGGGGGAAGGGGGGAGG + Intergenic
1066003384 10:31125302-31125324 GGGATGGGAGGAAAGTGGGGAGG + Intergenic
1066307561 10:34161293-34161315 GGGAGAAGAGGGGAGTGGGGAGG + Intronic
1066580893 10:36880862-36880884 GAGTGGAGGGAAAAGTGGGGAGG - Intergenic
1067227927 10:44387305-44387327 TGGAGCAGAGGAAAGTGGGGTGG + Intergenic
1067282477 10:44882896-44882918 GTGAGCAGAGGAAAGTGGCGTGG - Intergenic
1067544895 10:47185404-47185426 GCGCAGAGAGGAAGGTGGGGAGG - Intergenic
1067766614 10:49091938-49091960 CGATGGAGAGGAAAGTGGTGGGG + Intronic
1068229467 10:54153153-54153175 GGGTGGAAATGATAGTCGGGCGG - Exonic
1068794578 10:61064551-61064573 GGGTAGAGAGGGCAGTGTGGTGG + Intergenic
1069514355 10:69065801-69065823 GTGTGGAGTGGCAAGTGGAGAGG + Intergenic
1069567188 10:69471587-69471609 GGGAGGGGAGGGAAGAGGGGAGG - Intronic
1069830583 10:71280052-71280074 GGGTGCCCAGGCAAGTGGGGCGG - Intronic
1069903549 10:71719576-71719598 GCTTGGAGAGGGAAGTGTGGTGG - Intronic
1070091546 10:73290740-73290762 TGGTAGAGAGAAAAGTGAGGGGG + Intronic
1070129090 10:73644451-73644473 GGCTGGAGGGGAAGGTGGGATGG - Intergenic
1070416138 10:76191325-76191347 GGCTATAGAGGAAAATGGGGAGG - Intronic
1070660678 10:78303352-78303374 GGGAGGGGAGAAGAGTGGGGAGG - Intergenic
1070702463 10:78613550-78613572 GGGGGAAGAGGAAAGGGGGAAGG + Intergenic
1070837584 10:79459809-79459831 GAGGGGACAGGAAAGAGGGGAGG - Intergenic
1071618225 10:87095111-87095133 GGGCGGGGAGGAGAGTGGAGGGG + Intronic
1071867727 10:89755424-89755446 GGGAGGGAAGGAAAGGGGGGAGG - Intronic
1071867735 10:89755441-89755463 GGGAGGGAAGGAAAGGGGGGAGG - Intronic
1072296969 10:94018270-94018292 GGGGGAAGAGAAAAGTGGGAAGG - Intronic
1072394477 10:95024689-95024711 GGGGGGAGGGGGAAGGGGGGAGG + Intergenic
1072575201 10:96693274-96693296 GGGTGGGGTGGGAAGTTGGGGGG - Intronic
1072737523 10:97889132-97889154 GGGGGGAGGGGGAAGGGGGGAGG + Intronic
1072763269 10:98075798-98075820 CTTTGGAGAGGGAAGTGGGGAGG + Intergenic
1072983810 10:100122091-100122113 AGGTGGGGAGGAAAGAGGGGAGG + Intergenic
1073001444 10:100288966-100288988 GGGTGGGCAGGAGAGTGGTGAGG - Exonic
1073072550 10:100803739-100803761 CAGAGGAGAGGGAAGTGGGGAGG - Intronic
1073082537 10:100868997-100869019 GGATTGAGAGGAGGGTGGGGTGG + Intergenic
1073444971 10:103575159-103575181 GGGAGGGGCGGGAAGTGGGGCGG - Intronic
1073469563 10:103714361-103714383 GGGTGGGGAGGAAGGTGGCAGGG - Intronic
1073592167 10:104767723-104767745 GCGAGGAGAGGAAAGGGGAGGGG - Intronic
1073832457 10:107401584-107401606 GGGTGGAAAGGAAATGGGGATGG - Intergenic
1073857801 10:107697514-107697536 GGGAGGGGAGGGAAGGGGGGAGG - Intergenic
1073944498 10:108734709-108734731 AGGTGGAGTGGAGAATGGGGAGG - Intergenic
1074078467 10:110150271-110150293 GGGTGGAGGGCCAAGTAGGGTGG - Intergenic
1074101912 10:110360333-110360355 TGTGGGAGAGGAAAGTGGGTTGG - Intergenic
1074273947 10:111983246-111983268 GGGAGGTGAGGCAAGGGGGGAGG - Intergenic
1074346811 10:112694245-112694267 GGGTGGAGAGGGAGATGGGAAGG - Intronic
1074423256 10:113328056-113328078 AGGGGGAGAGGAAGGTGGGAGGG - Intergenic
1074524642 10:114253187-114253209 GAGGGGAGAGGAGAGAGGGGAGG - Intronic
1074768004 10:116714725-116714747 GACTGCAGAGGAAGGTGGGGTGG - Intronic
1074815643 10:117139596-117139618 GGGGGGAGAGGAGAGGTGGGAGG + Intergenic
1075045221 10:119141039-119141061 GGCTGGAGAAGACAGTGGGAGGG - Exonic
1075070049 10:119314496-119314518 GGCAAGAGAGGGAAGTGGGGTGG - Intronic
1075078994 10:119370226-119370248 GTGTGGCGGGGACAGTGGGGAGG - Intronic
1075112188 10:119596524-119596546 GGGTGGGGAGGAAGGGGAGGGGG + Intronic
1075274000 10:121077327-121077349 GGGTGGAGTTGGAGGTGGGGAGG - Intergenic
1075469614 10:122678221-122678243 GGGAGGAGAGGGAAGTAGGGAGG + Intergenic
1075566607 10:123509554-123509576 AGGTGGGGAGGAGAGTGTGGTGG - Intergenic
1075599915 10:123759961-123759983 AGGTGGAGAGGAGAGGGAGGGGG + Intronic
1075673684 10:124281467-124281489 GGGAGGACAGGGAAGTGAGGAGG + Intergenic
1075833336 10:125429844-125429866 GAGTGGAAAGGAAGGTGGGAAGG - Intergenic
1075922908 10:126227858-126227880 GAGTGGAGAGGACAGTGAGGAGG + Intronic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076469827 10:130710558-130710580 GGAGGGAGAGGACAGTGGAGCGG + Intergenic
1076575350 10:131462715-131462737 GGGTAGGGAGAAGAGTGGGGAGG - Intergenic
1076617052 10:131761961-131761983 GGGAGGAAAGGAAAGGGGAGGGG + Intergenic
1076762431 10:132612082-132612104 GAGGGGAGAGGGAAGTGAGGTGG + Intronic
1076778122 10:132709357-132709379 GGTAGGAGAGGAGAATGGGGAGG + Intronic
1076778391 10:132710572-132710594 GGGTGGACAGGTAGGTGGGGTGG + Intronic
1076778439 10:132710801-132710823 GGGTGGAGAGGTAGGTGTGCTGG + Intronic
1076888252 10:133272314-133272336 GGGGTGGGAGGGAAGTGGGGAGG - Intronic
1076907691 10:133371657-133371679 GGGTGGACAGCAAGGTGGGAAGG + Intronic
1077020167 11:413817-413839 GGGTGCAGGGGAAGGTGGGCAGG - Intronic
1077020192 11:413887-413909 GGGTGCAGGGGAAGGTGGGGAGG - Intronic
1077020222 11:413997-414019 GGGTGCAGGGAAAGGTGGGGAGG - Intronic
1077020270 11:414150-414172 GGGTGCAGGGAAAGGTGGGGAGG - Intronic
1077020326 11:414318-414340 GGGTGCAGGGAAAGGTGGGGAGG - Intronic
1077021470 11:418997-419019 GAGGGGAGAGGAGTGTGGGGTGG + Intronic
1077132027 11:977851-977873 GCGTGGAGAGGCATGTGGGCCGG + Intronic
1077231548 11:1460082-1460104 AGGTGGGGAGGGAAGGGGGGTGG + Intronic
1077297802 11:1834275-1834297 GGGTGGGAAGGAAGGTGGGGCGG - Intronic
1077473575 11:2776174-2776196 GGGTGGTGAGGAGAAGGGGGTGG - Intronic
1077648113 11:3944464-3944486 GAGTGGAGGGGGAAGTGGGATGG + Intronic
1077890707 11:6416174-6416196 GTGTGGAGATGAGAGTGTGGAGG - Intronic
1078451369 11:11443297-11443319 GGGTGGAGAGGTAGGAGGAGGGG - Intronic
1079361774 11:19776315-19776337 GGTTGGGCAGGAAGGTGGGGAGG + Intronic
1079401915 11:20112691-20112713 GGGTGGAGAGGAAAAAGGCCTGG + Intronic
1079470946 11:20776767-20776789 TGGGGGAGAGGAAAGGGAGGAGG + Intronic
1079510852 11:21208566-21208588 GTGCAGAGAGGAAAGTGGGGAGG - Intronic
1080306946 11:30846821-30846843 AGGTGGGGAAGAAAGTGGGTAGG - Intronic
1080387705 11:31819413-31819435 GGGTGGCGGTGAAGGTGGGGAGG + Intronic
1080438559 11:32268961-32268983 GGAAGGGAAGGAAAGTGGGGGGG + Intergenic
1080474679 11:32579051-32579073 TGGTGGAGAGGAAAGACGGAAGG - Intergenic
1080665123 11:34329358-34329380 GGGTGGAGTGGGAAGTGGGATGG - Intronic
1080826913 11:35856255-35856277 GGGTGGAAAGATTAGTGGGGTGG + Intergenic
1080826933 11:35856356-35856378 GGGTGGAAAGATTAGTGGGGTGG + Intergenic
1080826958 11:35856474-35856496 GGGTGGAGAGATTAGTGGGATGG + Intergenic
1080874124 11:36261265-36261287 GTGTGGGGAGGACAGTGGGGAGG - Intergenic
1081493425 11:43583665-43583687 GGAAGGAGGGCAAAGTGGGGGGG + Intronic
1081515233 11:43822474-43822496 GTGGGGTGGGGAAAGTGGGGAGG - Intronic
1081737107 11:45411748-45411770 GAGGGGAGAGGGAAGAGGGGAGG - Intergenic
1082043911 11:47709387-47709409 GGTTGTAGAGAAAAGAGGGGTGG + Intronic
1082076461 11:47979897-47979919 GGGAGGAGAGGAGGGTGGGTGGG + Intergenic
1082565800 11:54676772-54676794 GGATGGGGAAGAGAGTGGGGAGG - Intergenic
1082732538 11:56817807-56817829 AGGTGCAGAGGAGGGTGGGGAGG + Intergenic
1082818411 11:57526355-57526377 GGGTGGAGTGGACAGTAGGAGGG - Intergenic
1082897585 11:58208827-58208849 GACTGGAGAGGAAATGGGGGAGG + Intergenic
1082897702 11:58210091-58210113 GACTGGAGAGGAAATGGGGGAGG - Intergenic
1083308996 11:61775089-61775111 GGATGGACAGGAAAGAGGCGAGG - Intronic
1083332149 11:61903915-61903937 GGGGGGACAGGGAATTGGGGTGG - Intronic
1083389550 11:62337761-62337783 GGGCGGAGAGGAACGCGGGAGGG + Intronic
1083417790 11:62536511-62536533 GGGAAGAGAGGAAGGAGGGGCGG - Exonic
1083542971 11:63527526-63527548 GGTTGGAGGGGAAAGAGGGAGGG - Intergenic
1083701215 11:64478770-64478792 GAGTGGAGAGGAGAGAGGTGAGG - Intergenic
1083743340 11:64722534-64722556 GGGAGGAGAGGAGAGGGGGCTGG - Intronic
1083853204 11:65379603-65379625 GGGTGGAGAGGACAAAGGGGAGG - Intronic
1083877298 11:65531080-65531102 GGGAGGAGGGCAAAGTGGGGTGG - Intronic
1083881956 11:65553286-65553308 GGGTGAGGAGGGAACTGGGGAGG + Intronic
1083913025 11:65720972-65720994 GGGGAGGGAGGAAAGAGGGGAGG - Intergenic
1084032254 11:66487858-66487880 GTCTGGAGAGGGCAGTGGGGTGG - Intronic
1084079361 11:66810541-66810563 GGCTGGAGAGGAAAGATGGAGGG + Intronic
1084122573 11:67078016-67078038 GGGGCGGGAGGAATGTGGGGAGG + Intergenic
1084180926 11:67445480-67445502 GGGTGGGAAGGAAGGTGGGTGGG - Intergenic
1084358516 11:68654536-68654558 GGGTGTAGTGGGAAGTGGGGAGG - Intergenic
1084571676 11:69963438-69963460 GGGGGGAGGGGGAAGGGGGGAGG + Intergenic
1084647946 11:70471534-70471556 GTGAGGAGAGGAAAGCAGGGAGG - Intronic
1084742740 11:71150019-71150041 GGAGGGAGAGGAAAGGAGGGAGG + Intronic
1084742746 11:71150037-71150059 GGAGGGAGAGGAAAGGAGGGAGG + Intronic
1084742752 11:71150055-71150077 GGAGGGAGAGGAAAGGAGGGAGG + Intronic
1085547353 11:77332325-77332347 AGGGGGAGAGGGAAGAGGGGGGG + Intronic
1085717927 11:78889579-78889601 GGATGGAGAGGAAAGAGAGGAGG + Intronic
1085742838 11:79091765-79091787 GGGTGGAGATGAAATAGGAGAGG - Intronic
1085780365 11:79402633-79402655 GGGAAGAGAGGAGAGTGGGAGGG - Intronic
1085843131 11:80036895-80036917 GGGCGGAGAGCAAAGTGGAAAGG - Intergenic
1086046089 11:82533774-82533796 GGTGGGGGAGGAAGGTGGGGCGG - Intergenic
1086080770 11:82900608-82900630 GGCACGAGAGGAAAGTGGAGTGG - Intronic
1086133656 11:83425286-83425308 GGGAGGAGTGCAAACTGGGGTGG - Intergenic
1086306265 11:85484195-85484217 GGGTCGGGAGGAACGGGGGGCGG - Intronic
1087410756 11:97787689-97787711 GGGTGGAGGGGAGGGAGGGGAGG - Intergenic
1087479753 11:98684482-98684504 GGCTGGAAAGGGTAGTGGGGGGG - Intergenic
1088454984 11:110024065-110024087 AAGTGGGGAGGGAAGTGGGGAGG + Intergenic
1088454989 11:110024077-110024099 AAGTGGGGAGGGAAGTGGGGAGG + Intergenic
1088512512 11:110592689-110592711 GGGAGGAGAAGAAAGAGGAGAGG + Intronic
1088818228 11:113435636-113435658 AGGAGGAAGGGAAAGTGGGGGGG - Intronic
1089165161 11:116470257-116470279 GTGTAGGGAGGAAACTGGGGAGG + Intergenic
1089172654 11:116526138-116526160 GGGTGAAGAGGAGAGTGCAGGGG + Intergenic
1089188684 11:116638359-116638381 TTGTGGAGATGACAGTGGGGAGG - Intergenic
1089193401 11:116672701-116672723 GTGGGGTGAGGGAAGTGGGGAGG + Intergenic
1089255547 11:117192201-117192223 GGGTGGAGAGGGAAGTGGCTCGG - Intronic
1089294144 11:117458003-117458025 GGGAGGGGAAGAAAGTGGCGGGG + Intronic
1089403185 11:118176660-118176682 GGGGGGAGAGAAAAGGGGGATGG + Exonic
1089578045 11:119460500-119460522 GGGTGCAGGGGAAAGTGGTGGGG - Intergenic
1089745018 11:120610558-120610580 GGGTGGAGAGCACAGTGGGCTGG + Intronic
1089831092 11:121328910-121328932 GAGGGGAGAGGAAAGACGGGAGG - Intergenic
1089982075 11:122780760-122780782 GTGAGCAGAGGACAGTGGGGAGG + Intronic
1090029339 11:123194454-123194476 GGTTGGAGAGGAAAGGGGAGAGG - Intronic
1090227144 11:125078540-125078562 GGGTGGGGAGGAAAGGTGGGAGG + Intronic
1090327966 11:125904909-125904931 GGGTGGCTAGGAAAGTGCGCTGG - Intronic
1090374253 11:126277792-126277814 GAGAGGAGAGGACACTGGGGAGG - Exonic
1090427409 11:126618117-126618139 AGGAGGAGAGGGGAGTGGGGAGG - Intronic
1090494436 11:127196132-127196154 GGGTTGTGAGGTCAGTGGGGAGG - Intergenic
1090713965 11:129413685-129413707 GGGTGGAACGGAAAATGGTGGGG + Intronic
1091041500 11:132285277-132285299 GGGTGGAGAGGAAGGCTGGTGGG - Intronic
1091392084 12:131768-131790 GGGTGGGGAGGAAGGTGTAGGGG + Intronic
1091439029 12:498286-498308 TGGTGGAGAGGTAGCTGGGGAGG - Intronic
1091446338 12:546047-546069 GGGAGGAGTGAAGAGTGGGGAGG + Intronic
1091563159 12:1629804-1629826 GGGGGGAGAGGAGAGGGGGAGGG + Intronic
1091632327 12:2171341-2171363 GGCTGGAGAAGGGAGTGGGGTGG + Intronic
1091786457 12:3245891-3245913 GCGCAGAGAGGAAGGTGGGGTGG + Intronic
1091796334 12:3299413-3299435 GGATGGAGAGGAGAGAGGAGGGG - Intergenic
1091961478 12:4698779-4698801 GGCTGAAGAGGAAAGAGGGAAGG - Intronic
1092058251 12:5524605-5524627 GGGTGGAGTAGAAGCTGGGGAGG - Intergenic
1092085349 12:5753249-5753271 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
1092228880 12:6766258-6766280 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1092234361 12:6796982-6797004 AGATGGAGAGGAAAGGGGAGAGG - Intronic
1092237468 12:6819089-6819111 TGGTGGAGAGGATAGAGGGGTGG + Intronic
1092244007 12:6852837-6852859 GGGAGGGGAGGAAAGAGGAGAGG + Intronic
1092894891 12:13001447-13001469 GGGTGGGGAGGGGGGTGGGGCGG + Intergenic
1092986531 12:13851085-13851107 TGGTTGGGAGGAGAGTGGGGTGG - Intronic
1093000847 12:13993962-13993984 GGGAGGAAAGGAAAGAAGGGAGG + Intergenic
1093928237 12:24929958-24929980 GAATGGAGAGGAAAGTGATGTGG - Intronic
1094083685 12:26565867-26565889 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1094083693 12:26565887-26565909 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1094083716 12:26565952-26565974 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1094083819 12:26566434-26566456 AGAAGGAGAGGAAAGAGGGGAGG + Intronic
1095344714 12:41136474-41136496 GAAGGGAGAGGAAAGAGGGGAGG + Intergenic
1095628997 12:44352437-44352459 GTGGGGTGGGGAAAGTGGGGAGG - Intronic
1095743581 12:45633328-45633350 GGGGGGAGAGGAATGGGGGCTGG - Intergenic
1096107049 12:49002406-49002428 GAGTGGGGAGGATTGTGGGGAGG - Exonic
1096243062 12:49969652-49969674 GAGTGGAGAGGAGAGTGGTGTGG + Intronic
1096496947 12:52044175-52044197 GGGTGGAGAGGAGAGGAGGACGG - Intronic
1096592103 12:52667154-52667176 GGGAGGAGAGGGAAGGGGAGGGG + Intergenic
1096679655 12:53247116-53247138 GGGTGGAGAGGAGAGAGAGCTGG - Intergenic
1096682713 12:53267607-53267629 GGGGAGAGAGGGTAGTGGGGTGG - Intergenic
1096751174 12:53759812-53759834 GGGTGGAGGCGAGAGAGGGGAGG - Intergenic
1096771521 12:53938794-53938816 GGGTGGAGAGAAAAGAGGGGAGG + Exonic
1096843300 12:54391632-54391654 GGGTGGGCAGGGGAGTGGGGGGG + Intergenic
1097232428 12:57520787-57520809 GGGAGGGGAGGAAAGGGGGGCGG + Intronic
1097540457 12:60936328-60936350 GGGTGGGGAGAAAACTGGGTGGG + Intergenic
1097647912 12:62259466-62259488 AGGTGGAGAGGTGAGTGGAGAGG - Intronic
1097695361 12:62769851-62769873 GGCTGGAGGGGAAAGAGGGAGGG + Intronic
1098509959 12:71300124-71300146 GGGTGGAGAGGGAAGAGGAGTGG - Intronic
1098815916 12:75162108-75162130 GGGATGAGAGGAAAGAGAGGAGG - Intronic
1098882387 12:75929696-75929718 AGGTGGAGTGTAAAGTGCGGGGG - Intergenic
1099157542 12:79197377-79197399 GGGTGGGGAGGAAATTAGGATGG + Intronic
1099182277 12:79482529-79482551 GGGAGGAAGGGAAGGTGGGGAGG + Intergenic
1099286384 12:80717636-80717658 GTGTGGTGGGGAGAGTGGGGTGG + Intronic
1099325847 12:81213663-81213685 GGGTGGGGAGGGAAGGGGAGGGG - Intronic
1100362841 12:93894153-93894175 TGGTGTAGAGGAAAGAGGGTAGG - Intronic
1100693177 12:97061534-97061556 GGGTAGAGGGGAGAGTGAGGAGG + Intergenic
1101433577 12:104646222-104646244 AGGAGGAGGAGAAAGTGGGGTGG - Intronic
1101490633 12:105206404-105206426 GGATGGGGTGGAAAGTGAGGGGG + Intronic
1101640792 12:106584606-106584628 GGCTGGATATGGAAGTGGGGTGG + Intronic
1101673286 12:106896584-106896606 GGGAGGAGAGGAAGGGGGAGGGG + Intergenic
1101673295 12:106896604-106896626 GGGAGGAGAGGAAGGGGGAGGGG + Intergenic
1101761242 12:107660621-107660643 GGGTGTAGAGGAAAGCGCGGGGG + Intergenic
1102120256 12:110434680-110434702 GCTTGGGGAGGAATGTGGGGTGG + Intergenic
1102145350 12:110651066-110651088 GGGAGGAGAGGGAGGTGAGGGGG + Intronic
1102473862 12:113176001-113176023 GGGTTGTGGGGGAAGTGGGGAGG - Intronic
1102770336 12:115470679-115470701 GGGTGGGCAGGAAGGTGTGGCGG - Intergenic
1102848380 12:116213230-116213252 AGGTGGACAAGAAAGAGGGGAGG + Intronic
1102851192 12:116246792-116246814 GGGAGGGGAGGGAGGTGGGGAGG + Intronic
1103737187 12:123068084-123068106 GGGAGGTGGAGAAAGTGGGGAGG - Intronic
1103976691 12:124707283-124707305 AGGTGGAGAGGAAAGAGGGAAGG + Intergenic
1103986667 12:124772082-124772104 GGATGGAGAGACAAGTCGGGGGG + Intergenic
1104049377 12:125185892-125185914 GAGGGGAGAGGAGAGAGGGGAGG - Intergenic
1104645945 12:130497242-130497264 GGGTGGACATGACTGTGGGGAGG + Intronic
1104665680 12:130646054-130646076 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665687 12:130646078-130646100 AGGTGGAGAGGGAAGTGGTGAGG - Intronic
1104665690 12:130646090-130646112 AGGTGGAGAGGGAGGTGGAGAGG - Intronic
1104665698 12:130646114-130646136 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665705 12:130646138-130646160 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665712 12:130646162-130646184 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665719 12:130646186-130646208 AGGTGGAGAGGGAAGTGGTGAGG - Intronic
1104665722 12:130646198-130646220 AGGTGGAGAGGGAGGTGGAGAGG - Intronic
1104665730 12:130646222-130646244 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665737 12:130646246-130646268 AGGTGGAGAGGGAAGTGGTGAGG - Intronic
1104665747 12:130646282-130646304 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665754 12:130646306-130646328 AGGTGGAGAGGGAAGTGGTGAGG - Intronic
1104665780 12:130646390-130646412 AGGTGGAGAGGCAGGTGGTGAGG - Intronic
1104665787 12:130646414-130646436 AGGTGGAGAGGGAAGTGGTGAGG - Intronic
1104683240 12:130766955-130766977 GGGAGAAGAGGAAATTGGAGAGG + Intergenic
1104956742 12:132470453-132470475 GGGAGGGGAGGAGAGGGGGGAGG + Intergenic
1104971022 12:132530734-132530756 GGGGGGAGGGGGAAGGGGGGAGG + Intronic
1105060555 12:133146383-133146405 GGGTGGAGAGGAAACCTGGAGGG + Intronic
1105264327 13:18802843-18802865 GGGTGGAGTGGGTGGTGGGGAGG - Intergenic
1105487830 13:20854784-20854806 AGGTGGACAGGAGAGTGGAGAGG + Intronic
1105916822 13:24924545-24924567 AGGTGGAAAGGCTAGTGGGGAGG + Intergenic
1106208848 13:27622123-27622145 GCATGGAGAGAGAAGTGGGGAGG + Intronic
1106732239 13:32553537-32553559 GGTTGGTGGGGAAAGTGGGAAGG - Intergenic
1106799193 13:33239021-33239043 GGGGGGAGGGGGAAATGGGGAGG - Intronic
1107108684 13:36673734-36673756 GGGAGGAGGGGGGAGTGGGGAGG - Intergenic
1107373070 13:39773113-39773135 AGGTGGAGAGGTAAGAGGAGTGG - Intronic
1107423634 13:40272418-40272440 CCGTGGGGAGAAAAGTGGGGTGG - Intergenic
1107861147 13:44662018-44662040 TGGGGGAGAGGAGAGTGAGGGGG - Intergenic
1108039920 13:46330611-46330633 GTGTGAAGAAGAAAGTGGGGAGG - Intergenic
1108083379 13:46760326-46760348 AGGTGGAGAGGAGAGGGTGGAGG - Intergenic
1108299709 13:49061574-49061596 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1108455965 13:50613866-50613888 GGGAGGAGAGAAAAATGGAGAGG + Intronic
1108753776 13:53475633-53475655 AGGTAGAGGGCAAAGTGGGGAGG - Intergenic
1108808180 13:54186016-54186038 AGGTGGAGTGGAATGTGAGGTGG + Intergenic
1108841640 13:54624727-54624749 CAGAGGAGAGAAAAGTGGGGTGG - Intergenic
1109370668 13:61416090-61416112 GGGGGAAGGGGAAAGAGGGGAGG - Intronic
1109941929 13:69379657-69379679 GGGTGGGAAGGATTGTGGGGAGG - Intergenic
1110067134 13:71122466-71122488 GGATGGAGGGGAAAGTGAAGGGG + Intergenic
1110090584 13:71442174-71442196 GGTTAGTGAGGAGAGTGGGGAGG - Intronic
1110214850 13:73014058-73014080 GGGAGGAGAGGGGAGTGGAGGGG - Intronic
1110306033 13:73987753-73987775 GGGAAGAGAGGAAATTGGAGAGG + Intronic
1110369827 13:74727483-74727505 GGGAGGAGAGGAGAGGGGAGGGG + Intergenic
1111195205 13:84867358-84867380 GCCTGGAGGGGAAAGTGGGAGGG + Intergenic
1111329197 13:86742008-86742030 GGGGGGAGAGGAGAGGAGGGAGG + Intergenic
1111856181 13:93640715-93640737 GGGAGGGAAGGAAAGTGGGGAGG - Intronic
1111856190 13:93640739-93640761 GGGAGGGAAGGAAAGTGGGGAGG - Intronic
1111856199 13:93640763-93640785 GGGAGGGAAGGAAAGTGGGGAGG - Intronic
1111978979 13:94997070-94997092 AGGTGGAGAGGGAGGTGGAGAGG + Intergenic
1112441462 13:99427218-99427240 GGATGGAGGGGAGGGTGGGGGGG + Intergenic
1112477678 13:99747271-99747293 GGGTGGATAAGAAAGTGGGAGGG - Intronic
1112508043 13:99987138-99987160 GGAGGGAGAGGAAAGGGGGCAGG - Intergenic
1112790058 13:102993509-102993531 GGCTGGGGAGGAAAGCGGGGAGG - Intergenic
1112942605 13:104883476-104883498 TGTTGGAGAGGGAAGTGGGGAGG - Intergenic
1113033745 13:106025162-106025184 GGCTGGGAAGGAAAATGGGGTGG + Intergenic
1113104427 13:106757786-106757808 GGGTCGGGGGTAAAGTGGGGAGG + Intergenic
1113117099 13:106885330-106885352 GGGAGGAGTGGAAGGTGGGGAGG + Intergenic
1113117107 13:106885347-106885369 GGGAGGGGTGGAAGGTGGGGAGG + Intergenic
1113117113 13:106885364-106885386 GGGAGGAGTGGAAGGTGGGGAGG + Intergenic
1113179777 13:107612065-107612087 GGGGAGAGAGGGGAGTGGGGGGG + Intronic
1113257976 13:108528593-108528615 GGGAGGAGAGGAGAGGGGAGAGG - Intergenic
1113360115 13:109622933-109622955 GGGAGGGGAGGGGAGTGGGGGGG - Intergenic
1113509268 13:110839224-110839246 GGGAAGAGAGGAAAGGGGAGGGG - Intergenic
1113509294 13:110839284-110839306 GGGAGGGGAGGAAAGGGGAGGGG - Intergenic
1113513540 13:110873525-110873547 GGGCGGAGAGGCCACTGGGGAGG - Intergenic
1113754776 13:112803806-112803828 GGAAGGAGAGGAAGGAGGGGAGG - Intronic
1113759904 13:112840151-112840173 GGGGGGATGGGAGAGTGGGGAGG - Intronic
1113760013 13:112840503-112840525 GGGGGGATGAGAAAGTGGGGAGG - Intronic
1113939415 13:114010667-114010689 GCGTGGGGAGGGAAGTGGGGAGG + Intronic
1113966547 13:114156132-114156154 GGGTGGAGGGGTGGGTGGGGTGG + Intergenic
1114308236 14:21442669-21442691 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1114318200 14:21525844-21525866 GGGTGGGGAGGGAGGAGGGGAGG + Intronic
1114324021 14:21570793-21570815 GAGGTGAGAGGAAAGTGAGGGGG + Intergenic
1114466088 14:22923917-22923939 GGGTTTAGGGGAAAGTGGGTTGG - Intronic
1114607276 14:24007465-24007487 GGGTGGAGAGGGCCGTGGGGGGG + Intergenic
1115085978 14:29515267-29515289 GGCTGGGAAGGATAGTGGGGAGG - Intergenic
1115222922 14:31074815-31074837 GGGTGGAGGGGATAATGAGGGGG - Intronic
1115302415 14:31899409-31899431 GGGGACAGAGGAATGTGGGGAGG + Intergenic
1115399592 14:32941238-32941260 GGGAGGAGGGGAAAGGAGGGAGG - Intronic
1115782997 14:36791744-36791766 TGTTGGAGAGCAAAGCGGGGTGG - Intronic
1115797410 14:36954272-36954294 AGGTGGAGAGGCCAGTTGGGAGG - Intronic
1116628416 14:47297413-47297435 GGGAGGAGAGGGGAGTGGAGGGG + Intronic
1116770186 14:49118476-49118498 AGGCAGAGAGGAAAGAGGGGAGG - Intergenic
1116885093 14:50212808-50212830 GGGAGGACAGGGAAGTGAGGAGG + Intronic
1117316738 14:54578191-54578213 CAGTGGAGAGGCATGTGGGGTGG - Intronic
1117338077 14:54771774-54771796 GGTTGGAGATGAAGATGGGGCGG + Intronic
1118247492 14:64125490-64125512 GGGTGAAGAGGAGAGTAGGGAGG + Intronic
1118491323 14:66263506-66263528 GGGAGCATAGGAGAGTGGGGAGG - Intergenic
1118663169 14:68037177-68037199 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1118769282 14:68931049-68931071 GGGTGGAGCAGAAAGTGTGAGGG - Intronic
1118935925 14:70288287-70288309 GTGTAGAGAGGAAAGTGGTCTGG - Intergenic
1119184434 14:72629883-72629905 GGGTGGTGAAGAATGTGGGTAGG - Intronic
1119433912 14:74585724-74585746 GGGTGGGGAGGAGAGAAGGGAGG + Intronic
1119439786 14:74620422-74620444 TGGGGGAGAGGAAACTGGGTGGG - Intergenic
1119685528 14:76628002-76628024 GGGAGTAGAAGAAAGTGGAGTGG - Intergenic
1119768386 14:77205169-77205191 GGCTGGAGATGGAAGTGAGGGGG + Intronic
1119932057 14:78557021-78557043 GGGAGGAGAGGGAAGGGGAGGGG - Intronic
1120097832 14:80408935-80408957 GTGTGGAGAGGAAGGAGGGCTGG + Intergenic
1120761695 14:88291219-88291241 GGGTGGTGGGGAACGAGGGGCGG - Intronic
1121099816 14:91242665-91242687 GAGTGGATAGGTAAGTGGTGGGG + Intronic
1121377313 14:93424724-93424746 GGGTGGAGGGGCAATGGGGGAGG + Intronic
1122307412 14:100774404-100774426 GGGTGAGGAGGAAAGTGACGGGG + Intergenic
1122437913 14:101711996-101712018 GGGGGGAGATGACGGTGGGGGGG - Intergenic
1122631385 14:103109213-103109235 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631399 14:103109250-103109272 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631413 14:103109287-103109309 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631511 14:103109540-103109562 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122631568 14:103109685-103109707 GGGTGGAGAGGGAGGGAGGGAGG - Intronic
1122842339 14:104472577-104472599 GGCGGGAGAGGGAAGTGTGGTGG - Intergenic
1122890228 14:104728859-104728881 GGGAGGAGGGGACAGTGGAGTGG - Intronic
1123055554 14:105567671-105567693 GGGTGGACAGGGATGTGGGGTGG + Intergenic
1123079945 14:105687241-105687263 GGGTGGACAGGTGTGTGGGGTGG + Intergenic
1123079950 14:105687258-105687280 GGGTGGACAGGTGTGTGGGGTGG + Intergenic
1123434923 15:20247847-20247869 GGGAGGAGAGGGAGGAGGGGAGG + Intergenic
1123434928 15:20247864-20247886 GGGAGGAGAGGAGAGGGAGGAGG + Intergenic
1123434944 15:20247896-20247918 GGGAGGGGAGGAGAGGGGGGAGG + Intergenic
1123715790 15:23029896-23029918 GGGGGAAGAGCAAAGTGGGCTGG + Intronic
1124185596 15:27525525-27525547 GGGTGGGGGTGGAAGTGGGGAGG + Intronic
1124383950 15:29190586-29190608 GGGAGGGGAGGAAGGAGGGGAGG + Intronic
1124410810 15:29435069-29435091 GGGAAGAGGGGAAAATGGGGAGG - Intronic
1124479779 15:30068322-30068344 GGGTGAAGAGGTGCGTGGGGCGG - Intergenic
1124554652 15:30713143-30713165 GGCTGGGAAGGGAAGTGGGGAGG - Intronic
1124676596 15:31692537-31692559 GGCTGGGAAGGGAAGTGGGGAGG + Intronic
1125047536 15:35259667-35259689 TTTTGGAGAGGAAGGTGGGGAGG - Intronic
1125249141 15:37679238-37679260 GGGGGGAGTGGAGAGGGGGGAGG + Intergenic
1125578776 15:40771520-40771542 GGCAGAAGAGGAAAGTGGGAAGG + Exonic
1125593895 15:40872500-40872522 GAGGAGAGAGGGAAGTGGGGTGG - Exonic
1126096377 15:45093777-45093799 GCGTGGCAAGCAAAGTGGGGAGG - Exonic
1126104552 15:45139030-45139052 GGGTGGGGAGGAAAGGGGTGTGG - Intronic
1126613042 15:50549100-50549122 GGGTGGAGAGTGGGGTGGGGGGG - Intergenic
1126637255 15:50791652-50791674 GGCTGGAGAGGAAGGTCAGGAGG + Intergenic
1126695379 15:51321340-51321362 GGCTGGGAAGGAAAGTGTGGTGG - Intronic
1127226894 15:56940689-56940711 GGGAGGAGGGGAAAGGGGAGAGG - Intronic
1127490950 15:59462664-59462686 GGGCTGAGGGGAAAGTGGAGTGG - Intronic
1127586383 15:60382030-60382052 GGGAGGAAAGGAAAGAAGGGAGG + Intronic
1127892766 15:63269858-63269880 GGGGGTAGGGGAAGGTGGGGAGG - Intergenic
1128573326 15:68751907-68751929 GGGAGGAGAGGAGAGGGGAGAGG - Intergenic
1128573332 15:68751927-68751949 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
1128574118 15:68758589-68758611 GTGTGGAAAAAAAAGTGGGGGGG + Intergenic
1128731696 15:70025696-70025718 GAGTGGAGGGGAGAGTGGAGTGG + Intergenic
1128831913 15:70777224-70777246 GGGTGGAGAGGGTTGTGGGGAGG + Intergenic
1129031135 15:72618724-72618746 GAGAGGAGAGAAAAGAGGGGAGG + Intergenic
1129036279 15:72650482-72650504 GGGTGGAGAGGAAAAAGAGAGGG - Intergenic
1129150581 15:73685126-73685148 GGGTGGGGAGGGAATTGGGATGG + Intronic
1129160541 15:73745250-73745272 TGCTGGAGAGGAAAGGGGGTGGG - Intronic
1129213610 15:74086742-74086764 GGGTGGAGAGGAAAAAGAGAGGG + Intergenic
1129396793 15:75254343-75254365 GGGTGGAGAGGAAAAAGAGAGGG - Intergenic
1129400402 15:75278620-75278642 GGGTGGAGAGGAAAAAGAGAGGG - Intronic
1129681317 15:77659930-77659952 TGGTGGAGAGGAAAGGGGCGGGG + Intronic
1129692681 15:77722757-77722779 GGGTGTAGAGGAAAGAGGGCTGG + Intronic
1129759799 15:78122815-78122837 GGGTAGAGAGGAAAGCCGAGAGG + Intronic
1129820384 15:78597518-78597540 TCGTGGAGAGGGCAGTGGGGAGG - Intronic
1129902644 15:79163565-79163587 GGGGAAAGAGGAAAGTAGGGAGG - Intergenic
1130908556 15:88256181-88256203 AGGAGGAGAGGAGAGGGGGGTGG + Intronic
1130967065 15:88705446-88705468 GGGAGGAGAGGAGAGGGGAGGGG + Intergenic
1131097134 15:89663325-89663347 GGGTGGGGAGGGAAGATGGGGGG - Intergenic
1131106236 15:89736739-89736761 GTGGGGAGGGGAAAGTGGTGTGG + Intronic
1131203966 15:90425866-90425888 TGCAGCAGAGGAAAGTGGGGTGG + Intronic
1132045263 15:98558061-98558083 GGGTGGGGAGGAGAGCGTGGGGG + Intergenic
1132351506 15:101142308-101142330 GGGTGGATAGGTGAGTGGAGGGG - Intergenic
1132434017 15:101781994-101782016 GGGTGGGGAGGGAGGTGGGGTGG + Intergenic
1132478213 16:153081-153103 GTGGGGAGGGGACAGTGGGGAGG + Intronic
1132478229 16:153137-153159 GTGGGGAGAGGACAGTGAGGAGG + Intronic
1132480171 16:163335-163357 GTGGGGAGAGGACAGTGGAGAGG + Intronic
1132480304 16:163713-163735 GTGGGGAGAGGACAGTGAGGAGG + Intronic
1132628102 16:901933-901955 GGGTGGAGAGCAGTGGGGGGTGG + Intronic
1132668952 16:1094935-1094957 TGGGGGAGAGGAAAGAGGGGAGG + Intronic
1132716502 16:1292679-1292701 GGGGGGAGAGGAAAGGAGAGGGG - Intergenic
1132855464 16:2042827-2042849 GGGTGGAGAGGGAGGTGCTGCGG - Intronic
1132929925 16:2453919-2453941 GGGTGGCGAGGGAAGTGCTGGGG - Intronic
1132941396 16:2510203-2510225 GGGTGGAGTGGACTCTGGGGTGG - Intronic
1133069550 16:3235870-3235892 GGGTGGGGAGGGTAGGGGGGTGG - Intronic
1133069560 16:3235887-3235909 GGGTGGGGAGGGTAGGGGGGTGG - Intronic
1133069570 16:3235904-3235926 GGGTGGGGAGGGTAGGGGGGTGG - Intronic
1133257374 16:4525540-4525562 TGGTGGAGAGGGGAGTGGAGAGG - Intronic
1133328905 16:4959026-4959048 GGGGGTAGAGGAAAGTTTGGGGG + Intronic
1133384599 16:5358937-5358959 GGGTGGAGGGAGAGGTGGGGAGG - Intergenic
1133392839 16:5423040-5423062 GTGGGGAGAGGGAAGAGGGGAGG + Intergenic
1133531175 16:6656895-6656917 GGGAGGAGAGGAGAGTTGAGGGG - Intronic
1133901388 16:9978537-9978559 GGATGGGGAGGAAAGGGAGGAGG - Intronic
1134104322 16:11475134-11475156 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1134449576 16:14354641-14354663 GGGAGGAGAGGAGGATGGGGAGG + Intergenic
1134523257 16:14927946-14927968 GGGGGGAGAGGAGAGGGGAGAGG - Intronic
1134563051 16:15227313-15227335 AGATGGGGAGGAAAGTGGGTCGG - Intergenic
1134799529 16:17071589-17071611 GGGAGGGGAGGAACGTGGAGGGG - Intergenic
1134799614 16:17071775-17071797 GGGAGGGGAGGAAAGGGGAGGGG - Intergenic
1134814756 16:17196699-17196721 GGGTGAAAAGGAAAGTGGATGGG - Intronic
1134831357 16:17326304-17326326 TGGGGGAGAGGAAAATGGGGAGG - Intronic
1134887203 16:17804219-17804241 GGGGAGAGAGGAAAGTGGAAAGG - Intergenic
1134923585 16:18138946-18138968 AGATGGGGAGGAAAGTGGGTCGG - Intergenic
1135200773 16:20436233-20436255 GAGGGGAGAGGAGAGTGGGGAGG - Intronic
1135358973 16:21794893-21794915 GGTTGGAGAGGGAGTTGGGGAGG + Intergenic
1135389757 16:22080943-22080965 GGGTGGAGAGGACAAAGGCGAGG + Exonic
1135400629 16:22164049-22164071 AGGTGGAGAGGGAGGTCGGGAGG + Intergenic
1135464081 16:22670355-22670377 GGGGGGATAGGGCAGTGGGGAGG + Intergenic
1136015794 16:27399995-27400017 GGGTGGATAGGTAGGTGGGTGGG + Intergenic
1136016306 16:27403251-27403273 TGGAGGAGAGGAGGGTGGGGAGG + Intronic
1136124494 16:28167918-28167940 TGGGGGAGAGGAGAATGGGGCGG + Intronic
1136726248 16:32359883-32359905 GGGGGGGGATGAAAGAGGGGAGG + Intergenic
1136844582 16:33565937-33565959 GGGGGGGGATGAAAGAGGGGAGG + Intergenic
1137529230 16:49266662-49266684 GGGTGGAGTGGAATGTGGGAGGG - Intergenic
1137676344 16:50305607-50305629 AGGGGGAGAGGAGAGGGGGGTGG - Intronic
1137711649 16:50571079-50571101 GAGCTGAGAGGAAAGTGGAGGGG + Intronic
1137878999 16:52026768-52026790 GAGTGGAGAGGAGAGGGTGGTGG + Intronic
1138418924 16:56886783-56886805 GAGTGGGGGAGAAAGTGGGGAGG - Intronic
1138423194 16:56913108-56913130 GGTTTGTGCGGAAAGTGGGGAGG + Intronic
1138539594 16:57680089-57680111 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1138558548 16:57786811-57786833 AGCTGGACAGGGAAGTGGGGAGG + Intronic
1138637418 16:58352178-58352200 GGTTGGATGGGAAAGTGGTGGGG - Intronic
1138741233 16:59313086-59313108 GGGGGTAGGGGAAGGTGGGGAGG - Intergenic
1138969881 16:62131618-62131640 GGCTGGAGAGAAAAGGGGAGTGG - Intergenic
1139140382 16:64255078-64255100 GGGTGGAGAGGGGAGGGGAGGGG + Intergenic
1139140392 16:64255098-64255120 GGGTGGAGAGGGGAGGGGAGGGG + Intergenic
1139249372 16:65480297-65480319 GCTGGGATAGGAAAGTGGGGAGG - Intergenic
1139656225 16:68388630-68388652 GAGTGGGGTGGAGAGTGGGGAGG - Intronic
1139750463 16:69106521-69106543 GGGAGGAGGGGTCAGTGGGGAGG - Intronic
1140127617 16:72131268-72131290 GACTGGAAAGGGAAGTGGGGAGG + Intronic
1140230370 16:73112812-73112834 GGATGCAGAGGAATGTGGGTGGG - Intergenic
1140279392 16:73541178-73541200 CTGTGGAGAGGAGAGTGGGAAGG - Intergenic
1140419301 16:74804964-74804986 GGCAGGAGAGGAGAGTGGAGGGG - Intergenic
1140856082 16:78978947-78978969 TAGGGGAGAGTAAAGTGGGGAGG - Intronic
1141173922 16:81707099-81707121 AGGAGGGGAGGAGAGTGGGGAGG - Intronic
1141581812 16:85004528-85004550 GGGTGGAGTGGGGGGTGGGGTGG - Intronic
1141877268 16:86834490-86834512 GGGTGGACAGGAACGTGCTGTGG + Intergenic
1142046791 16:87930613-87930635 GGGTGGGGAGGAGAGAGCGGTGG + Intronic
1142074837 16:88111523-88111545 GGCTGGGAAGGGAAGTGGGGGGG - Intronic
1142194894 16:88734815-88734837 GGGTGGTGAGGACCGCGGGGAGG + Intronic
1142224853 16:88872358-88872380 GGGTGGAGGGGTGGGTGGGGGGG + Intergenic
1142254435 16:89006971-89006993 GGGAGAAGAGGGGAGTGGGGAGG - Intergenic
1142254445 16:89007001-89007023 GGAGGGAGAGGGGAGTGGGGAGG - Intergenic
1142254463 16:89007049-89007071 GGGAGAAGAGGGGAGTGGGGAGG - Intergenic
1142254501 16:89007162-89007184 GGGAGAAGAGGGGAGTGGGGAGG - Intergenic
1142254520 16:89007222-89007244 GGGAGAAGAGGGGAGTGGGGAGG - Intergenic
1203000184 16_KI270728v1_random:157873-157895 GGGGGGGGATGAAAGAGGGGAGG - Intergenic
1203131785 16_KI270728v1_random:1694276-1694298 GGGGGGGGATGAAAGAGGGGAGG - Intergenic
1203154749 16_KI270728v1_random:1866235-1866257 GGGGGGGGATGAAAGAGGGGAGG + Intergenic
1142586758 17:979145-979167 GCGGGGAGAGGACAGTGGGTCGG + Intronic
1142958137 17:3535104-3535126 GGGTGGAGCTCAAAGCGGGGTGG + Intronic
1143156398 17:4839729-4839751 GGGAGGAGAGAAAAGAGGGATGG + Intronic
1143303554 17:5928580-5928602 CGGTGGATAGAAAAGTGGGTGGG - Intronic
1143380173 17:6491024-6491046 GGGAGGAGAGGAAAGGGGAGGGG + Intronic
1143380181 17:6491044-6491066 GGGAGGAGAGGAAAGGGGAGGGG + Intronic
1143380192 17:6491065-6491087 GGGAGGGGAGGAAAGGGGAGGGG + Intronic
1143839974 17:9724284-9724306 GGGACCAGAGGAAAGTTGGGGGG + Intronic
1143963405 17:10738938-10738960 GGGAGGAGAGGAAGGGAGGGAGG - Intergenic
1143963411 17:10738955-10738977 GGGAGGAGAGGAAGGGAGGGAGG - Intergenic
1143973736 17:10814822-10814844 GCGTGGAGAGGAGAGAGGGGAGG + Intergenic
1144053417 17:11517233-11517255 GGCTGGAGGGGAAAGAGGTGGGG + Intronic
1144066617 17:11630031-11630053 TGGGGGAGAGGGAAATGGGGAGG + Intronic
1144113612 17:12063981-12064003 GGGCGGGGAGGAAAGCAGGGAGG + Intronic
1144294768 17:13863269-13863291 GAGAGGAGAGGAAAGGGGAGGGG + Intergenic
1144312401 17:14025110-14025132 GGCTGGAGAGAAAAGTGGGAGGG + Intergenic
1144332352 17:14236215-14236237 GGCTGGAGAGAGAAGTGGGAGGG - Intronic
1144498480 17:15765301-15765323 GGCTGGAGAGAGAAGTGGGAGGG + Intergenic
1144534790 17:16077540-16077562 GGGAGGAGAGGATAGGGGAGGGG + Intronic
1144534797 17:16077555-16077577 GGGAGGGGAGGAGAGGGGGGAGG + Intronic
1144862630 17:18315126-18315148 GGAAGGAGGGGAAAGAGGGGCGG - Intergenic
1145161862 17:20580342-20580364 GGCTGGAGAGAGAAGTGGGAGGG + Exonic
1145756275 17:27392842-27392864 GGCTGGAAAGGGTAGTGGGGTGG - Intergenic
1145934157 17:28705346-28705368 GGGAGGAGGGGGAAGTGGGGAGG - Intronic
1146147982 17:30438842-30438864 GGGTGGAGGTGGGAGTGGGGTGG - Intronic
1146694369 17:34897573-34897595 AGGTGTAGGGGAAAGTGTGGAGG - Intergenic
1146791514 17:35753249-35753271 GGGAGGAAAGCAGAGTGGGGAGG - Intronic
1146938539 17:36827333-36827355 GGGTGGAGAGGGGAGAGAGGCGG - Intergenic
1147134191 17:38425770-38425792 GGATGGAGAGGAAGGTGAGGAGG + Intergenic
1147367668 17:39970072-39970094 GAATGGGGAGGAAAGAGGGGGGG + Intronic
1147367686 17:39970124-39970146 GAATGGGGAGGAAAGAGGGGGGG + Intronic
1147384410 17:40072897-40072919 GGCTGGACAGGAGACTGGGGTGG - Intronic
1147389575 17:40100872-40100894 GGGAGGAGCTGAGAGTGGGGTGG + Intergenic
1147487198 17:40827862-40827884 GGCTGGAGAGGAAAGTAGGGTGG + Intronic
1147738855 17:42659158-42659180 GGGAGGAGAGGAACGGGGGAGGG - Intergenic
1147846877 17:43410711-43410733 GGGAGGAAAGGAAAGAGGGTGGG + Intergenic
1148111753 17:45148492-45148514 AGGTGGAGAGGCAGGTTGGGAGG + Exonic
1148119161 17:45197591-45197613 GGGAGGAGAGGGAGATGGGGTGG + Intergenic
1148386799 17:47239916-47239938 GGGTGGAGAGGAGAGGGAGGAGG + Intergenic
1148427266 17:47610149-47610171 GGGTGGGGCTGAGAGTGGGGAGG - Intronic
1148439263 17:47703206-47703228 GGGTGGAGAGAGGGGTGGGGGGG - Intronic
1148462337 17:47845966-47845988 GGGGAGAGAGGAAAGGAGGGAGG - Exonic
1148561639 17:48610010-48610032 GGCTGGAGAGGAAGGGGGAGGGG + Intronic
1148579845 17:48735969-48735991 GGGTTGAGGGGACAGTGAGGAGG - Intergenic
1148603745 17:48912906-48912928 GGGTGGATGGGATAGTCGGGCGG - Exonic
1148674350 17:49436440-49436462 GGGTGGGGAGCAATGTGGTGTGG - Intronic
1148675344 17:49441658-49441680 GGGAAGAGAGGAAGGTGGAGGGG + Intronic
1148687361 17:49508360-49508382 GGGTGGCTGGGAAAGTGGGCTGG - Intronic
1148736037 17:49865446-49865468 GCGTGGAGACGACAGAGGGGCGG - Intergenic
1148772232 17:50074119-50074141 GGGGGCAGGGGAAAGTGGTGGGG - Intronic
1149502790 17:57167186-57167208 GGGTGGTGGGGAAGGGGGGGTGG + Intergenic
1149513012 17:57257989-57258011 AGGAGGAGAGGAAACTGAGGTGG + Intronic
1149555270 17:57569082-57569104 GGGTGGGGAGGTGAATGGGGTGG + Intronic
1149666400 17:58367708-58367730 GGGTGGAGGGGATAGTGGGGTGG + Intronic
1149868452 17:60163143-60163165 GGTGGGGGAGGAAGGTGGGGCGG + Intronic
1150152028 17:62817849-62817871 GGCTGGGAAGGATAGTGGGGAGG + Intergenic
1150178611 17:63090354-63090376 GTGGGGTGGGGAAAGTGGGGAGG - Intronic
1150325032 17:64250136-64250158 AGGTGGATAGGAAACTGGGGTGG + Intronic
1150450247 17:65260759-65260781 GGGTGGGGTGGCAAGAGGGGTGG - Intergenic
1150590572 17:66558675-66558697 GAGTGGAGAGTAAGGGGGGGAGG + Intronic
1150929879 17:69573094-69573116 GGGAGGGGAGGGAAGAGGGGAGG - Intergenic
1150947774 17:69765852-69765874 GGGAGGGGAGGAAAGGGGAGAGG - Intergenic
1150983701 17:70171256-70171278 AGGAGGAGGGGGAAGTGGGGAGG - Intronic
1151196725 17:72437082-72437104 GGCTGGAGAGGAAAGAGAAGGGG - Intergenic
1151300831 17:73224056-73224078 GGGAAGAGAAGAAAGTGGAGGGG + Intronic
1151399735 17:73848309-73848331 GGGTGGACGGTAAAGTGTGGTGG - Intergenic
1151411445 17:73932978-73933000 GGGGGGAGAGGGAAGAGGGAGGG - Intergenic
1152141678 17:78540696-78540718 GGGTGGAGAGATGAATGGGGTGG + Intronic
1152208061 17:78986779-78986801 GGCTGGAGGGGGAAGTGGGAGGG + Intergenic
1152210437 17:79000429-79000451 GGGCGGAGAGGCAGGAGGGGTGG - Intronic
1152244362 17:79177425-79177447 GGCTGGAGAGGAGAGGCGGGAGG + Intronic
1152378366 17:79929988-79930010 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
1152378374 17:79930008-79930030 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
1152449245 17:80365914-80365936 GGGAGGTTAGGAACGTGGGGAGG + Intronic
1152569929 17:81117156-81117178 GTGTGCCGAGGACAGTGGGGAGG + Exonic
1152623658 17:81378857-81378879 GGGTGAGGGGGAGAGTGGGGTGG - Intergenic
1152636063 17:81430993-81431015 GGGTGGAGGGGACAGCGTGGGGG + Intronic
1152636076 17:81431027-81431049 GGGTGGAGGGGACAGCGTGGGGG + Intronic
1152786364 17:82249989-82250011 AGCTGGGGAGGAAAGCGGGGTGG + Intronic
1152790213 17:82274632-82274654 GGGTGGAGAGGAAAGACTGGGGG - Intergenic
1152793812 17:82296908-82296930 GGGTGGAGAGGAGGGAGGGAGGG - Intergenic
1152853361 17:82649822-82649844 GAGGGGACAGGAAAGTGAGGAGG - Intergenic
1153181098 18:2434742-2434764 GGGTGGAGAGAAAAAAGGAGAGG - Intergenic
1153476636 18:5505488-5505510 GGGTGGAGATGAAGGTGTGGAGG - Intronic
1153476644 18:5505515-5505537 GGGTGGAGGTGAAAGTGTGGAGG - Intronic
1153476696 18:5505704-5505726 GGGTGGAGGTGAAGGTGTGGAGG - Intronic
1153476713 18:5505758-5505780 GGGTGGAGGTGAAGGTGTGGAGG - Intronic
1153476722 18:5505785-5505807 GGGTGGAGGTGAAGGTGTGGAGG - Intronic
1153476739 18:5505839-5505861 GGGTGGAGGTGAAGGTGTGGAGG - Intronic
1153694090 18:7622673-7622695 GGCTGGAGAGGACAGTGAGATGG + Intronic
1153966783 18:10189818-10189840 GGCCGGAGAGGAAGTTGGGGAGG + Intergenic
1154002506 18:10494494-10494516 GGGTGGAGAGGAAAACTGGAGGG - Intergenic
1154098444 18:11444172-11444194 GTGGGGAGAGGGAAGGGGGGAGG - Intergenic
1154177870 18:12098264-12098286 AGGTGGAGAAGCAAGTGGGCTGG - Intronic
1154202076 18:12307041-12307063 GGGTGGAGAGAGCAGTGGGGAGG + Intergenic
1154299513 18:13180930-13180952 GGCTGGAGGGGAAAGAGGAGGGG - Intergenic
1154385113 18:13886344-13886366 GGATGGGAGGGAAAGTGGGGCGG - Intronic
1155053919 18:22169361-22169383 GGGAGGAGAGAAAAGAGGGTGGG - Intergenic
1155193767 18:23453665-23453687 GGAGGGAGCGGAAAGAGGGGCGG + Intronic
1155195398 18:23469383-23469405 GGGGAGAGAGGAGAGAGGGGAGG - Intronic
1155515770 18:26622749-26622771 GGGTGGAGAGGGTAGAGAGGGGG + Intronic
1155798909 18:30074885-30074907 AGGAAGAGAGCAAAGTGGGGAGG - Intergenic
1156310753 18:35919467-35919489 GGTTGCAGAGGTGAGTGGGGAGG + Intergenic
1156457494 18:37302948-37302970 GGTGGGAGAGGAGAGTGGGAAGG + Intronic
1157291946 18:46415902-46415924 GGGAGGAGAGGTAAGCAGGGAGG + Intronic
1157314778 18:46578423-46578445 GGCTGGAGAGAAAGGTGGGTGGG + Intronic
1157464233 18:47930588-47930610 GGGAGGAGAGGGAAGGGGAGGGG + Intronic
1157475408 18:48020765-48020787 GGGAGGAGAGGAGGGAGGGGAGG - Intergenic
1157488587 18:48107083-48107105 GGGAGGAAAGGAGAGAGGGGAGG + Intronic
1157558269 18:48627778-48627800 GGGTGGGGAGGAAGGAAGGGAGG + Intronic
1157599560 18:48885710-48885732 GGCAGGTAAGGAAAGTGGGGAGG - Intergenic
1157609820 18:48949459-48949481 GGGTGCAGAGGGAGGTGGGGGGG - Intronic
1157671793 18:49536466-49536488 GGCTGGAGAGGAAAGAGGGAGGG - Intergenic
1157684440 18:49631141-49631163 GGCTGGAGAGGACAGTTGGGAGG - Intergenic
1157713466 18:49865940-49865962 GGGAGGAGAGGGGAGTGGAGAGG - Intronic
1158197603 18:54906125-54906147 GGGTGGAGAGGATAGTTTCGGGG - Intronic
1158321671 18:56270566-56270588 GGGAGGAGAGGGAAGGGGAGGGG + Intergenic
1158409307 18:57190786-57190808 GGGAGGATGGGAAAGTGGGAGGG - Intergenic
1158608737 18:58919525-58919547 GGGGGGAGAGGAAAGGACGGCGG - Exonic
1158801463 18:60915346-60915368 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
1158847946 18:61464401-61464423 GGGCCGAGAGGACAGTGGGTTGG - Intronic
1158966363 18:62625609-62625631 GAGTGGGAAGAAAAGTGGGGTGG - Intergenic
1159448814 18:68574077-68574099 GGGAGGCTAGGAAAGTGGTGAGG + Intergenic
1159693383 18:71521462-71521484 GGGTGGTGATGAGGGTGGGGGGG - Intergenic
1160318198 18:77867312-77867334 AGGTGGAGAGGAAGGTGGGTGGG - Intergenic
1160431126 18:78813343-78813365 GGGTCGGGAGGAAAGGGAGGCGG - Intergenic
1160616343 18:80132675-80132697 GAGGGGAGAGGAGAGAGGGGAGG - Intronic
1160822383 19:1064573-1064595 GGGGCCATAGGAAAGTGGGGCGG + Intronic
1160975348 19:1790108-1790130 AGGGGAAGAGGGAAGTGGGGAGG - Intronic
1161080035 19:2306021-2306043 GGCTGGGAAGGAAAGTGGGTCGG - Intronic
1161226150 19:3146897-3146919 GGGGAGAGAGGAAGGAGGGGAGG - Intronic
1161273404 19:3402879-3402901 GGGGAGAGAGGGAAGAGGGGAGG + Intronic
1161374657 19:3933323-3933345 GGGTGGAGAGGAGGGAGGAGGGG + Intronic
1161403395 19:4078708-4078730 GGGTGGGGATGGAGGTGGGGTGG - Intergenic
1161404003 19:4081805-4081827 GGGAGGAGAGGAAAGGAGGAGGG - Intergenic
1161477579 19:4494995-4495017 AGGAGAAGAGTAAAGTGGGGTGG + Intronic
1161499618 19:4606858-4606880 GGGAGGAGAGGGGAGTGGGGGGG - Intergenic
1161503822 19:4633225-4633247 GGGTAGAGAGGGAGGAGGGGAGG + Intergenic
1161599177 19:5170444-5170466 GGGAAGAGAGGAAGGAGGGGAGG + Intronic
1161613619 19:5257644-5257666 GGGTGGGCAGGCAGGTGGGGTGG + Intronic
1161803533 19:6429463-6429485 AGGAGGAGAGGAAAGAGGAGGGG + Intronic
1161985483 19:7651112-7651134 GTGTGGGGAAGAAAGTGGGTCGG + Intergenic
1162022046 19:7872485-7872507 GGCTGGGGAGGAGAGAGGGGTGG + Exonic
1162031761 19:7920596-7920618 GGGTGGGGCGGAGAGTGGGCGGG + Intronic
1162237686 19:9321693-9321715 GGGGGGAGAGGAGGGCGGGGGGG - Intergenic
1162237731 19:9321779-9321801 GGGTGGGGAGGAGGGTGGGGGGG - Intergenic
1162237739 19:9321791-9321813 GGGTGGGGAGGGGGGTGGGGAGG - Intergenic
1162503686 19:11069525-11069547 GGGTGGAGAGAGAGGTGGGTGGG - Intergenic
1162802489 19:13118843-13118865 GGGAGGAGAGGAGAGCGGCGCGG + Intronic
1162866121 19:13548464-13548486 GGAAGGAGATGAAAGTGGGGAGG + Intronic
1162917360 19:13881567-13881589 TCGTGGAGGGGGAAGTGGGGAGG + Intergenic
1162996488 19:14339143-14339165 AGGGGAGGAGGAAAGTGGGGAGG - Intergenic
1163074418 19:14876647-14876669 GGTTGGGGAGGAAAGGGGAGGGG - Intergenic
1163096674 19:15063201-15063223 GGGGGGAGGGGAGAGGGGGGAGG - Intergenic
1163351214 19:16777582-16777604 GAGGGGAGGGGAAAGTGGAGGGG + Intronic
1163462562 19:17447978-17448000 AGGAGGAGAGGAAAGGAGGGAGG + Intronic
1163462573 19:17448018-17448040 GTGGGGAGAGGGAAGTGGGGAGG + Intronic
1163549396 19:17957199-17957221 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1163582444 19:18146630-18146652 GGGTGGAGAGTGAAGAGGGCAGG + Intronic
1163648129 19:18501835-18501857 GGGTGGGCAGGAAGGAGGGGAGG + Intronic
1164426055 19:28142708-28142730 GGAGGGAGGGGAAAGAGGGGAGG + Intergenic
1164566439 19:29329225-29329247 TGGTGGAGAGGAAGGAAGGGAGG + Intergenic
1164708787 19:30339749-30339771 GGTTGGAGAGGGAGGTGGGGAGG + Intronic
1165031103 19:32998831-32998853 GGGAGGAGAGGAAGGAGGGGAGG + Intronic
1165176538 19:33934489-33934511 GGCTGGAAAGGGAAGAGGGGAGG + Intergenic
1165790581 19:38489278-38489300 GGGTGAAGAGGAAGATGAGGAGG + Exonic
1166035202 19:40163214-40163236 GAGGGGAGAGGGAAGGGGGGAGG + Intergenic
1166188764 19:41160988-41161010 GGGAGGAGAGGTAAGGGGAGGGG + Intergenic
1166290416 19:41860087-41860109 GGGTGGAGAGGTAAAGGGGAGGG - Exonic
1166297679 19:41896960-41896982 GAGTGGGGAGGAAAGAGAGGAGG - Intronic
1166392885 19:42419681-42419703 CGGTGGGGAAGGAAGTGGGGTGG + Intronic
1166523852 19:43498934-43498956 GGTGGGAGAGGACAGTGGGAAGG + Intronic
1166543746 19:43622414-43622436 GGGTGGGGAGGGGAATGGGGAGG - Exonic
1166733371 19:45070859-45070881 GGGTGGGGAGGACAAGGGGGTGG + Exonic
1166959307 19:46488265-46488287 GGGGGGAGAGGGAAGAGGTGAGG + Intronic
1166997151 19:46725095-46725117 GGGAGGAGATGGAGGTGGGGTGG - Intronic
1167454425 19:49591164-49591186 GGGGGGAGGGGAAGGGGGGGCGG - Intergenic
1167683160 19:50938327-50938349 GGGTGGGGTGGGGAGTGGGGTGG - Intergenic
1167904445 19:52647134-52647156 GGGTGGTGTAGGAAGTGGGGCGG - Intronic
1168464951 19:56594885-56594907 GGATGGAGAGGGACTTGGGGAGG - Intergenic
1168691602 19:58380846-58380868 AGGTGGAGAGGGGACTGGGGTGG + Intronic
925150585 2:1612146-1612168 TGGTGCAGAGGAAGGTGGGGAGG - Intergenic
925830013 2:7884483-7884505 GGGTGGGGAGGGAACTCGGGGGG + Intergenic
925913761 2:8589696-8589718 GGGAGGGGAGGAAAGGGGAGAGG + Intergenic
925913780 2:8589740-8589762 GGGAGGGGAGGAAAGGGGAGAGG + Intergenic
925913790 2:8589762-8589784 GGGAGGGGAGGAAAGGGGAGAGG + Intergenic
925913800 2:8589784-8589806 GGGAGGGGAGGAAAGGGGAGAGG + Intergenic
925913810 2:8589806-8589828 GGGAGGGGAGGAAAGGGGAGAGG + Intergenic
925913820 2:8589828-8589850 GGGAGGGGAGGAAAGGGGAGAGG + Intergenic
926420151 2:12687819-12687841 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
926461913 2:13140621-13140643 TGGGGGAGGGGGAAGTGGGGAGG - Intergenic
926512513 2:13800062-13800084 GTTGGGAGAGGGAAGTGGGGTGG + Intergenic
926811740 2:16760905-16760927 GGGTGGAGAAGAAACTGCGGAGG - Intergenic
926880696 2:17540600-17540622 GGGAAGAGAGGAAAGGGGAGGGG + Intronic
927003234 2:18821499-18821521 GGGAGGAAAGGAAGGAGGGGAGG + Intergenic
927482393 2:23464633-23464655 AGGGGAAGGGGAAAGTGGGGAGG - Intronic
927589333 2:24339570-24339592 GGGTAGGGAGGAAAGAGGGAAGG + Intronic
928081328 2:28315053-28315075 GAGGGGAGGGGAAAGGGGGGAGG + Intronic
928102161 2:28445251-28445273 GGGTGCAGAGGACATTGAGGTGG + Intergenic
928549732 2:32358067-32358089 GGGTGGGGAGGGAAGTAGGCGGG + Intronic
928997450 2:37308524-37308546 GGGTGGGGAGGGAGGTGGGTGGG - Intronic
929192279 2:39150530-39150552 AGGTGGAGAGGAGAGAGAGGAGG + Intergenic
929237891 2:39625741-39625763 GGGGGAAGAGGAGAGTGGGGAGG + Intergenic
929778278 2:44941997-44942019 GGAGGGAGAGGAGAGGGGGGAGG - Exonic
930088770 2:47516961-47516983 GGGTGGAGAGGGAGGGAGGGAGG - Exonic
930571733 2:53094556-53094578 GGAAGGAGAGGAAAGGGGAGAGG + Intergenic
930762471 2:55050669-55050691 GGAAGGAGATGAAAGTGGGTGGG + Intronic
930969435 2:57377584-57377606 GGGAGGAGAGGAAAGGGGAGGGG + Intergenic
931319935 2:61166252-61166274 GGGTGTAGAGGAGAGTTGAGAGG + Intergenic
931667199 2:64617891-64617913 GGGAGGGGAGGAAGCTGGGGAGG + Intergenic
932033552 2:68215801-68215823 AGATGGAGGGGAAAGTGGGTGGG + Intronic
932305907 2:70704266-70704288 AGGTGGAGGGGAGGGTGGGGTGG - Intronic
932339023 2:70948174-70948196 GGCAGGAGAGGAGAGTGGAGAGG - Intronic
932344258 2:70985368-70985390 GGGTGGCGAGGAAAGGGGGAGGG + Intronic
932446092 2:71782472-71782494 AGGGGCAGAGGACAGTGGGGTGG + Intergenic
932911497 2:75810651-75810673 GGGTGGGGAGGAGAGGAGGGAGG - Intergenic
933253956 2:80059740-80059762 TGATGGAGAGCAGAGTGGGGCGG - Intronic
933774833 2:85765700-85765722 GGGTGAAGAGGAGGGTGCGGGGG - Intronic
933795276 2:85914606-85914628 GGGTGGAGAGGAGGGTCTGGAGG - Intergenic
933809121 2:86021493-86021515 GAGTGGAGAGGACAGTGGGGAGG - Exonic
934046928 2:88180014-88180036 GGGTGGAGAGAACAGCGGGCTGG + Intronic
934077977 2:88443805-88443827 GGATGGAGAGGGTGGTGGGGGGG + Intergenic
934117497 2:88811061-88811083 TGCTGGAGAGGAAAGGGGAGGGG + Intergenic
934525548 2:95049482-95049504 GGGGGGAGAGGCAAGGGGCGGGG + Intronic
934555858 2:95286728-95286750 GAGAGGGGAGGAAAGTGGAGGGG - Intronic
934937047 2:98473069-98473091 GGGTGCAGTGGAGAGTGAGGAGG + Intronic
934937063 2:98473159-98473181 GGGTGCAGTGGAGAGTGAGGAGG + Intronic
934937070 2:98473189-98473211 GGGTGGAGTGGAGAGAGTGGAGG + Intronic
934937076 2:98473219-98473241 GGGTGCAGTGGAGAGTGTGGAGG + Intronic
934937088 2:98473279-98473301 GGGTGGAGTGGAGAGTGTGGCGG + Intronic
934937095 2:98473309-98473331 GGGTGGAGTGGAGAGTGAGGAGG + Intronic
934937102 2:98473339-98473361 GGGTGGAGTGGAGAGTGAGGAGG + Intronic
935592171 2:104853867-104853889 GCGGGGAGGGGAAAGTGGTGAGG + Intergenic
935915204 2:107942362-107942384 GTGTGGAGTGGAAAGTCAGGAGG + Intergenic
935966470 2:108481924-108481946 GGAAGGAGGGTAAAGTGGGGGGG - Intronic
935989901 2:108709786-108709808 GGGAGGAGAGGAGAGGGGAGGGG + Intergenic
936161099 2:110084797-110084819 TGCTGGAGAGGAAAGGGGAGGGG + Exonic
936183564 2:110286557-110286579 TGCTGGAGAGGAAAGGGGAGGGG - Intergenic
936234614 2:110732497-110732519 GAGGGGAGAGGAAGGTGAGGAGG + Intergenic
936370382 2:111898344-111898366 GGGCGGAGAGGAAGGGGAGGGGG - Intergenic
936464326 2:112733561-112733583 GGCTGGAGAGTGAAGTTGGGTGG + Intronic
936808529 2:116367545-116367567 GGGTGGGGAGGATAGGGGAGGGG - Intergenic
937070706 2:119061012-119061034 GGGTGGGGAGGAGAGCGGTGGGG - Intergenic
937429409 2:121825801-121825823 AGGTGGAGATGCAAGTGGGAAGG + Intergenic
937999869 2:127724422-127724444 GGGTAGAGAAGGAAGTGGGTGGG - Exonic
938187693 2:129246699-129246721 GGGTGGGGAGGAGGGTGAGGTGG - Intergenic
938577604 2:132619123-132619145 GGGTGGAGAAGAAAGTGCACTGG - Intronic
938764537 2:134451484-134451506 TCCTGGAGAGGAAACTGGGGAGG + Exonic
938817390 2:134918498-134918520 GGGTGGGGAGGGAAGGGGCGGGG - Intronic
939294264 2:140238821-140238843 GGCGGGAAATGAAAGTGGGGTGG - Intronic
939419789 2:141951985-141952007 GGGGGGAGAGGGGAGGGGGGAGG - Intronic
939606710 2:144262923-144262945 GAGGGGAGAGGGAAGAGGGGAGG + Intronic
939995032 2:148911976-148911998 GGATGGGGAGGAAAGAGGGAGGG - Intronic
940013758 2:149082114-149082136 GGGGAGAGAATAAAGTGGGGTGG - Intronic
940069590 2:149670966-149670988 GGGTGGTGAAGAACGTGGGAGGG + Intergenic
940441893 2:153725305-153725327 GTGTGGAGGGGAGAGGGGGGAGG + Intergenic
940907660 2:159183611-159183633 GGGTTGAGAGGAGAGAGAGGAGG + Intronic
941207193 2:162588892-162588914 GGAGGGAGAGGAAAGAGGGTAGG - Intronic
941606225 2:167600520-167600542 GGGTGGGGAGGATGGTGGAGCGG - Intergenic
941658678 2:168171846-168171868 GGGGGGAGGGGGGAGTGGGGGGG - Intronic
941780338 2:169437755-169437777 GGCTGGAAAGGGTAGTGGGGAGG + Intergenic
941858678 2:170255336-170255358 GGATGGTGAGGGAAGGGGGGAGG - Intronic
941901826 2:170686304-170686326 GGGAGGGGAGGAAAGAGGGAGGG + Intergenic
941951423 2:171160592-171160614 AGGTGGGGAGGAAAGAGGTGAGG + Exonic
941957022 2:171215268-171215290 AGGTGGAGTGGAAGGTGAGGTGG - Intronic
942089360 2:172473937-172473959 GGGTCAAGAGGAGAGAGGGGTGG + Intronic
942241151 2:173964801-173964823 GGGAGGAGAGGAGAGGGGGCAGG - Intronic
942379358 2:175372101-175372123 GGGTGCAAAGGAAAGTGAGTGGG + Intergenic
942516001 2:176753806-176753828 GGGAGGGGAGGAAAGGGTGGTGG + Intergenic
944250007 2:197572433-197572455 GGGTGGAGAGGGGAATGTGGAGG - Intronic
945265541 2:207888079-207888101 GGGTGGAGAGGAAAGGGAGGTGG - Intronic
945583567 2:211628310-211628332 GTGGGGTGAGGCAAGTGGGGAGG - Intronic
945853164 2:215034411-215034433 GTGTGGAGAGGAATGGGGGAAGG + Intronic
945941686 2:215957432-215957454 AAGTGGAGAGGAGAGTGTGGGGG - Intronic
946248840 2:218401137-218401159 GGGTGGAGAGGATGGAGGGAGGG + Intronic
946250125 2:218406524-218406546 GGGCGGGGCGGGAAGTGGGGCGG - Intergenic
946276218 2:218633780-218633802 GGATGGGGAGGGAAGTGGGATGG + Intronic
946357501 2:219197508-219197530 GGGTGGGGAGGACAGGGGGAAGG - Intronic
946399373 2:219460665-219460687 GGGAGGAGAGGGGAGAGGGGAGG - Intronic
946411703 2:219518424-219518446 GGGAAGAGAGGAAAGAGGAGAGG + Intronic
946412193 2:219521044-219521066 GTGTGGGGTGGAAGGTGGGGAGG - Intronic
946519101 2:220446650-220446672 GGAGGGAGAGGGAAGGGGGGAGG - Intergenic
946613195 2:221481315-221481337 GGGTGGGGCGGAGGGTGGGGCGG - Intronic
946634247 2:221707033-221707055 GGGTGGGGAGGAAATTGGTAGGG - Intergenic
947282137 2:228467186-228467208 AAGAGGAGAGGAAAGTGGAGAGG - Intergenic
947521611 2:230850071-230850093 GGGAGGAGAGGGCAGAGGGGAGG + Intergenic
947547379 2:231019903-231019925 GGGTGGGGAGTCGAGTGGGGAGG - Intronic
947865938 2:233397778-233397800 GAGTGGAGTGGAGAGTGCGGAGG + Intronic
948180927 2:235979518-235979540 GGGTGGAGTGGAAAGCCAGGAGG - Intronic
948251872 2:236536007-236536029 GGGTGCAGAGGATGGTGGGGAGG + Intergenic
948295478 2:236857226-236857248 GGCGGGAGAGGAAAGAGGAGGGG - Intergenic
948604010 2:239123382-239123404 GGGTGGAGGGGCATGTGGGGTGG + Intronic
948756561 2:240162925-240162947 GGATGGACAGGAAGGTGGGGAGG - Intergenic
948765400 2:240216697-240216719 GGGTGGAGAGAAAGGGGGTGGGG + Intergenic
948871918 2:240805031-240805053 GGGAGGGGAGGGAAGTGGGGAGG + Intronic
948871962 2:240805130-240805152 GGAGGGAGAGGGGAGTGGGGAGG + Intronic
949049031 2:241887344-241887366 GGCCGGGGAGGAAAGTGAGGAGG + Intergenic
1168762253 20:357220-357242 GGTTACAGAGGAAAGTGCGGGGG - Intronic
1169027550 20:2383377-2383399 GGGTGGAGAGCTAAGTCGGCAGG + Intronic
1169074008 20:2750573-2750595 GGGTGGAGAGGAGAAGTGGGTGG - Intronic
1169216240 20:3796358-3796380 GGGAGGAGAGGGATGCGGGGAGG - Exonic
1169709674 20:8547675-8547697 GGATGGAGAGAACAGTGAGGAGG - Intronic
1170460551 20:16573361-16573383 GGGGCGAGAGGGAAGTGGGCGGG - Exonic
1170556709 20:17520695-17520717 GGGTGGAGAGGCAAGAGGAGTGG - Intronic
1170703819 20:18727410-18727432 GGGTGGCGAGGAGACTGGTGAGG + Intronic
1170888829 20:20363174-20363196 GGGGGGAGAGTAAAGGAGGGGGG + Intergenic
1170946212 20:20893288-20893310 GGGAGGTGGGGAGAGTGGGGAGG - Intergenic
1171197455 20:23211337-23211359 TGGAGGAGAGGAAGGAGGGGAGG - Intergenic
1171436963 20:25131429-25131451 GGGTGGAGAGGTGCGTGGGTGGG - Intergenic
1171990731 20:31694334-31694356 GGGTGGGGAAGGAAGTGGGTGGG + Intronic
1172125173 20:32621273-32621295 GGGTGGGGAGGAGGCTGGGGTGG + Intergenic
1172138535 20:32705009-32705031 GGGTGCAGAAGATAGTGGGGAGG + Intronic
1172173603 20:32959541-32959563 TGGTGGAGAGGACAGAGTGGTGG + Intronic
1172479683 20:35263768-35263790 CTGTGGAGAGGAGTGTGGGGAGG - Intronic
1172510289 20:35496092-35496114 GGGAGGAGAGGAAAGGGATGGGG + Intronic
1172872266 20:38143143-38143165 GAGAGGAGAGGAAAGAGGGAGGG + Intronic
1172875452 20:38161361-38161383 GGGTGGAGAGGAAGTGGTGGTGG + Intronic
1172896550 20:38304365-38304387 GGGTGGAGAGGAGGGAAGGGAGG - Intronic
1172964297 20:38823080-38823102 GGCTGGAGATCAAAGAGGGGAGG + Intronic
1173002070 20:39111710-39111732 GGGAGGAGGGGAAAGGGAGGAGG + Intergenic
1173103234 20:40107140-40107162 TGGGGGAGTGGAAAGTGGTGTGG + Intergenic
1173125236 20:40330364-40330386 GGTTAGAGAGGAAAATGAGGTGG - Intergenic
1173373760 20:42463589-42463611 GGGAGGGGAGGAAAGGGGAGAGG - Intronic
1173427899 20:42958440-42958462 GGGTGAGGAGGAAAGGAGGGGGG + Intronic
1173454297 20:43190574-43190596 GGGTGAAGAAGAAGGTGGGGTGG - Intergenic
1173736113 20:45362915-45362937 TAGGGGAGAGGCAAGTGGGGTGG - Intronic
1174161134 20:48551261-48551283 GGGTGGAGGGGCGGGTGGGGTGG - Intergenic
1174296692 20:49550361-49550383 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1174400179 20:50271790-50271812 ATGTGGAGAGGAAGGTGAGGTGG + Intergenic
1174571654 20:51506477-51506499 GGGTGGGGAGGAACACGGGGAGG - Intronic
1175189478 20:57201553-57201575 AGCTGGAGAAGAAAGTGGGAGGG + Intronic
1175609955 20:60342580-60342602 GGATGGAGAGGAGAGAGGGGAGG - Intergenic
1175740968 20:61419603-61419625 GGGTGGGGAGGGAGCTGGGGAGG - Intronic
1175832731 20:61975669-61975691 GGGCAGAGAGGAGAGCGGGGTGG + Exonic
1175925590 20:62469834-62469856 GGGACCAGAGGAAACTGGGGAGG + Intronic
1176024985 20:62981350-62981372 GGGGGGAGGGGAGAGGGGGGAGG - Intergenic
1176039235 20:63055772-63055794 GGGTGGAGGGGGAAGAGGGGAGG - Intergenic
1176113892 20:63422734-63422756 GGGTGGAGTGGAGGGTGGGAGGG + Intronic
1176125496 20:63472904-63472926 GGGAGGGGAGGAGAGTGGCGGGG + Intergenic
1176128624 20:63487029-63487051 GGATGCAGAGGAGGGTGGGGTGG - Intergenic
1176128638 20:63487072-63487094 GGATGCAGAGGAGGGTGGGGTGG - Intergenic
1176144408 20:63559173-63559195 GGGTGGTGGGGAGGGTGGGGGGG + Intronic
1176256547 20:64156053-64156075 TGAGGCAGAGGAAAGTGGGGAGG - Intronic
1176549244 21:8214403-8214425 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1176557137 21:8258626-8258648 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1176568176 21:8397441-8397463 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1176576079 21:8441661-8441683 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1176865256 21:14047149-14047171 GAGTGGAGTGGAGAGTGGAGTGG + Intergenic
1176932518 21:14830097-14830119 GGGTGGAGAAGAGACTGTGGAGG - Intergenic
1178058035 21:28821156-28821178 GGGTGGAGTGGAAGGTTGGCAGG - Intergenic
1178225364 21:30710905-30710927 AGGAGGAGAGGAAAGAGGAGGGG + Intergenic
1178607368 21:34051488-34051510 AGGAAGAGAGGAAAGAGGGGAGG + Intergenic
1178727839 21:35070660-35070682 TTGTGGAGTGGAAAGTGGGAGGG + Intronic
1178824656 21:36005011-36005033 GGGGGCAGGGGAAAGGGGGGAGG + Intergenic
1179441157 21:41395150-41395172 AGGGGGAGAGGAAAGTGGGAAGG + Intronic
1179541339 21:42085094-42085116 GGATGGAGAGGAGCGAGGGGCGG + Intronic
1179586018 21:42374570-42374592 GGCTGGGGAGAAAAGTGGAGTGG + Intronic
1179801982 21:43815373-43815395 GGCTGCAGGGGAAAGGGGGGTGG + Intergenic
1180070839 21:45435217-45435239 AGGAAGAGAGGAAGGTGGGGTGG + Intronic
1180363044 22:11916898-11916920 GGGTGGAAGGGAAAAAGGGGTGG + Intergenic
1180583128 22:16860227-16860249 GGGGGGAGAGGAAAGGGCAGCGG + Intergenic
1180860312 22:19075580-19075602 GGGAGGAGAGAAAAATTGGGAGG - Intronic
1180996017 22:19965710-19965732 GTGTGGAGAGGGCTGTGGGGAGG + Intronic
1181021891 22:20107902-20107924 GGGTGGAGGGTAACATGGGGAGG + Intronic
1181217483 22:21343420-21343442 GGGTGGTGGGGAAAGAGGGTTGG + Intergenic
1181286892 22:21758915-21758937 AGGTGGAGAGGAGAGAGTGGAGG - Exonic
1181387707 22:22557883-22557905 GGGTGGGGAGGAGATGGGGGTGG + Intronic
1181577153 22:23802369-23802391 AGGAGGAAAGGAAAGAGGGGAGG - Intronic
1181758733 22:25043112-25043134 GGGTGGGGAGGAAAGGAGGAAGG + Intronic
1181775235 22:25154499-25154521 GGGTGGATTGGGAAATGGGGTGG + Intronic
1182067771 22:27442647-27442669 GGGCGAAGAGGAACGTGGTGGGG + Intergenic
1182092311 22:27604132-27604154 GGGAGGGGAGGCAAGTGGGGGGG - Intergenic
1182093376 22:27610873-27610895 GGGAGGGGAGGAAAGAAGGGAGG + Intergenic
1182358119 22:29731417-29731439 GGGTGGTGAGGCAGGTGGGCTGG - Exonic
1182794818 22:32984379-32984401 TGGTGCAGAGGAGAGTGGGTGGG - Intronic
1182908657 22:33960727-33960749 GGCTGGAAAGGGTAGTGGGGTGG - Intergenic
1183091793 22:35527214-35527236 GGGGGCAGAGGAAAGAGGGATGG + Intergenic
1183246215 22:36695500-36695522 GGGTGGATAGGAAACTGAGAGGG - Intronic
1183247097 22:36702325-36702347 GGGTGGGGTGGAGAGGGGGGAGG + Intronic
1183261290 22:36797527-36797549 GGGTGGAGAGGGGAGAGGGAGGG + Intergenic
1183377051 22:37471486-37471508 GGGTGGAGAGGAGTTGGGGGAGG - Intronic
1183378114 22:37476857-37476879 GGGTGGGCAGGAAGGCGGGGAGG - Intronic
1183488948 22:38106669-38106691 TGGTGGTGAGGCAAGTGGGAAGG - Intronic
1183667342 22:39253504-39253526 GGGTGGGGAGGAACCTGGGAGGG - Intergenic
1183864585 22:40694081-40694103 AGCTGGAGTGGAAGGTGGGGAGG - Intergenic
1184074428 22:42167154-42167176 GGGATCAGAGCAAAGTGGGGAGG - Intronic
1184105564 22:42365704-42365726 GGGAGGAGAGGCAGCTGGGGAGG + Intergenic
1184119429 22:42440696-42440718 GGGGGCAGAGGAAAGAGGGCAGG + Intergenic
1184173376 22:42772490-42772512 GGGAGGAGAGGGGAGTGGAGGGG - Intergenic
1184268007 22:43360305-43360327 GGGTGGGGAGTGAAGCGGGGGGG + Intergenic
1184509356 22:44924066-44924088 GGGAGGGGAGGGAAGAGGGGAGG + Intronic
1184509370 22:44924102-44924124 GGGAGGGGAGGGAAGAGGGGAGG + Intronic
1184557032 22:45239151-45239173 GTGTGGACAGGGGAGTGGGGAGG + Intronic
1184595659 22:45512492-45512514 AGGTGGATAGGACAGTGAGGTGG + Intronic
1184648202 22:45907423-45907445 GCGTGGAGAGGGGAATGGGGCGG + Intergenic
1184780074 22:46643959-46643981 GGGAAGAGAGGAAATGGGGGCGG - Intronic
1185077335 22:48690443-48690465 GGCTGGAGAGGCCAGTAGGGTGG - Intronic
1185347563 22:50317095-50317117 GGGTGGCGAGGACAGGGTGGGGG + Intronic
1203254129 22_KI270733v1_random:130719-130741 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1203262185 22_KI270733v1_random:175798-175820 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
949241704 3:1880507-1880529 GAGTGGGGAGGAGGGTGGGGTGG - Intergenic
949437332 3:4043531-4043553 GCCTGGAGAGGAATGGGGGGTGG - Intronic
949968996 3:9386376-9386398 GGGTGGAGTGGGGGGTGGGGGGG - Exonic
950018618 3:9770576-9770598 GGGGGCAGAGGGAATTGGGGAGG + Intronic
950094290 3:10319809-10319831 GGGGGGGGAGGAAAGAGGGAGGG + Intronic
950132803 3:10558852-10558874 GGGAGGGGAGGAAAGAGGAGAGG + Intronic
950314231 3:11986450-11986472 AGGTGGAGAGGAAATGGGGAAGG - Intergenic
951318559 3:21217068-21217090 GGGCGTAGAGGAAAGGGGGTAGG + Intergenic
951686840 3:25354010-25354032 GGGTGGAAAGGAATGGGGAGAGG - Intronic
951719078 3:25679489-25679511 AGGGGGAGGGGAAAGTGGGGCGG + Intergenic
951766139 3:26201704-26201726 AGGTGGAGAAGAAAATGGTGGGG + Intergenic
952064976 3:29558328-29558350 GGTTGAAGAGGAAAGGGGTGGGG + Intronic
952356839 3:32592602-32592624 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
952833877 3:37588322-37588344 AGATGGAAAGGGAAGTGGGGGGG - Intronic
952914304 3:38221240-38221262 GGGTGGAGAGGAATGGAGTGAGG + Intronic
952976445 3:38700282-38700304 GGGAGGAGGGGAAATTGGGGAGG + Intronic
953208913 3:40857317-40857339 GGGGTGAGAGGAAAGTGAGCAGG - Intergenic
953316929 3:41936761-41936783 GGTTGGGAAGGATAGTGGGGAGG + Intronic
953571719 3:44076536-44076558 GGGAGGAGAGGGGATTGGGGAGG + Intergenic
953761494 3:45690716-45690738 AGGTGGAGAGGAAAATGTGGAGG - Intronic
953980271 3:47410100-47410122 GGGCTGGGAGGAAAGTGGAGCGG - Exonic
954086696 3:48250253-48250275 GGTTGGAGAGGAGAGGGGAGAGG - Intronic
954148929 3:48647680-48647702 GGGTGGAGGGGAAATATGGGAGG + Intronic
954156284 3:48686445-48686467 GGGTGGGGAGCAAAGATGGGAGG - Intergenic
954414267 3:50385270-50385292 GGGTGGAGAGCAAAGCTCGGGGG + Intronic
954432838 3:50480471-50480493 GGGTGGGGAGGCTTGTGGGGAGG + Intronic
954469839 3:50683822-50683844 GGGGGGGGAGGAGAGCGGGGAGG - Intronic
954538890 3:51381041-51381063 GGGTGGAGAGGAGACTGCGAAGG - Exonic
954746311 3:52789468-52789490 GGGTGGAGAGGAAGGAGAGGTGG + Intronic
954832622 3:53435617-53435639 GGGAAGAGTGTAAAGTGGGGAGG - Intergenic
954973732 3:54673856-54673878 GGGTGGAGAGGAGAGAGTGAAGG - Intronic
954999248 3:54911635-54911657 GGGCAGAGATGAAAGTGGAGCGG - Intronic
955300213 3:57771171-57771193 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
955422020 3:58748360-58748382 TGGTGGATAGGTAGGTGGGGTGG + Intronic
955515337 3:59720841-59720863 GGCTGGAGAGAGAAGTGGAGAGG - Intergenic
955611269 3:60759792-60759814 CGGTGGGGATGAAAGTGGGATGG + Intronic
955863364 3:63355773-63355795 AGGTGGAGAGCAAAGGGGAGAGG - Intronic
956451028 3:69375039-69375061 GGGTGGATGGGTAAGTGGGTGGG - Intronic
956451057 3:69375170-69375192 GGGTGGACAGGTAAGTGGGTGGG - Intronic
956854977 3:73267266-73267288 GGCTGGAAACGGAAGTGGGGAGG - Intergenic
956913638 3:73847428-73847450 GGCTGGAGGGGAAAGGGGGAGGG + Intergenic
957535545 3:81498090-81498112 GGGTTGTGAGGAAAGTGCAGTGG - Intronic
957935604 3:86937570-86937592 GGGTGGAGAAAAGAGCGGGGGGG + Intergenic
958154926 3:89744393-89744415 GGGGTGTGAGGAAAATGGGGAGG - Intergenic
958192019 3:90195808-90195830 GGGTGGTGGGGAGAGGGGGGAGG - Intergenic
958503198 3:94941052-94941074 GGGGGGTGAGGAGAGAGGGGAGG - Intergenic
958626714 3:96635239-96635261 GGGTGGTGAGGAAATGGGGAGGG - Intergenic
958798933 3:98733806-98733828 GGTTGGCGGGGACAGTGGGGAGG + Intronic
958800329 3:98747884-98747906 GGGAGGAGAGGAATGGGGGTAGG + Intronic
959315953 3:104807121-104807143 GGGTGGAGGGGGGAGGGGGGAGG - Intergenic
959995524 3:112676449-112676471 AGATGGAGAGGAAAGTGGAAGGG + Intergenic
960126254 3:114001365-114001387 GAGTGGAGAGGAGGGTGGGCAGG + Intronic
960244080 3:115380405-115380427 GGCTGCACAGGGAAGTGGGGTGG + Intergenic
960623756 3:119660656-119660678 TGGTGGGGAGGAGAGAGGGGGGG - Intronic
960626237 3:119685049-119685071 GGGTAGAGAGGAGAGAGAGGTGG - Intergenic
960959513 3:123060099-123060121 GGGAGGAGAGGAAGGGAGGGAGG - Intergenic
960993780 3:123328264-123328286 GAGGGGTGAGGAAGGTGGGGTGG - Intronic
961130351 3:124460361-124460383 GGGTGGAAAATAAAATGGGGTGG + Intronic
961445421 3:126978774-126978796 GTGTGGAGAGCAGAGTTGGGAGG + Intergenic
962072284 3:132044841-132044863 GGGTGGGGAGGGAAGGGGAGCGG + Intronic
962293257 3:134155135-134155157 GGGTGAAGAAGGAAGCGGGGAGG - Intronic
962371468 3:134824241-134824263 GGGTGGAGATGACAATGAGGCGG + Intronic
962419822 3:135218116-135218138 GGGTGGGTAGGAAAGTGGAGAGG + Intronic
962502422 3:136008976-136008998 GTGTGAGGAGGAAAGTGGGGTGG - Intronic
962520872 3:136196352-136196374 GAAGGGAGAGGAAAGGGGGGAGG - Intronic
962855407 3:139340500-139340522 GGGTGAAGTCAAAAGTGGGGTGG + Intronic
962908377 3:139825611-139825633 GGATGAAGAAGGAAGTGGGGTGG - Intergenic
963011277 3:140772911-140772933 GGGTGGAGTGGAATGGGGTGGGG - Intergenic
963038834 3:141053908-141053930 TGGGGGAGAGGAAAATGGTGAGG - Intronic
963092476 3:141497171-141497193 GGGGGGAGAGGGGAGGGGGGAGG + Intronic
963214053 3:142724609-142724631 GGATGGAGAGGAAGGCAGGGAGG - Exonic
963451156 3:145482928-145482950 GGGGGCTGAGGGAAGTGGGGGGG - Intergenic
963627721 3:147694104-147694126 GGGTGGGAAGGAAACTGGAGTGG - Intergenic
963819105 3:149868577-149868599 GGGTTGGGAGGAAAGGGGAGGGG - Intronic
964213376 3:154252702-154252724 GTGTGGGAAGGGAAGTGGGGAGG + Intronic
964398025 3:156268009-156268031 GGGTGGGGAGGAAGTGGGGGTGG - Intronic
964570879 3:158106271-158106293 GGGTGAAGAGGAGAGGGAGGAGG + Intronic
964745290 3:160006662-160006684 GGTCAGAGAGGAAAGTGGAGTGG - Intergenic
964783453 3:160366901-160366923 GGGTTGTGAGGGAGGTGGGGTGG - Intronic
964846591 3:161051090-161051112 TGGTGGAGAGGATAGCTGGGAGG - Intronic
965311645 3:167135362-167135384 GGGGGGAGAGGGGAGTGGGGAGG + Intergenic
965373885 3:167897606-167897628 GGGAGGAGAGGAGGGAGGGGAGG + Intergenic
965537438 3:169837827-169837849 AGGGGGAGGGGAAAGTGGGTAGG + Intergenic
965718586 3:171634933-171634955 GGGTGTAGAGGAGAGTGGAATGG - Intronic
966454004 3:180094354-180094376 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
966458241 3:180142744-180142766 GGGAGGAGAGGAAAGGGGAAGGG - Intergenic
966583903 3:181599984-181600006 GGCTGGGAAGGCAAGTGGGGAGG - Intergenic
966592764 3:181699936-181699958 GAGTGGGGAAGAAAGTGAGGTGG - Intergenic
966710695 3:182969418-182969440 GGGTGGATAGAAAATTGAGGTGG + Intronic
966731832 3:183158111-183158133 GGGAGAAGAGGAGAGTGGGAAGG - Intronic
966740083 3:183224586-183224608 GGGTGGAGAGAGAAGAGAGGGGG - Intronic
967033705 3:185631587-185631609 GGGGGGAGGGGGAAGGGGGGAGG - Exonic
967102581 3:186228574-186228596 GGGTGGAGTGAAAAGGCGGGGGG - Intronic
967712348 3:192723890-192723912 GAGAGGAGAGGAAAGGGGAGGGG + Intronic
967712369 3:192723952-192723974 GGGAGGAGAGGAAGGAGGGGAGG + Intronic
967712378 3:192723974-192723996 GGGAGGAGAGGAAGGGAGGGAGG + Intronic
967798437 3:193626050-193626072 AGGAGAAGAGGAAATTGGGGAGG - Intronic
968136671 3:196224729-196224751 GGGAGGAGAGGGGAGAGGGGAGG + Intronic
968138743 3:196238660-196238682 GGGAGGACAGGAAAGGAGGGAGG + Exonic
968515594 4:1014482-1014504 GGGTGCAGAGGACAGGGGAGTGG - Intronic
968601501 4:1512063-1512085 GGGAGGAGAGGAAGGGTGGGGGG + Intergenic
968607303 4:1541625-1541647 AGTTGGGGAGGAGAGTGGGGCGG - Intergenic
968620040 4:1599923-1599945 GGGAGGAGAGGAAATAGGAGGGG - Intergenic
968650817 4:1759635-1759657 GGATGGGGCGGAAAGTGGGGCGG - Intergenic
968741782 4:2334847-2334869 GGGGGGAGGCGGAAGTGGGGAGG - Intronic
968761571 4:2445001-2445023 GGGTGGAGGTGATAGTGGGATGG - Intronic
968928153 4:3560816-3560838 GGGTGGATAGGTGAGTGGGTGGG - Intergenic
969077395 4:4590766-4590788 GGGAGGATAGGAAAGTCAGGAGG - Intergenic
969280387 4:6166892-6166914 GGGTGAAGAGGTGAGTGGGGAGG - Intronic
969341831 4:6546909-6546931 GGGAGAAAAGGAAAGAGGGGAGG + Intronic
969443567 4:7231896-7231918 GGGTGGGGATGAGACTGGGGTGG + Intronic
969844224 4:9907397-9907419 TGGTGGAGGGGAAAGTTGGGTGG - Intronic
970303274 4:14703669-14703691 GGGTGGTGAGGAGACTGGAGAGG - Intergenic
970449058 4:16149049-16149071 GGGTACAGAGGAAAGAGGGATGG - Intergenic
970876537 4:20877120-20877142 GGGTGAAGAGGAAAAGGGAGAGG + Intronic
971163481 4:24158044-24158066 GGGGGGAAGGAAAAGTGGGGAGG - Intergenic
971177262 4:24292970-24292992 GGGTGGAGAGGAACGCAGGCAGG - Intergenic
971251313 4:24975466-24975488 GGGAAGAGAAGAAAGCGGGGAGG + Intronic
971412122 4:26384981-26385003 GGGAGGAGAGGGGAGAGGGGAGG - Intronic
971412132 4:26385003-26385025 GAGAGGAAAGGAAAGGGGGGAGG - Intronic
971722796 4:30268145-30268167 GGGGAGAGAGGGGAGTGGGGAGG + Intergenic
971864834 4:32156285-32156307 GGGAGGAGGGGAGAGGGGGGAGG - Intergenic
972025717 4:34374465-34374487 GGGAGGAGAGGGAAGTGGAGGGG - Intergenic
972579686 4:40384251-40384273 GAGGGAAGAGGGAAGTGGGGTGG + Intergenic
972644464 4:40954377-40954399 GGGTGGAGAGGAAAGAGGGAAGG + Intronic
972773761 4:42222665-42222687 GGGAGGGGTGGAAAGTGAGGAGG + Intergenic
972790263 4:42364980-42365002 GGGAGAAGAGGGAAGTGGAGGGG - Intergenic
972807022 4:42539251-42539273 GGGGGGAGAGGAAGGGTGGGAGG + Intronic
972968917 4:44548387-44548409 GAGTGGAGAAGAAAGTGGTAGGG - Intergenic
973161984 4:47030942-47030964 GGGAGGGAAGAAAAGTGGGGTGG + Intronic
974020508 4:56688194-56688216 AGGTGGAGAGGAAAGAAGGAAGG + Intergenic
974036402 4:56821792-56821814 AGGTGGCGAGGGAAGAGGGGCGG + Intergenic
974136810 4:57828220-57828242 GAGGGGAGAGGAAAAAGGGGAGG + Intergenic
974282884 4:59822305-59822327 GGGTGGAGAGAAAGGTAGAGAGG + Intergenic
974833407 4:67216448-67216470 GGGGGGAGGGGAAAGGAGGGGGG + Intergenic
974907239 4:68073441-68073463 GGGAGGAGAGAAAAGTGGAAAGG + Intronic
975073753 4:70178388-70178410 GGGAGGAGAGGAGAATGGAGGGG - Intergenic
975094511 4:70442500-70442522 GGCTGGAGGGGAAATTGAGGAGG - Intronic
975139339 4:70903380-70903402 GAGTGGAGGGGAACGTGGAGGGG + Intronic
975650944 4:76592230-76592252 GGGTGGAGCAGAATGTGGCGGGG + Intronic
976081150 4:81356212-81356234 GGGAGGAAAGGAAAGGAGGGGGG + Intergenic
976287033 4:83380962-83380984 GAGAGGAGAGGAAAATGGGAAGG - Intergenic
976623327 4:87151565-87151587 GGGTGAAGAGAAAGGAGGGGAGG + Intergenic
976905725 4:90233472-90233494 GTGGGGTGGGGAAAGTGGGGAGG + Intronic
977044358 4:92050834-92050856 AAGTGGAGAGGAAAGAGGAGAGG + Intergenic
977090824 4:92673825-92673847 GGGTGGGGAGGAAGGGGGGAGGG + Intronic
977593518 4:98852549-98852571 GGGATGAGGGGAAAGTGGGGAGG - Intergenic
977902619 4:102439537-102439559 AGGGGGAGATGAAAGTGGAGAGG + Intergenic
979278664 4:118840278-118840300 GGGTGGAGAGGACAGACAGGTGG + Intergenic
979641814 4:123017149-123017171 GGGGGGAGAGGGAAGGGGAGAGG + Intronic
979741392 4:124155218-124155240 GGGTGAAGGGAAAATTGGGGGGG - Intergenic
979817292 4:125125524-125125546 GGGTGGTCAGGAAAGGAGGGAGG + Intergenic
980282054 4:130735337-130735359 GGGTGGGGAGGAAAAGAGGGAGG + Intergenic
980470963 4:133250934-133250956 GGATGGAGAGGAAAGGATGGAGG + Intergenic
981761122 4:148196078-148196100 CGGGAGAGAGGAAAGTGGGCTGG + Intronic
982232375 4:153221564-153221586 GGGCAGAGGGGAAGGTGGGGAGG - Intronic
982599385 4:157426945-157426967 GGCTGGAAAGGGTAGTGGGGAGG - Intergenic
983043620 4:162959130-162959152 GACTGGGGAGGAAAGTGGGGAGG - Intergenic
983172305 4:164549801-164549823 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
983249109 4:165325465-165325487 GGGCAGAGAGAAAAGTTGGGTGG + Intergenic
983502856 4:168519765-168519787 GGGAGGAGAGGCAATTGGGTTGG - Intronic
983531026 4:168809957-168809979 GGGTGGAGAGAACAATGTGGGGG + Intronic
984337868 4:178415610-178415632 GGGTGAGGAGGGGAGTGGGGTGG - Intergenic
984617559 4:181915696-181915718 GGGAGGAGAGAAAAGAGGAGGGG + Intergenic
984712616 4:182898260-182898282 AGGTGGAGAGTACAGAGGGGAGG - Intronic
984905680 4:184623834-184623856 GGGTTGAGAGGGAAATGAGGAGG + Intergenic
985117424 4:186605510-186605532 GAGTGGGGAGGGGAGTGGGGAGG + Intronic
985117454 4:186605598-186605620 GGGAGGAGGGAAGAGTGGGGAGG + Intronic
985658077 5:1142351-1142373 GGGTGGAGGGGAGAGGGGAGAGG - Intergenic
985658129 5:1142491-1142513 GGGGAGAGAGGGGAGTGGGGAGG - Intergenic
985679398 5:1248029-1248051 GGGTGGAGTGGAGGGAGGGGTGG + Intergenic
985957474 5:3276173-3276195 GGGAGGGGAGGAAGGAGGGGGGG + Intergenic
985958062 5:3279045-3279067 GGGAGGAGAGGAAGGAGGGAGGG - Intergenic
986328877 5:6702985-6703007 GGGAGGGGAGGAAGGAGGGGGGG - Intergenic
986330108 5:6711779-6711801 GGGTGGCGGGGAAAGAGGGGTGG + Intergenic
986529695 5:8723435-8723457 GGATGGAAAGGAAAGGTGGGAGG + Intergenic
986690003 5:10306451-10306473 GGGAGGAGAGGAGAGAAGGGAGG + Intronic
986772591 5:10987654-10987676 GGGAGGAGAGGGGAGTGGGGAGG - Intronic
987589437 5:19904366-19904388 GGGTGGAGAGGGGAGGGGGAGGG + Intronic
987870108 5:23605822-23605844 GGGAGGACAGGAATTTGGGGAGG + Intergenic
987962676 5:24830720-24830742 GGGGGGAGAGGGGAGGGGGGAGG - Intergenic
988055752 5:26093450-26093472 GGGTGGACAACAAAGTGCGGTGG - Intergenic
988490579 5:31701914-31701936 AGGTGGAGGGGAAAGCAGGGAGG - Intronic
988627352 5:32891864-32891886 TGGAGTGGAGGAAAGTGGGGAGG - Intergenic
988900457 5:35726983-35727005 GGGAGGGGAGGAAAGGGGGGGGG - Intronic
989489955 5:42038762-42038784 GGCTGGGAAGGATAGTGGGGAGG - Intergenic
989623746 5:43410197-43410219 GGGTGGAAAACCAAGTGGGGAGG - Intronic
990153770 5:52850797-52850819 GGGTGGAGAGTATAGGAGGGAGG - Intronic
990381831 5:55227010-55227032 AGCCGGAGAGGAAGGTGGGGCGG - Exonic
990953834 5:61324213-61324235 GGGAGGGGAGGGAAGTGGGGAGG + Intergenic
991203821 5:64025826-64025848 TGGTGGGGAGGTCAGTGGGGAGG + Intergenic
991433596 5:66573398-66573420 GGGAGGAGAGGAAGGAGGGAGGG + Intergenic
991481943 5:67090342-67090364 GGGGGGAAGGGGAAGTGGGGAGG - Intronic
991545431 5:67776927-67776949 GGCTGGAAAGAATAGTGGGGTGG - Intergenic
991997014 5:72397964-72397986 GGCTGGAGGGGAAAGAGGGAGGG + Intergenic
992041024 5:72832881-72832903 GGGTGGAGAGTAAACTGAGTGGG - Intronic
992103991 5:73435815-73435837 GGAATGAGAGGAAAGTGGGTCGG - Intergenic
992218858 5:74551940-74551962 TGGTTGAGAGGTAAGTGGAGAGG - Intergenic
992527921 5:77630011-77630033 GGGTGGGAAGGGAAGAGGGGCGG + Exonic
992641413 5:78771307-78771329 GGCTGGAGAAGAAAGAGGGAGGG + Intergenic
992759593 5:79939720-79939742 GGGTGGAGAGAACAGCGTGGAGG + Intergenic
994090312 5:95803962-95803984 AGGTGGGAAGGAAAGTGGGGAGG - Intronic
994217917 5:97159516-97159538 GAGAGGAGAGGAAAGTAGAGAGG - Intronic
994313258 5:98301729-98301751 CTGTGGAGAAGAAAGTGGGGGGG + Intergenic
995105630 5:108374705-108374727 GGGAGGTGAGGAAAGAGGAGGGG + Intronic
995180849 5:109228906-109228928 GCGGGGAGAGGAAAGGGGAGAGG + Intergenic
995185444 5:109266822-109266844 GGGTTGGGAGGAACGTGGTGAGG - Intergenic
996247019 5:121276649-121276671 GGGTGAAAAGGATAGAGGGGAGG + Intergenic
996340188 5:122429213-122429235 AGGAGGAGAGGAAAGTGGGAAGG + Intronic
996374416 5:122789412-122789434 GTGTGGTGGGGAAGGTGGGGCGG - Intronic
996731899 5:126724894-126724916 AGTTGGAGAGGAAAGTGGCTAGG + Intergenic
997241642 5:132312275-132312297 GGGAGGGGAGGAAGGTGGGATGG + Intronic
997291866 5:132742913-132742935 GGGTGGAAGGGAAAGAGGGAGGG - Intergenic
997307847 5:132852628-132852650 GGGTGGAATGGCAAGTGGAGTGG - Intergenic
997405139 5:133639680-133639702 GGGTGCAGAGGAAACTTGGGGGG + Intergenic
997647781 5:135492320-135492342 TGATGGAGAAGAAAGTGGGGAGG - Intergenic
997725707 5:136118324-136118346 AAGTGGAGAGGAAAGGGGGCAGG - Intergenic
997834488 5:137181228-137181250 GGCAGGAGAGGAAGGTGGAGGGG + Intronic
998136285 5:139676276-139676298 GGCTGGGGAGGAGGGTGGGGAGG - Intronic
998136325 5:139676365-139676387 GGGTGGGGAGGAGTCTGGGGAGG - Intronic
998169790 5:139865829-139865851 GGGTGGTGGGGAAGGTGGGGTGG + Intronic
998382688 5:141736962-141736984 GGGTAGAGAGGGAAGGAGGGAGG - Intergenic
998403673 5:141861901-141861923 GCAAGGAGTGGAAAGTGGGGAGG + Intronic
998575573 5:143311953-143311975 GGGTTGACAGGAAAATGGGCTGG - Intronic
998614205 5:143721576-143721598 GGGTAGAGAGGAAGGGAGGGAGG - Intergenic
998625702 5:143843263-143843285 GAGAGGAGAGAAAAGTGAGGAGG + Intergenic
999033837 5:148324936-148324958 GGGTTGGGAGGATAGTAGGGGGG - Intronic
999173798 5:149617720-149617742 GGATGGAGAAGCAGGTGGGGAGG - Intronic
999452865 5:151691502-151691524 GGTTGGAGAGGGCAGTGGGCAGG - Intergenic
999535850 5:152516290-152516312 GAGGGGAGAGGAAATTGGAGGGG + Intergenic
999852477 5:155557649-155557671 GGGTTGAGAGGAAAGTGGTATGG - Intergenic
999932706 5:156451062-156451084 GGGAGGAGAGGCAAGGGGAGGGG - Intronic
1000148395 5:158475680-158475702 GGGTGGTGAGGATAATGTGGGGG + Intergenic
1000159900 5:158587139-158587161 GAGGGGAGAGGAAAGAGTGGAGG - Intergenic
1000231162 5:159316587-159316609 TGTTGGAGAGGAAAGGGGGATGG - Intronic
1000264195 5:159619262-159619284 GGGAGAAGAGGAATGTGGAGAGG - Intergenic
1000297047 5:159921195-159921217 GGGTGGGGAGGACATTGGAGAGG - Intronic
1000494344 5:161960890-161960912 GTCTGGAGAGTGAAGTGGGGTGG - Intergenic
1000615068 5:163417264-163417286 GGGTGGAGGGAAGTGTGGGGCGG + Intergenic
1000990012 5:167902160-167902182 GAGTGGAGTGGGGAGTGGGGTGG + Intronic
1001036487 5:168300370-168300392 GGGTGGAGCAGAGAGTGGGGAGG + Intronic
1001122400 5:168991533-168991555 GGGTGGTGGGGGCAGTGGGGAGG - Intronic
1001292204 5:170471711-170471733 GGGTGGAGAAGAGAGGGAGGAGG - Intronic
1001313004 5:170624684-170624706 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1001506396 5:172283802-172283824 GGGTGGAGCGGCGAGGGGGGCGG - Exonic
1001611027 5:173002104-173002126 GGGTGGAGAGGAAAAGTGTGGGG - Intronic
1002123382 5:177022900-177022922 GGGTAGAGAGGAAGGTGAGTCGG + Exonic
1002176324 5:177403405-177403427 GGGCGGAGAGGAGCGTGAGGCGG + Intronic
1002345014 5:178542686-178542708 AGGTGGAGAGGAAGGGGGAGGGG + Intronic
1002585285 5:180242198-180242220 GGGTGCAGGAGAAGGTGGGGAGG + Intronic
1002963402 6:1938942-1938964 GGGAGGGGAGGAAAGAAGGGAGG - Intronic
1003067615 6:2917183-2917205 GGCTGGAAAGGAAAGAGGTGAGG - Intergenic
1003175094 6:3748331-3748353 GGATGGAGAAGAAGGTCGGGTGG + Intronic
1003318542 6:5033064-5033086 TGGGGGAGGGGAAGGTGGGGCGG - Intergenic
1003455684 6:6279515-6279537 GGGTGGAGAGGGACTTGGTGGGG + Intronic
1003481492 6:6537575-6537597 GGGGGGAAAGGGAAGGGGGGAGG + Intergenic
1003513226 6:6798990-6799012 GGATGGGGAGGGAAGTGGTGAGG - Intergenic
1003723772 6:8735813-8735835 GAGAGAAGAGGAAAGTGGCGAGG - Intergenic
1004396107 6:15248041-15248063 AGGTGGAGAGCAGCGTGGGGTGG + Intronic
1004485647 6:16063730-16063752 GGGAGGAGAGGAAGGGAGGGAGG + Intergenic
1004564313 6:16781279-16781301 GGGTGGAGAGCAATGGGGTGGGG + Intergenic
1004847774 6:19664339-19664361 GGTAGGAGAGGAAATTGGGAGGG - Intergenic
1005069684 6:21851756-21851778 GTGAGGAGAGGGAGGTGGGGGGG - Intergenic
1005406156 6:25490093-25490115 GGCTGGAGGGGAGAGTGGGCGGG + Intronic
1005585383 6:27271736-27271758 TGGTGGAGTGGAAAGTGGAGTGG + Intergenic
1005805745 6:29473076-29473098 GGGTGGAGATTTAAATGGGGTGG + Intergenic
1005824079 6:29622020-29622042 GGTTGGAGAGGAAAGCCAGGCGG - Intronic
1005824527 6:29624800-29624822 GGGAGGAGGGGAAATGGGGGAGG + Intronic
1005999682 6:30955478-30955500 GAATAGAGAGGAAAGTGGGAGGG - Intergenic
1006076009 6:31532939-31532961 GGGAGGAGGGCAGAGTGGGGGGG + Intronic
1006082720 6:31576690-31576712 GGATGGAGGTGAAAGTAGGGGGG + Intronic
1006097672 6:31666073-31666095 GGGGGGAGTGGAAATTAGGGAGG - Exonic
1006154756 6:32008103-32008125 GGGTGGACAGGTGGGTGGGGAGG - Intergenic
1006161068 6:32040838-32040860 GGGTGGACAGGTGGGTGGGGAGG - Intronic
1006268347 6:32944308-32944330 GGATGGGGAGGAATGTGAGGGGG - Intronic
1006271166 6:32968627-32968649 GTATGGAGAGGCGAGTGGGGGGG + Intronic
1006305123 6:33213990-33214012 GGGTAGAGAAGCAGGTGGGGAGG + Intergenic
1006375559 6:33669971-33669993 GGGAGGAGGGGGAGGTGGGGAGG - Intronic
1006439109 6:34042389-34042411 AGGTGGGCAGGAATGTGGGGAGG + Intronic
1006519536 6:34563321-34563343 GGGTAGGGAGGGTAGTGGGGTGG + Intergenic
1007122408 6:39394145-39394167 GGGTGGAGAGTGAATTGGGTAGG + Intronic
1007264977 6:40589056-40589078 GTGTGGAGTAGAAACTGGGGAGG + Intergenic
1007387207 6:41528092-41528114 GGGCGGGGAGGGAAGTGGGCAGG - Intergenic
1007632543 6:43280767-43280789 GGGTGGACAGGAAAGTTGACAGG + Intronic
1007632691 6:43281639-43281661 AGATGGGCAGGAAAGTGGGGAGG + Intronic
1007688892 6:43685065-43685087 TGGTGGAGAGGGAAGAGGGCTGG + Intronic
1007940743 6:45778892-45778914 GGGAGGAGAGGAAAGAGTTGGGG - Intergenic
1008713186 6:54254785-54254807 GGCAGGGCAGGAAAGTGGGGGGG - Intronic
1009166201 6:60344858-60344880 GTGGGGTGAGGGAAGTGGGGAGG - Intergenic
1009244137 6:61213982-61214004 GGGTGAAGAGGAAAGAAGGAGGG + Intergenic
1009624285 6:66118466-66118488 GGGTGGAAAGGAAAGCGGGGAGG + Intergenic
1009666627 6:66689882-66689904 GGGTGGAGAGAAAATTTAGGAGG + Intergenic
1009696344 6:67108877-67108899 GTGTGGAGAGGAAGTAGGGGTGG + Intergenic
1010192603 6:73209413-73209435 GGGAGTAGAGGGTAGTGGGGAGG - Intergenic
1010752613 6:79631665-79631687 GGGCGGGGAGGAAAGGTGGGTGG + Intronic
1011215945 6:85005679-85005701 GGTTGGAGAGGAAAGTGATGAGG + Intergenic
1011632323 6:89339520-89339542 GGGAAGGGAGGGAAGTGGGGAGG + Intronic
1011632341 6:89339555-89339577 GGATGGGGAGGGAAGAGGGGTGG + Intronic
1011765107 6:90611381-90611403 GGCTGGAGAGGAAAGAGGTGTGG - Intergenic
1011914654 6:92488619-92488641 GAGAAGAGAGGAAAATGGGGAGG - Intergenic
1013010764 6:106117929-106117951 GGGTGGAGAGGGAAGAAGAGAGG + Intergenic
1013217369 6:108040014-108040036 GGGTGGGGAGGGAGGTGGGTGGG + Intergenic
1013316867 6:108951675-108951697 GTGTGGCCAGGAAACTGGGGAGG - Intronic
1013836317 6:114340953-114340975 GGGTGGGGGCGAAAGTGGGTGGG - Intronic
1014416392 6:121190212-121190234 TGGTGGGGAGGAAAGGAGGGAGG - Intronic
1014559561 6:122873933-122873955 GGGAGGAGAGGAAGGGGGGGAGG - Intergenic
1015199952 6:130568170-130568192 GGGTAGTGAGGTAGGTGGGGTGG - Intergenic
1015255513 6:131175252-131175274 AGGTGGAGGTGGAAGTGGGGAGG + Intronic
1015353374 6:132248619-132248641 GGATGGGGTGGAAAGTGTGGTGG + Intergenic
1015950600 6:138548952-138548974 GGGTGGACATGAATTTGGGGTGG - Intronic
1016923393 6:149317641-149317663 GGGGGCAGAGGGAGGTGGGGAGG + Intronic
1016958359 6:149648568-149648590 GAGCGGAGAGCAAAGTGGGCTGG - Exonic
1017024320 6:150168036-150168058 TGGGGGAGAGGAGAGTCGGGAGG - Intronic
1017332720 6:153218427-153218449 GGGAGGGGAGGGAAGTGGAGGGG - Intergenic
1017697926 6:157037427-157037449 GGGTGGAGTGGAGAATGGGAAGG + Intronic
1017918856 6:158854435-158854457 GGCTGGAGAGGAAAGAGGAAGGG + Intergenic
1018627716 6:165795880-165795902 GGGTGGAGAGGACTGTAAGGTGG - Intronic
1018650156 6:165986317-165986339 AGGTGCAGAGGAAAGGGGTGGGG + Intronic
1018837905 6:167498820-167498842 GGGAGGGGAGGTCAGTGGGGAGG - Intergenic
1019110879 6:169712769-169712791 GGGTTGAGGGCAAAGAGGGGAGG - Intronic
1019223612 6:170493567-170493589 AGGAGGAGAGGAAGGTGAGGAGG + Intergenic
1019332955 7:469956-469978 GGGTGAAGAGGGAGGTGGGATGG - Intergenic
1019354782 7:572751-572773 GGGAGGAGAGAAAGGTGAGGCGG + Intronic
1019456543 7:1130589-1130611 GGGTGGGGAGGAGTGTAGGGAGG - Intronic
1019508414 7:1404947-1404969 GGGAGGAGAGGGAAGAGGGAGGG + Intergenic
1019892028 7:3954573-3954595 GGGCGGAGAGTATAGAGGGGAGG - Intronic
1019982118 7:4629424-4629446 GGGTTGAGGGGAAAGGAGGGGGG - Intergenic
1020092893 7:5351184-5351206 GGGTGGGGAGGAGGGAGGGGAGG + Intronic
1020577293 7:9949347-9949369 GGCTGGAAAGGGTAGTGGGGAGG + Intergenic
1021373249 7:19876868-19876890 GGATGGAGAGGGAAATGAGGAGG - Intergenic
1021546204 7:21815841-21815863 GGAGGGAGGGGCAAGTGGGGTGG - Intronic
1021911611 7:25390759-25390781 GGGTGGAGAGCCAGGTGAGGAGG + Intergenic
1022090005 7:27102016-27102038 GGGGGGAGGGGAGAGTGGGCTGG - Intronic
1022094603 7:27130822-27130844 GGGCGCAGAGGAAAGGGGGATGG - Intronic
1022124509 7:27342264-27342286 GGGTGGTGGGGGGAGTGGGGGGG + Intergenic
1022209183 7:28191960-28191982 GGCTGGGGAGGAAAAAGGGGAGG + Intergenic
1022370278 7:29764798-29764820 GGGTTAGGAGGAGAGTGGGGGGG - Intergenic
1022469638 7:30674379-30674401 GCCTGTGGAGGAAAGTGGGGAGG + Intronic
1022473391 7:30695050-30695072 GGGAGGAGGGGGAAGAGGGGAGG + Intronic
1022657345 7:32331561-32331583 GGTTGGAGGGGCAAGTGTGGAGG + Intergenic
1022747858 7:33190846-33190868 GAGTGGAGAGGGAAGAGGGGTGG + Intronic
1022875235 7:34521175-34521197 TGGGGAAGAGGAGAGTGGGGAGG + Intergenic
1023003750 7:35840199-35840221 GGGGGGAGGGGAAAGGGGGGAGG - Intronic
1023300397 7:38764393-38764415 GGCTGGAGAGGAAGGGGAGGTGG + Intronic
1023533454 7:41183153-41183175 GGGAGGGGAGGAAAGGGGGAGGG - Intergenic
1023584560 7:41715639-41715661 GAGTGGAGAGCAAGGCGGGGAGG - Intergenic
1023745189 7:43316757-43316779 GGGAGGAGAGAAAAGGGGAGGGG - Intronic
1023840915 7:44097033-44097055 GGGAGGAGGGGAAGGTGGAGAGG + Intergenic
1023935111 7:44734233-44734255 GGGAGGAGAGGGGAGTGGAGGGG - Intergenic
1023996402 7:45161611-45161633 GAGAGGAGAGGAAACAGGGGAGG + Intronic
1024750239 7:52456375-52456397 GGGTGGAGAACAATGTGGAGTGG - Intergenic
1025764577 7:64430825-64430847 GGCTGGGGAGGGTAGTGGGGGGG + Intergenic
1026104175 7:67407928-67407950 GGGAGGGGAGGAGAGAGGGGAGG - Intergenic
1026204509 7:68245193-68245215 GGGTGGAGATGAGATTTGGGTGG - Intergenic
1026225476 7:68436556-68436578 GGGAGGGGAGGAAAGGGGAGGGG - Intergenic
1026407641 7:70084018-70084040 GGGTGGAGATGGAAGGGAGGTGG - Intronic
1026421182 7:70239195-70239217 GGCTGGAGAAGATACTGGGGAGG - Intronic
1026968639 7:74454860-74454882 GGGTGGAGAGGACAGAGGAGGGG + Intronic
1027189394 7:75988703-75988725 GGGTGGAGGGGAAGGCCGGGTGG + Intronic
1027189447 7:75988806-75988828 GGGTGGAGGGGAAGGCGGGGAGG + Intronic
1027189459 7:75988831-75988853 GTGTGGAGGGGAAGGCGGGGAGG + Intronic
1027189514 7:75988956-75988978 GGGTGGAGGGGAAGGCCGGGTGG + Intronic
1027189530 7:75988985-75989007 GGGTGGAGGGGAAGGCCGGGTGG + Intronic
1027222044 7:76220416-76220438 GGGTGGAGTGGAATGTGGTGTGG + Intronic
1027339073 7:77186485-77186507 GGCTGGAAAGGGTAGTGGGGAGG + Intronic
1027853916 7:83484643-83484665 GGTTGGTGAGGAGAGTAGGGTGG - Intronic
1028222401 7:88213055-88213077 TGGTGGAGAGGGAATTGAGGAGG - Intronic
1028352744 7:89869281-89869303 GGCTGGGGAGGAATTTGGGGTGG - Intergenic
1028469157 7:91186110-91186132 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469174 7:91186155-91186177 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469182 7:91186175-91186197 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469190 7:91186195-91186217 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469198 7:91186215-91186237 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469206 7:91186235-91186257 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469214 7:91186255-91186277 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028469222 7:91186275-91186297 GGGAGGAGAGGAGAGGGGAGGGG - Intronic
1028862154 7:95664866-95664888 GGCTGGAGAGGGAAGAGGTGAGG - Intergenic
1029199489 7:98829088-98829110 GGGAGGAGAGGGAAGGGGAGGGG + Intergenic
1029206140 7:98870257-98870279 GGGTGGGGAGGGATGCGGGGAGG - Intronic
1029226276 7:99030775-99030797 GAGGGGAGAGGAATGGGGGGTGG + Intronic
1029361920 7:100094074-100094096 GGCTGGAGCGGGAGGTGGGGAGG + Intronic
1029538094 7:101167453-101167475 GCGGGGAGAGGAAGGAGGGGAGG - Intergenic
1029644545 7:101845527-101845549 GTGTGGGGATGAAAGTGGGGAGG + Intronic
1029726510 7:102409352-102409374 CGGTGGAGGGGAAAGTGTTGAGG - Intronic
1029729956 7:102433020-102433042 GAGGGGAAAGGAAGGTGGGGAGG - Intergenic
1030028212 7:105345173-105345195 GGGAGGAGAGGAGAGGGGAGGGG + Intronic
1030079665 7:105766635-105766657 GGGTGGAGAGCACAGTGGGGTGG - Intronic
1030469925 7:109951219-109951241 GGTTGGAGGGGAAAGAGGGAGGG - Intergenic
1031072564 7:117178442-117178464 AGGTTGAGATGAAAGTAGGGGGG - Intronic
1031103217 7:117507626-117507648 AGGTGGAGAAGCATGTGGGGAGG + Intronic
1031797108 7:126188550-126188572 GGGGTGAGAGGGAAATGGGGAGG - Intergenic
1031810037 7:126356206-126356228 GGGGAGGGAGAAAAGTGGGGTGG - Intergenic
1031830449 7:126619373-126619395 GTGGGGTGAGGGAAGTGGGGAGG + Intronic
1031914700 7:127552104-127552126 GGGTGGAGAGAGAAATGTGGTGG + Intergenic
1032128172 7:129209596-129209618 GGGTGGAGAGGGAAGGGCAGAGG - Intronic
1032201327 7:129825179-129825201 GGGAGGCGAGGATAGTGGGTGGG - Intergenic
1032263231 7:130352736-130352758 GGGTGGTGAGGAAATTGCAGTGG + Intronic
1032427068 7:131830820-131830842 GGATGGAGGTGAGAGTGGGGAGG + Intergenic
1032581191 7:133105125-133105147 GGGTGGAGGGGGCAGTGTGGAGG - Intergenic
1032708034 7:134439119-134439141 GGGTGGAGGGGAATGTGGGAAGG + Intergenic
1032784711 7:135191937-135191959 TGGTGGAGAGGACAGTGGGCAGG + Intronic
1032839892 7:135705427-135705449 GTATGGAGAGGAAATGGGGGAGG + Intronic
1033053691 7:138030297-138030319 GGCTGGAGGGGAAAGAGGGAGGG - Intronic
1033238283 7:139655828-139655850 GGGTGGGGAGGCAAGTCAGGAGG + Intronic
1033302467 7:140198639-140198661 GGGTTGGGGGAAAAGTGGGGTGG + Intergenic
1033316027 7:140298458-140298480 AGCTAGAGAGGAAGGTGGGGAGG - Intronic
1033755922 7:144398423-144398445 TGGAGAAGGGGAAAGTGGGGAGG + Exonic
1033962800 7:146934447-146934469 GGGGGGAGGGGGAAGGGGGGAGG + Intronic
1033969866 7:147025505-147025527 ACGGGGAGAAGAAAGTGGGGAGG + Intronic
1033978892 7:147139494-147139516 GGGGGGAGTGGGAAGTGGTGTGG - Intronic
1034119077 7:148610900-148610922 AGGTGGAGAAGAATGAGGGGTGG - Intronic
1034272253 7:149808976-149808998 GGGAGGAGGAGAAGGTGGGGTGG + Intergenic
1034284507 7:149875690-149875712 GGGTGAGGAGGAAAGGAGGGAGG - Intronic
1034427223 7:151020361-151020383 GGGAGGAGGGGAAAGAAGGGAGG + Intronic
1034449372 7:151129203-151129225 GGGAGGGGAGGAAAGAAGGGTGG - Intronic
1034713846 7:153220993-153221015 GGCTGGAGAGGAAAGAGGGAGGG - Intergenic
1034850161 7:154486098-154486120 GGGTGGTGAGGAGACCGGGGAGG - Intronic
1035111569 7:156486633-156486655 GGGTGGAGGGGAGAAGGGGGTGG - Intergenic
1035120377 7:156561791-156561813 GAGAGGAGAGGAGAGTGGGAAGG - Intergenic
1035179935 7:157081941-157081963 ATGTGAAGAGGAAAGTGGGCTGG + Intergenic
1035435898 7:158858925-158858947 GGGAGGAAAGGAAAGGGGAGGGG - Intronic
1035435909 7:158858950-158858972 GGGAGGGGAGGAAAGGGGAGGGG - Intronic
1035435916 7:158858965-158858987 GGGAGGGGAGGAAAGGGGAGGGG - Intronic
1035500336 8:87288-87310 GGGTGGAGAGGAGAAAGGAGAGG - Intergenic
1035580036 8:733869-733891 GGGTGGAGAGAAAAGCTGGACGG - Intronic
1035600647 8:894941-894963 GCGGGGTGGGGAAAGTGGGGTGG + Intergenic
1035691045 8:1559971-1559993 GGGTGGAGAAGCCAGTGTGGAGG - Intronic
1035769181 8:2133237-2133259 GGCTGGAGAGGACAGTGTTGAGG - Intronic
1035846926 8:2875191-2875213 GGATGGAGAGGACAGTGATGGGG + Intergenic
1036130422 8:6104304-6104326 GGGAGGAGAGGGGAGGGGGGGGG + Intergenic
1036290298 8:7481996-7482018 GGGGGGAGGGGGAAGGGGGGAGG + Intergenic
1036718218 8:11146964-11146986 TGGGGAAGAGGAAAATGGGGAGG + Intronic
1036750983 8:11443656-11443678 GGGTGGACAGCAGGGTGGGGAGG + Intronic
1036767619 8:11558677-11558699 GGGTGAAGAGCAGAGTGGAGAGG + Intronic
1036777146 8:11621254-11621276 GGCTGGAGAGGCAGGTGGGCTGG - Intergenic
1036814553 8:11891834-11891856 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
1037085763 8:14847693-14847715 GGGAGGAGAGGAGGGAGGGGAGG + Intronic
1037110536 8:15159733-15159755 GGGTGGGGGGGAGGGTGGGGGGG - Intronic
1037198682 8:16223520-16223542 GGCTGGAGAGCCCAGTGGGGAGG + Intronic
1037223500 8:16554573-16554595 GGAAGGAGAGGAGAGTGGAGGGG + Intronic
1037550491 8:19966366-19966388 GGGTGGAGAGGTTCCTGGGGTGG + Exonic
1037616066 8:20520022-20520044 CGGTGGAGAGGGAAGAGGGAGGG - Intergenic
1037767529 8:21781317-21781339 GGGTGGTGGTGGAAGTGGGGAGG - Intronic
1037798581 8:22017798-22017820 GGGAGGAGAGGAAAACGGGGAGG + Intergenic
1037886551 8:22599119-22599141 GGGAGGAGAGGAGAGGGGAGAGG - Intronic
1038039669 8:23714268-23714290 GGGTGGAGAGTAAAGTGAAGCGG + Intergenic
1038048359 8:23786461-23786483 GGGTGCAGGGGGCAGTGGGGAGG - Intergenic
1038346257 8:26735206-26735228 GGGTGGAGAGCAAAGAGGAGGGG + Intergenic
1038679470 8:29653574-29653596 TGGTGGGGAAGAAAGTGGGTAGG + Intergenic
1038886292 8:31666380-31666402 TGAGAGAGAGGAAAGTGGGGAGG + Intronic
1039516532 8:38138315-38138337 GGCTGGAGGGGAAAGTAGGAGGG + Intronic
1039518310 8:38151119-38151141 GGGTGCAGGGGAGAGTAGGGAGG + Exonic
1039612827 8:38932778-38932800 GGATGGGGAGGAAGGTGGGAGGG + Intronic
1039846316 8:41328194-41328216 GGCGGGAGAGCAAAGTGGAGTGG - Intergenic
1040040921 8:42916105-42916127 AGGTGGTGAGGAGAGTGGGAAGG - Intronic
1040537192 8:48320712-48320734 GCATGGAGAGGACAGTGAGGAGG + Intergenic
1040823853 8:51596042-51596064 GAGTGGAGAGGAAGGGAGGGTGG - Intronic
1040978358 8:53219010-53219032 CTGTGGAGAGGTGAGTGGGGAGG + Intergenic
1041044096 8:53875630-53875652 GGCTGGAAAGGGAAGTGGAGTGG - Intronic
1041690334 8:60680243-60680265 GCGGGGAGAGGAAAGGAGGGCGG + Intronic
1041765035 8:61410589-61410611 TGATGGAGTGGAGAGTGGGGCGG - Intronic
1041901902 8:62991990-62992012 GGAAAGAGAAGAAAGTGGGGTGG - Intronic
1041996496 8:64066383-64066405 GGAAGAAGAGGAAAGTGGGAAGG + Intergenic
1042208601 8:66354125-66354147 GGCTGGTGAGGAAAGTTGAGAGG + Intergenic
1042576796 8:70229615-70229637 GGGGAAAGAGGAAAGTGAGGAGG - Intronic
1042841171 8:73125288-73125310 TGAGGGAGAAGAAAGTGGGGAGG + Intergenic
1043149407 8:76694714-76694736 GAGTGGACAGGATGGTGGGGCGG - Intronic
1043420893 8:80097553-80097575 AGGAAGAGAGCAAAGTGGGGAGG - Intronic
1043667679 8:82837505-82837527 GGCTGGAGTGGGAAGTGGAGAGG + Intergenic
1043835118 8:85036793-85036815 GAGAGGAGAGGAAAGGAGGGAGG + Intergenic
1043941935 8:86205630-86205652 GGGAGGAGAGGGGAGTGGGGAGG + Intergenic
1044014207 8:87030943-87030965 GGGGGGAGAGGAAGAGGGGGAGG - Intronic
1044042955 8:87392652-87392674 GGGTGGAGAGGAATGAAGAGTGG + Intronic
1044119335 8:88375524-88375546 AGTTGGAGAGGAAAGGTGGGAGG + Intergenic
1044159204 8:88891894-88891916 GGGTGGATAGGAGAGTTGGGAGG + Intergenic
1044825760 8:96195361-96195383 GGGTAGAGAGGGAAATGAGGTGG + Intergenic
1045320708 8:101079944-101079966 GGGAGGAAAGGAAAGAGGGAAGG - Intergenic
1045561689 8:103270369-103270391 GGGAAGAGAGCAAAGTGGGGAGG - Intergenic
1045856436 8:106770160-106770182 GGGCGAAAAGGAAAGCGGGGAGG - Exonic
1046062436 8:109155362-109155384 GTGTAGGGTGGAAAGTGGGGAGG - Intergenic
1046328147 8:112677105-112677127 GGGTGCAGAGTACAGTGGAGTGG + Intronic
1046335988 8:112787783-112787805 GGCTGGGAATGAAAGTGGGGTGG + Intronic
1046417132 8:113932126-113932148 AGCTGGAGAGGGAAATGGGGAGG + Intergenic
1047097653 8:121641487-121641509 GGGGGGTGAGGGAAGTGGAGAGG + Intergenic
1047478518 8:125258465-125258487 GGGGAGCCAGGAAAGTGGGGTGG - Intronic
1047803631 8:128335696-128335718 GGGTGACAAGGTAAGTGGGGAGG + Intergenic
1047981623 8:130189313-130189335 GGCTGGGAAGGATAGTGGGGAGG - Intronic
1048487821 8:134865154-134865176 GGCTGGAGTGGAAAGTGGCCTGG + Intergenic
1048551129 8:135434420-135434442 GGCTGGGAAGGATAGTGGGGTGG - Intergenic
1048890225 8:138940497-138940519 GGGTGGGGGGGAAGGTGGGGGGG - Intergenic
1048890238 8:138940517-138940539 GGGTGGGGAGAAAGGTGGGGGGG - Intergenic
1048890248 8:138940537-138940559 GGGTGGGGGGGAAGGTGGGGGGG - Intergenic
1049078850 8:140424839-140424861 CGGTGGTGAGGAAAGCGGGTAGG + Intronic
1049121946 8:140747429-140747451 AGGAGGAGAAGAAAGGGGGGGGG + Intronic
1049155305 8:141062587-141062609 GGGTGGATAGGCAGGTAGGGAGG + Intergenic
1049157982 8:141078545-141078567 GGCTGGAGACGTAAGTGGGGTGG + Intergenic
1049163940 8:141115405-141115427 GGGTGGAGAGGAAAGCAGGATGG + Intergenic
1049338295 8:142098207-142098229 GGGTGAGGAGGCGAGTGGGGTGG + Intergenic
1049397037 8:142405691-142405713 GGGTAGAGAGGAAGGGTGGGAGG - Intergenic
1049405144 8:142449065-142449087 GGGTGTAGATGGAAGTGGGGTGG - Intergenic
1049545386 8:143228391-143228413 GGGGGGAGAGGGAGGCGGGGGGG + Intergenic
1049610484 8:143552798-143552820 GGGGGGATAGGGAGGTGGGGTGG + Intergenic
1049720955 8:144115315-144115337 GGGAGGAGAGGAAAGTGCTAAGG - Intronic
1049737721 8:144218723-144218745 GGGAGGGGAGGGAAGAGGGGAGG - Intronic
1049786227 8:144452098-144452120 GGGTGGCGAGGACAGGTGGGCGG + Intronic
1050152886 9:2634661-2634683 GAGAGGAAAGGAAAGTGAGGTGG - Intronic
1050163663 9:2742912-2742934 GGGTGCAGAGGAAAGAAGGTTGG - Intronic
1050256373 9:3796339-3796361 GGGAGGAGAGAAAGGTAGGGAGG - Intergenic
1050403851 9:5285968-5285990 GGGTAGAGAAGACAGTAGGGTGG + Intergenic
1050985454 9:12076602-12076624 GAGGGGAGAGGAGAGTGGAGAGG - Intergenic
1051642717 9:19238531-19238553 GGGAGGGGAGGAGAGGGGGGAGG - Intronic
1051642765 9:19238622-19238644 GGGAGGGGAGGAGAGGGGGGAGG - Intronic
1051668608 9:19488553-19488575 GGGTTAAGAGGACATTGGGGAGG + Intergenic
1052891255 9:33702308-33702330 GGATGTAATGGAAAGTGGGGAGG + Intergenic
1052952011 9:34220132-34220154 GGCAGGAGAGGAAAGGGGAGGGG - Intronic
1053082966 9:35192908-35192930 GGGTGGAGAGGAAAACAGTGGGG + Intronic
1053329320 9:37188830-37188852 GAGGGGAGAGGGAAGAGGGGAGG - Intronic
1053347385 9:37387829-37387851 GGCTGGAGAGGAGTGTGGGCAGG - Intergenic
1053475484 9:38379185-38379207 GGGTGGGGAGAAAAGGGAGGGGG + Intergenic
1053803022 9:41775926-41775948 GGGTGGATAGGTGAGTGGGTGGG - Intergenic
1054142241 9:61539196-61539218 GGGTGGATAGGTGAGTGGGTGGG + Intergenic
1054191311 9:61987236-61987258 GGGTGGATAGGTGAGTGGGTGGG - Intergenic
1054461989 9:65470343-65470365 GGGTGGATAGGTGAGTGGGTGGG + Intergenic
1054647058 9:67600481-67600503 GGGTGGATAGGTGAGTGGGTGGG + Intergenic
1054812806 9:69448014-69448036 GCATGGAGAGGCAAGCGGGGGGG - Intronic
1054877298 9:70110408-70110430 AGGAGGAGAGGAAATTGGAGAGG + Intronic
1054985008 9:71251850-71251872 AGGTGGAGAGGATGGTGGGAGGG - Intronic
1055011050 9:71565987-71566009 GGCTAGAGAGGAAAGAGGGAGGG - Intergenic
1055357204 9:75449755-75449777 GAGTGGAGGGGAAAGAGGGAGGG + Intergenic
1055779150 9:79800437-79800459 GAGTGGAGAGGAAGATGGGTTGG + Intergenic
1055904280 9:81274752-81274774 GGTTGGACAGGATAGTGGAGAGG + Intergenic
1055936474 9:81609059-81609081 GAGAGGAGAGGAAAGGGGAGGGG - Intronic
1056031317 9:82556487-82556509 GATTGGAGTGGAAATTGGGGTGG - Intergenic
1056079241 9:83073374-83073396 GGGTGGGGTAGAAGGTGGGGTGG - Intergenic
1056830197 9:89910628-89910650 GGCTGGAAAGGGTAGTGGGGAGG - Intergenic
1056857247 9:90142542-90142564 GGGTGGCGGGGAGAGGGGGGTGG - Intergenic
1056965200 9:91159501-91159523 GGAAAGAGAGGAAAGAGGGGAGG + Intergenic
1057068405 9:92075484-92075506 GTGTGGAGAGGAAGGAGGGTTGG - Intronic
1057271300 9:93653151-93653173 GGTGGGAGAGGAAGGTGGTGAGG - Intronic
1057450562 9:95155260-95155282 GGGAGGGGAGGAAAGGGGAGGGG + Intronic
1057924969 9:99137939-99137961 GTTTGGAGAGGAAAGTGGCGGGG + Exonic
1057963135 9:99476583-99476605 GAGTGGAGACAAAACTGGGGAGG - Intergenic
1058593407 9:106589027-106589049 GGCTGGAGAGGAAGGCGTGGAGG - Intergenic
1058714460 9:107711296-107711318 AGGTGGAGAGGGAAGTGCTGAGG - Intergenic
1059145661 9:111897080-111897102 GTGGGGAGAGGAAAGGGCGGAGG - Exonic
1059354335 9:113687430-113687452 GGGTGGAGGAGGAAGTGGGGAGG + Intergenic
1059487990 9:114642186-114642208 GGGTGGGGAGGAAGGAGGGAAGG - Intronic
1059632717 9:116141932-116141954 GGGAGGGGAGGAAAGGAGGGAGG + Intergenic
1059703321 9:116796651-116796673 GGGTGAAGGGAAAAATGGGGAGG + Intronic
1060063572 9:120483067-120483089 GGGTGGAGAGGGGAGAGTGGGGG - Intronic
1060102907 9:120856201-120856223 GGAAGCAGAGGAAAGTGGGTGGG + Exonic
1060161755 9:121370541-121370563 AGATGGTGAGGATAGTGGGGAGG + Intergenic
1060332473 9:122685859-122685881 AGGTGGGGAGGAAAGAGGTGAGG - Intergenic
1060397521 9:123326577-123326599 GAGGAGAGAGGAGAGTGGGGAGG - Intergenic
1060824436 9:126679927-126679949 GGGTGGAGGGCAGAGTGGTGGGG - Intronic
1060919476 9:127409570-127409592 GGGGGGAGATGATAGTGAGGTGG + Intergenic
1061045724 9:128163839-128163861 GGGTGGGCAGGCAAGTGGGTGGG - Exonic
1061122796 9:128654486-128654508 GGCTGGAGAGGAGTGAGGGGTGG - Intronic
1061244133 9:129392540-129392562 GGGCGGGGAGGAGAGTTGGGAGG - Intergenic
1061256370 9:129455985-129456007 GGGAGGAGAGGGAAGGGAGGGGG - Intergenic
1061282028 9:129602907-129602929 GGGAGGAGAGGAGAGGGGAGAGG + Intergenic
1061589218 9:131588059-131588081 GGGTGGGGAGGCCGGTGGGGAGG + Intronic
1061869256 9:133511444-133511466 TGGTGGGGAGGGAGGTGGGGCGG + Intergenic
1061947144 9:133914730-133914752 GGGAGGAGAGGGAAGGGGAGGGG + Intronic
1061954766 9:133955760-133955782 GGGTGGGGAGGAACGTGGGGGGG - Intronic
1061999338 9:134207922-134207944 AGGTGGGGAGGATGGTGGGGAGG - Intergenic
1062049629 9:134440641-134440663 GGGTGGACAGGAGGGTGGGCTGG - Intergenic
1062062018 9:134501952-134501974 GGGAGGAGAGGAAAGTATGTCGG + Intergenic
1062129158 9:134883405-134883427 GGCTGCAGAGGAACGTGAGGCGG + Intronic
1062144044 9:134979055-134979077 GGGAGGAGAGGAAAGAGAGAAGG + Intergenic
1062468330 9:136691291-136691313 GGATGGAGAGGACAGGGGCGGGG + Intergenic
1062542641 9:137048445-137048467 GGATGGAGAAGACAGTGGTGGGG + Exonic
1203470530 Un_GL000220v1:113863-113885 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1203478351 Un_GL000220v1:157835-157857 GGGTCGGGAGGAACGGGGGGCGG - Intergenic
1185504923 X:625025-625047 GGGAGGAAAGGAAAGGAGGGAGG - Intronic
1185511618 X:668211-668233 GGGAGGAGAGGGAGGAGGGGAGG - Intergenic
1185545801 X:943154-943176 GAGAGGAGAGGAAAGAGAGGGGG + Intergenic
1185581239 X:1212971-1212993 GGGAGGGGAGGGGAGTGGGGAGG - Intergenic
1185598885 X:1325447-1325469 GGGGAGAGAGGGAGGTGGGGAGG + Intergenic
1185598891 X:1325464-1325486 GGGAGGAGAGGGAAGGGGAGCGG + Intergenic
1185640653 X:1588148-1588170 GGGAGCAGAGGAAAGGGGAGGGG - Intergenic
1185669759 X:1798517-1798539 GGGAGGAGAGGAGAGAGGAGAGG - Intergenic
1185734303 X:2485630-2485652 GGGAGGAGAGGGAAGGAGGGAGG + Intronic
1185869224 X:3649795-3649817 GGAGGGAGAGGAAAGGAGGGAGG + Intronic
1185915014 X:4025726-4025748 GGGAGGAGAGGAGAGGGGAGGGG - Intergenic
1186141766 X:6582004-6582026 GGGTGGAGAGGTAGGTAGGTAGG - Intergenic
1186324367 X:8462610-8462632 GGGTGAAGGGGAAGGGGGGGGGG + Intergenic
1186327817 X:8498748-8498770 AGGGGGAGGGGAGAGTGGGGAGG + Intergenic
1186698625 X:12065534-12065556 GGGTTGAGATGGAAGTGGAGAGG - Intergenic
1186809514 X:13174486-13174508 GGGTGGAGTGGGGAGTAGGGTGG - Intergenic
1186810940 X:13187917-13187939 GGGTGGAGAGCAAAATGCTGGGG - Intergenic
1186943675 X:14540878-14540900 AGGTGGGGAGGAAAGGGAGGGGG + Intronic
1187039577 X:15579515-15579537 AGCTGGAGAGGATAGTGGGAGGG + Intronic
1187707207 X:22020713-22020735 GGGAGGAGAGGGAAGGGGAGGGG - Intergenic
1187833959 X:23411882-23411904 GGGTGGCGGGGGAGGTGGGGTGG + Intergenic
1188068439 X:25690331-25690353 GGCTGGAAAGGATAGTGGGAGGG - Intergenic
1188459219 X:30404134-30404156 GGGTGGAGAGGAAACTCAAGAGG - Intergenic
1188478278 X:30610598-30610620 GGCTGGAGGGGAAAGAGGGAGGG - Intergenic
1188740232 X:33769201-33769223 GGGAGGAGAGGAGAGGGGAGGGG + Intergenic
1188811222 X:34656613-34656635 GGATGGGGAGGGAAGAGGGGTGG + Intronic
1188983058 X:36744875-36744897 AGGTGGAAAGGAAAGTGGTATGG + Intergenic
1189002160 X:36958308-36958330 GGATGGGGAGGGAAGAGGGGTGG - Intergenic
1189126764 X:38456329-38456351 GTGGGAAGAGGAAATTGGGGTGG - Intronic
1189550447 X:42087234-42087256 GGGAATGGAGGAAAGTGGGGAGG - Intergenic
1189793396 X:44624504-44624526 GGGTGGGGAGGGAAGTGAGAAGG + Intergenic
1190332286 X:49243207-49243229 GGGTGAGGAGGAAGGTGGGGGGG + Intronic
1190927862 X:54924767-54924789 GGGAGGAGAGGGGAGTGGAGAGG - Intronic
1191189035 X:57646206-57646228 GGGATGAGAGGAAAGTGGGATGG + Intergenic
1191603679 X:63039221-63039243 GGCTTGAGAGGAAAGGGGGAGGG + Intergenic
1192032244 X:67525921-67525943 GGCTGGAGAGGAAGGTGGATGGG + Intergenic
1192198805 X:69050458-69050480 GGGTGGAGAGTAAATTGTAGGGG - Intergenic
1192432028 X:71118970-71118992 GGGGGAAGAGTAAAGTGGGCTGG + Intronic
1192720047 X:73685516-73685538 AGGTGGAAAGGAAAGTGGTATGG + Intronic
1193152828 X:78142369-78142391 GGCTGGAAAGGATAGTGGGAGGG - Intergenic
1194035310 X:88863868-88863890 GTGTGGAGGGGGAAGTGTGGAGG + Intergenic
1194150947 X:90324578-90324600 AGATAGAGAGCAAAGTGGGGAGG + Intergenic
1194382493 X:93211922-93211944 GTGTGGAGGGGGCAGTGGGGTGG - Intergenic
1194420805 X:93670647-93670669 GGGTGGAGAAGAAAGAAGAGAGG - Intergenic
1194912765 X:99667028-99667050 GGGGGGTGGGGGAAGTGGGGGGG + Intergenic
1195173840 X:102296007-102296029 GGGTGGACAGGAATTTGGCGGGG - Intergenic
1195185025 X:102391086-102391108 GGGTGGACAGGAATTTGGCGGGG + Intronic
1195455456 X:105064267-105064289 AGGGGGAGAGAAAAGTGGGAAGG - Intronic
1195697406 X:107677054-107677076 GGGAGGAGAAAAAAGTGGGCGGG + Intergenic
1196438198 X:115693593-115693615 GGATGGAGGGGAAAGGGGGCGGG + Intergenic
1196681713 X:118476167-118476189 GAATGGAGAGGAGAGTGGAGAGG + Intergenic
1196794795 X:119493538-119493560 GGGTGGCGAGGGAACAGGGGTGG - Intergenic
1196889236 X:120276308-120276330 GGGAAGAATGGAAAGTGGGGAGG + Intronic
1196893051 X:120309011-120309033 GGGGGAAGAGGACAGTGGGTAGG - Intronic
1197199073 X:123733133-123733155 GGGTGGAGAGGAAAGTGGGGCGG - Intergenic
1197226875 X:123962595-123962617 GGAGGGAGAGGGAAGAGGGGTGG - Intronic
1197507102 X:127319419-127319441 AGGTGGATAGGAAAATGGTGTGG - Intergenic
1197753831 X:129981910-129981932 GGGTGGCGACGACGGTGGGGGGG + Intronic
1198254638 X:134914625-134914647 GGAGGGAGATGAAAGTAGGGTGG - Intronic
1198384603 X:136116711-136116733 GGTTGGAGGGGATAGTAGGGAGG - Intergenic
1198416652 X:136426755-136426777 GAGTGGAGAGGCAAATGTGGTGG + Intergenic
1198608240 X:138368327-138368349 GGCTGGGAAGGATAGTGGGGTGG + Intergenic
1198806859 X:140502221-140502243 GGGACTGGAGGAAAGTGGGGAGG + Intergenic
1198987060 X:142466771-142466793 GTGGGGTGGGGAAAGTGGGGAGG + Intergenic
1199005248 X:142688524-142688546 GGAAGGAAAGGAAAGCGGGGAGG - Intergenic
1199081271 X:143579325-143579347 GAGTAGAGAGAAGAGTGGGGAGG - Intergenic
1199136753 X:144262453-144262475 GGGGGGAGGGGGAAGGGGGGAGG + Intergenic
1199715742 X:150506312-150506334 GAGGGGAGAGGAAAAAGGGGAGG - Intronic
1199868389 X:151874726-151874748 GGGAGCAGAGAAATGTGGGGAGG + Intergenic
1200497313 Y:3901337-3901359 AGATAGAGAGCAAAGTGGGGAGG + Intergenic
1200712235 Y:6497045-6497067 GGGGGGAGGGGAGAGGGGGGAGG - Intergenic
1200775177 Y:7164147-7164169 GAGTGGAGAGGAGAGTGGGGAGG - Intergenic
1200807753 Y:7449546-7449568 AAGTGCAGAGGAAAGAGGGGTGG - Intergenic
1201146101 Y:11066505-11066527 GGAAGGAGAGGAAAGGAGGGAGG + Intergenic
1201434197 Y:13939301-13939323 AAGTGGAGGGGAGAGTGGGGAGG - Intergenic