ID: 1197199074

View in Genome Browser
Species Human (GRCh38)
Location X:123733136-123733158
Sequence GCTGGGTGGAGAGGAAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 930
Summary {0: 1, 1: 1, 2: 10, 3: 102, 4: 816}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199074_1197199086 9 Left 1197199074 X:123733136-123733158 CCCCACTTTCCTCTCCACCCAGC 0: 1
1: 1
2: 10
3: 102
4: 816
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199074_1197199089 20 Left 1197199074 X:123733136-123733158 CCCCACTTTCCTCTCCACCCAGC 0: 1
1: 1
2: 10
3: 102
4: 816
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199074_1197199087 19 Left 1197199074 X:123733136-123733158 CCCCACTTTCCTCTCCACCCAGC 0: 1
1: 1
2: 10
3: 102
4: 816
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1197199074_1197199082 -6 Left 1197199074 X:123733136-123733158 CCCCACTTTCCTCTCCACCCAGC 0: 1
1: 1
2: 10
3: 102
4: 816
Right 1197199082 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199074 Original CRISPR GCTGGGTGGAGAGGAAAGTG GGG (reversed) Intergenic
900169272 1:1258444-1258466 GCTGGCTGGAGTGGGAAGAGGGG - Intronic
900519414 1:3098446-3098468 CCTGGGTGGAGCGGTGAGTGGGG - Intronic
900613107 1:3552807-3552829 GGTGGCTGCAGAGAAAAGTGGGG - Intronic
900637882 1:3674741-3674763 GGTGGCTGGAGGGGAGAGTGAGG + Intronic
900848352 1:5121630-5121652 GCTGGGTGAAGGGGAAAGGAGGG - Intergenic
901929274 1:12586394-12586416 GCTGGGTGGGGATGAACGCGGGG - Intronic
902057245 1:13611566-13611588 GCTGGGGGAAGAGGAGAATGAGG + Intronic
902296699 1:15472605-15472627 GCTGGGAGGGGAGGAAAGAGAGG - Intronic
902595944 1:17509559-17509581 GCAGGGGAGAGGGGAAAGTGAGG + Intergenic
903014698 1:20354279-20354301 GCTGGGTGGAGGGAAGGGTGGGG + Intronic
903375718 1:22864676-22864698 GCTGGGAGGAGAGAAAGGTTTGG + Intronic
903740773 1:25557237-25557259 GCTTGGTGCAGAGGAAGGCGTGG - Exonic
903845814 1:26279515-26279537 CCTGAGTGGAGAGGAACTTGGGG + Exonic
904038421 1:27570977-27570999 GCTGGGGGGATGGGAGAGTGGGG - Intronic
904065812 1:27749918-27749940 GAGGAGGGGAGAGGAAAGTGAGG - Intronic
904218505 1:28944231-28944253 GCTGGGAGGAGAGGAAGATGAGG + Intronic
904286579 1:29456587-29456609 GCTGGGAGAAGAGGAAAATTTGG - Intergenic
904605332 1:31695011-31695033 GCTTGGTGGAGATGGCAGTGGGG + Intronic
904679587 1:32219762-32219784 GCACGGTGCAGTGGAAAGTGAGG + Intronic
905386632 1:37608951-37608973 CCTGGGAGGTGAGGAAGGTGGGG - Intergenic
905524223 1:38624255-38624277 GGTGGGTGGAGAGGAACTGGGGG + Intergenic
905530969 1:38678408-38678430 TGAGGTTGGAGAGGAAAGTGAGG - Intergenic
906197034 1:43935950-43935972 GCTGTGTGGAGGGGAAACTCAGG - Intronic
906214520 1:44031019-44031041 GCGGGAGGGAGAGGGAAGTGGGG - Intronic
906459641 1:46027579-46027601 GCTGGGGGGACAGGCAGGTGTGG - Intronic
906526301 1:46495090-46495112 GCAGGGTGAAGAGGAAACTTTGG + Intergenic
906576648 1:46897130-46897152 GCTGGGGGGAGGGGAAAATGGGG + Intergenic
906595270 1:47070455-47070477 GCTGGGGGGAGGGGAAAATGGGG - Intronic
906667681 1:47632977-47632999 GGTGGGTGGAGGGGTGAGTGTGG + Intergenic
907550337 1:55299540-55299562 GCTGGCTGGAGAGGAGAGCAGGG - Intergenic
907553780 1:55327173-55327195 GATGGGGAGAGAGGAAAGAGAGG - Intergenic
907636671 1:56141872-56141894 ACTGGGAGGAGAGGAATTTGTGG + Intergenic
909571943 1:77123626-77123648 GCTGGGAGGAGGGGACACTGGGG + Intronic
909674946 1:78228289-78228311 GCTGAGGGGAGAGTAAAGTTTGG + Intergenic
910178018 1:84452067-84452089 GCTGGGTAGAAAGGACACTGTGG - Intergenic
910399799 1:86827047-86827069 GCTGGGTAGAGGGCAATGTGGGG + Intergenic
910429356 1:87146078-87146100 GCTTGATGGAGTGGAGAGTGTGG + Intronic
911001023 1:93165884-93165906 GGGGGGTGGAGGGGAAGGTGTGG - Intronic
911049021 1:93653973-93653995 TCTGGGTAGAGAGCAAATTGTGG - Intronic
911167930 1:94741582-94741604 GAAGGGTGGAGGGGAAAATGGGG + Intergenic
911237083 1:95423123-95423145 GTAGGGTGGAGAGGAAGGAGTGG + Intergenic
911299714 1:96157293-96157315 GCTGGGAGGGGATGAGAGTGTGG + Intergenic
911361467 1:96882291-96882313 GCTGGGGGGTGGGGAAAATGAGG + Intergenic
912219462 1:107656217-107656239 GATGGGTGGATAAGAAAATGTGG + Intronic
912710151 1:111944233-111944255 GCTGAGGGGAGAGGAAAGAGTGG + Intronic
912717012 1:111989983-111990005 GCGGGGAGGAGAGGAGAGTCCGG + Intergenic
913272939 1:117111794-117111816 GCTGGGTGTGGGGGAAGGTGGGG + Exonic
914242884 1:145863937-145863959 GCTGGGTTGAGAAAAAAGAGTGG - Intergenic
914450713 1:147788968-147788990 GAAAGGTGAAGAGGAAAGTGAGG + Intergenic
914747034 1:150508586-150508608 GCTGGTGGGAGAGGCAAGGGAGG + Intronic
914797931 1:150937322-150937344 GCTGGAGGGAGGGGAAAATGGGG + Intronic
915036601 1:152932813-152932835 TATGGGTGGAGAGGAACATGTGG + Intergenic
915088980 1:153408499-153408521 GCTTGGTGTACATGAAAGTGAGG + Intergenic
915145480 1:153793885-153793907 CCTGGGAGGAGGGGACAGTGGGG + Intergenic
915558168 1:156671262-156671284 GATGGCTGGAGTGGAAAATGAGG - Exonic
915562126 1:156693453-156693475 GGTGGGAGGAGAGGAAAGGGAGG - Intergenic
916204826 1:162306342-162306364 GCTAGGTATAGAGAAAAGTGAGG + Intronic
916677041 1:167072853-167072875 CCTGGGGGTGGAGGAAAGTGGGG + Intronic
918479637 1:184964703-184964725 GGTTGGCGGAGAGGAAAGAGAGG + Intronic
919140628 1:193567211-193567233 GCTGGGAGGAGAAGAAAATACGG - Intergenic
919879279 1:201891520-201891542 GCTGGGTAGAGTGGATATTGGGG - Exonic
919897288 1:202017262-202017284 GTTGATTGGAGAGGAAAGTGAGG + Intergenic
919904068 1:202065712-202065734 CCTGGGAGGAGAGGAGAATGGGG + Intergenic
920067094 1:203276750-203276772 GGTGGGTGGAGAAGAGGGTGTGG + Intergenic
920131686 1:203736911-203736933 GGTGGGTGGAGAGAAGGGTGAGG - Intronic
920277220 1:204815383-204815405 TCTGGGTGGGGAGCAACGTGGGG - Intergenic
920499141 1:206475392-206475414 GCTGGGGGCAGAGGAGAATGAGG + Intronic
920541684 1:206783630-206783652 GCTGGGGGTTGAGCAAAGTGGGG - Intergenic
920791357 1:209096053-209096075 GCAGGGTTAAGAAGAAAGTGTGG + Intergenic
920947917 1:210546863-210546885 CCTGGGTGGGGAAGAATGTGGGG + Intronic
921550174 1:216526115-216526137 TCTGAGGGGAGAGGATAGTGAGG + Intronic
922310037 1:224380136-224380158 GCTGGGTGGAGAAGAGTGAGTGG + Intergenic
922517065 1:226215420-226215442 GCTTGGTGGAGAGGTAGGGGCGG - Intergenic
922819559 1:228474692-228474714 GATGGAGGGAGGGGAAAGTGTGG + Intergenic
923091130 1:230742138-230742160 GATGGGGGTAGAGGAATGTGGGG - Intergenic
923158626 1:231299282-231299304 ACTGGGTGGAGAAGACACTGAGG - Intergenic
923638116 1:235721972-235721994 GCTTGGTGGAGAGGGAGGGGTGG + Intronic
1063004361 10:1953630-1953652 GCTGGGAGGAGAGGAGGATGTGG + Intergenic
1063118271 10:3086298-3086320 TCTGGGTGCAGAGGAAAGGAAGG + Intronic
1063129250 10:3163423-3163445 GCTTGGTTGCGTGGAAAGTGGGG - Intronic
1065013581 10:21441461-21441483 CCTGGTTAGAGAGTAAAGTGAGG + Intergenic
1065162903 10:22941755-22941777 GCTGGGTGAGGAGGAAAGAAAGG + Intronic
1065634994 10:27722670-27722692 GTTGGTTGGAGAGAAAACTGGGG + Intronic
1065932433 10:30491495-30491517 ACTGGGTGGAGATGAATGTCAGG + Intergenic
1066108413 10:32175773-32175795 GGTGGGTGGACAGAGAAGTGGGG + Intergenic
1066273288 10:33844394-33844416 GCTGTGTGGAGGGAAATGTGGGG - Intergenic
1067525571 10:47036334-47036356 CCTGGCTGGGGAGGAGAGTGAGG + Intergenic
1067976871 10:51036460-51036482 GGGGGGTGCAGAGTAAAGTGAGG + Intronic
1068019351 10:51561639-51561661 GGGGTGGGGAGAGGAAAGTGGGG + Intronic
1068108774 10:52653649-52653671 GCTGGGTGGGGAGTACTGTGTGG + Intergenic
1068305283 10:55200004-55200026 GCAGTGTGGAGGGGAATGTGGGG + Intronic
1069652838 10:70063322-70063344 GATGGGAGGAGAGGAAAGAAAGG - Intronic
1069660989 10:70123395-70123417 GCAGGGTGGCGAGGTGAGTGAGG - Exonic
1069845724 10:71369872-71369894 GCAGGGTGAAGAGGAAAGACAGG - Intergenic
1069979460 10:72242208-72242230 GAGGGGAGGAGGGGAAAGTGGGG + Intergenic
1070105913 10:73431119-73431141 GCTGGGTGGAAGGGAAAATGGGG + Intronic
1070185470 10:74058167-74058189 ACTGGTTGGAGATGACAGTGAGG + Intronic
1070459022 10:76646161-76646183 TATGGCTGGAGTGGAAAGTGTGG + Intergenic
1070485331 10:76924988-76925010 GCTGGGTTGGGAGGGAAGAGGGG - Intronic
1070505710 10:77111128-77111150 GATGGAAGGACAGGAAAGTGGGG - Intronic
1073088231 10:100909797-100909819 GCTGGGGGGAGGTGAAGGTGAGG - Intergenic
1073152860 10:101323586-101323608 GATGGGTGGAGAGGAAAGAATGG - Intergenic
1073472277 10:103730346-103730368 GCTGGGTGGAGTTGGAGGTGTGG + Intronic
1073506468 10:103997076-103997098 GCTGGGAGGAGTGGAAAATGGGG - Intronic
1073580417 10:104660536-104660558 GCTGGGTAGAGGGGAGGGTGAGG - Intronic
1074224733 10:111473530-111473552 GCTGGGCAGAAAGGCAAGTGAGG + Intergenic
1074699816 10:116083175-116083197 CATGGGTGAAAAGGAAAGTGCGG + Intronic
1074897730 10:117791610-117791632 TCTGTGTGGGCAGGAAAGTGGGG - Intergenic
1075995626 10:126873996-126874018 ACTGTGTGGAGAGGAAAGGAAGG - Intergenic
1076040841 10:127247257-127247279 GCTGGGTGGAAAGGAAAAGAAGG - Intronic
1076496975 10:130903894-130903916 GCGGTGTGGAGAGGAGAGTGGGG - Intergenic
1076537057 10:131186196-131186218 GCTGAGGGGAGGGGAAACTGGGG + Intronic
1076604943 10:131683396-131683418 GCTGGGGACAGAGGAAAGAGTGG - Intergenic
1076769695 10:132656272-132656294 GGTGGATGAAGAGGAGAGTGGGG - Intronic
1076778448 10:132710835-132710857 TATGGGTGGAGAGGTAGGTGTGG + Intronic
1076844968 10:133065523-133065545 GATGGGTGGAGGGGTAGGTGGGG + Intergenic
1076888253 10:133272317-133272339 GCTGGGGTGGGAGGGAAGTGGGG - Intronic
1077198083 11:1291508-1291530 GGTGGGTGGTGAGGACAGGGTGG - Intronic
1077353024 11:2101468-2101490 GGTGGCTGGAGAGGAAAGAGGGG - Intergenic
1078245343 11:9569457-9569479 GCTGGGTGCGGTGGAAAGTCTGG + Intergenic
1078638532 11:13074743-13074765 GCTGGTTTGAGGGCAAAGTGAGG + Intergenic
1078938838 11:15977530-15977552 ACTGGGTAAAGAGGTAAGTGGGG - Intronic
1079362565 11:19781394-19781416 GGGAGGTGGAGAGGAGAGTGGGG + Intronic
1079664983 11:23093658-23093680 GGTGGGTGGAGAAGACAGAGAGG - Intergenic
1080759704 11:35236690-35236712 GCTCAGTGGAGAAGAAAGTCTGG + Intergenic
1080885892 11:36367884-36367906 TCTGGGTGAGGAGGGAAGTGAGG + Intronic
1081650137 11:44818341-44818363 GCTGGGGACAGAGGAAGGTGAGG - Intronic
1081856984 11:46310174-46310196 GCAGGGTGGAGAGGATATTCTGG - Intronic
1081957755 11:47108317-47108339 GCTGGTTTTGGAGGAAAGTGAGG - Intronic
1081965505 11:47166750-47166772 GGTGGATGCAGAGGTAAGTGGGG - Exonic
1082215447 11:49561815-49561837 GCTGTGTGGAAAGGAAATTTAGG + Intergenic
1083611541 11:64006756-64006778 GCGGGGTGGGGCGGGAAGTGAGG + Intronic
1083637137 11:64126822-64126844 GCTGGGGGGCGTGGGAAGTGGGG - Intronic
1083658394 11:64241234-64241256 GCTAGGTGACGAGGAAATTGGGG + Intronic
1083996759 11:66276757-66276779 GCAGTGGGGAGAGGAAAGGGTGG - Exonic
1084020355 11:66413662-66413684 GCTGGGTGGACAGAGGAGTGTGG - Intergenic
1084645404 11:70454340-70454362 GCTGTATGGAGAGGTCAGTGTGG + Intergenic
1085127101 11:74009180-74009202 GCTGGCTGGTGAGGGCAGTGAGG + Exonic
1085275754 11:75298579-75298601 GCTGGTGGGAATGGAAAGTGGGG + Intronic
1085298310 11:75443358-75443380 GCTGGGTGGGGAGGACTGTGTGG - Intronic
1085311444 11:75519311-75519333 GCTGGGTGGGGAGGGGAGTCAGG - Intronic
1085717926 11:78889576-78889598 GAGGGATGGAGAGGAAAGAGAGG + Intronic
1086197741 11:84161265-84161287 GCTAGGTGGGGAGGGAAGAGAGG + Intronic
1087044560 11:93833976-93833998 GCTGGGTAGGGAGGGAAGTGAGG - Intronic
1087357550 11:97113861-97113883 ACGGGGTGGAGGGGAAAGAGAGG - Intergenic
1089032416 11:115346122-115346144 GCTGGACAGAGAGCAAAGTGGGG + Intronic
1089296177 11:117469694-117469716 CCAGGGAGGAGAGGGAAGTGGGG + Intronic
1089417741 11:118306591-118306613 GCTCTGGGGATAGGAAAGTGGGG + Intronic
1089770950 11:120802566-120802588 GCAGGATGGAGAGGAACTTGGGG + Intronic
1090494437 11:127196135-127196157 GCTGGGTTGTGAGGTCAGTGGGG - Intergenic
1091315206 11:134609735-134609757 GCTGTGTGTAGGGGAGAGTGAGG + Intergenic
1091712773 12:2753359-2753381 GCTGGGCAGAGAGGAGAGGGAGG + Intergenic
1091844402 12:3644719-3644741 GATGGGTGCAGGGGAAGGTGTGG + Intronic
1091994093 12:4979122-4979144 GCTGGGAGAAGAGAAAAGGGTGG - Intergenic
1092009413 12:5097165-5097187 GGTGAGTGGAAAAGAAAGTGGGG - Intergenic
1092025470 12:5235722-5235744 GCTGGGCAGAGTGGAGAGTGAGG + Intergenic
1092074303 12:5660471-5660493 GCTGGGTGGAGAGTGAGGAGAGG - Intronic
1092156408 12:6284542-6284564 GCTGGGTGCTGAGGACAGTCTGG - Intergenic
1092198958 12:6568185-6568207 GGTGGGTCTAGAGGAAATTGGGG - Exonic
1092811216 12:12272954-12272976 GGTGGCTGGAAAGGAATGTGAGG + Intergenic
1092955236 12:13543402-13543424 GCTGGGTGTAGAGGAAAGTGAGG - Exonic
1093397052 12:18695571-18695593 GCTGGGTGGAGGGTGGAGTGTGG - Intronic
1093440357 12:19188109-19188131 ATTGGGTGGTAAGGAAAGTGTGG + Intronic
1093559361 12:20519862-20519884 GAGGGGTGGTGAGGAAAGTAAGG + Intronic
1093696506 12:22166436-22166458 ACTGGGTGGAGAGGCAGGTTGGG - Intronic
1094062278 12:26326993-26327015 GCTTGGAGGAGAGGAGAGAGAGG - Intergenic
1094345185 12:29460501-29460523 CCTGGGTGTAGTGGAGAGTGGGG - Intronic
1094777367 12:33745989-33746011 GCAGTGTGGAGAGAAATGTGGGG + Intergenic
1095792661 12:46184818-46184840 GCTGTGAGGAAATGAAAGTGAGG - Intronic
1095961504 12:47837714-47837736 GCTGCCTGGGGAGAAAAGTGTGG - Intergenic
1096049927 12:48598626-48598648 GCTTGAGGGAGAGGAAAGTTAGG - Intergenic
1096074621 12:48795278-48795300 GCTGAGTGGAGAATAAATTGTGG + Intergenic
1096324519 12:50647472-50647494 GCAGGGTGGAGAGGAAAAGGAGG - Intronic
1096539331 12:52296198-52296220 CATGGGTGGAGAAGAAAATGAGG + Intronic
1096768597 12:53916080-53916102 GCTGGGAGGAGAGTATAATGGGG - Intergenic
1096771520 12:53938791-53938813 GAGGGGTGGAGAGAAAAGAGGGG + Exonic
1097021571 12:56024739-56024761 CCAGGGCGGAGAGGAAAATGGGG - Intronic
1097037503 12:56133470-56133492 GTTGGGAGAAGAGGAAGGTGGGG + Intronic
1097094728 12:56537344-56537366 GCTGGAGGGAGAGGAGAATGTGG - Intronic
1097244889 12:57602297-57602319 GATGGGTGGAGATGGAATTGAGG - Exonic
1097599018 12:61669256-61669278 GGTGTGGGGTGAGGAAAGTGAGG - Intergenic
1097727467 12:63091409-63091431 GCTGTGTGGAGAGGAATTTGAGG + Intergenic
1097958129 12:65507071-65507093 GCAGGGAGGAGATGAAAATGAGG - Intergenic
1098088041 12:66869259-66869281 GCTGGGTAGAAAGGCAACTGTGG + Intergenic
1098147727 12:67515168-67515190 GCAGGGTGGGGTGGAAAGGGCGG - Intergenic
1099131384 12:78836550-78836572 GCTGAGTGGGGAGGGAATTGTGG - Intergenic
1100090623 12:90965013-90965035 GGTGGGAGGAGGGGAATGTGTGG - Intronic
1100641126 12:96483225-96483247 TCTGGCTGGAAAGGAAAGTCAGG + Intergenic
1101179896 12:102204661-102204683 GCTGTTTAGAGATGAAAGTGTGG + Intergenic
1101287431 12:103329379-103329401 GGTGGGTGGAGAGCAAGGAGAGG + Intronic
1101439870 12:104695636-104695658 GCTGGGTGGAAGTGAGAGTGAGG - Intronic
1101490630 12:105206401-105206423 GCAGGATGGGGTGGAAAGTGAGG + Intronic
1101793152 12:107949100-107949122 ACTGGGTGGAGAAGGCAGTGGGG + Intergenic
1101964375 12:109272440-109272462 GCTGGGAGGGGAGGGGAGTGGGG - Intergenic
1102405873 12:112673811-112673833 GCTGTGTGGGGAGGGAAGTAGGG - Intronic
1102821981 12:115916207-115916229 ACTGGGAGGAGAGGAGAATGGGG + Intergenic
1103217051 12:119209753-119209775 GCTGGGTGCAGAGAGAAATGAGG - Intronic
1103303744 12:119947952-119947974 GCTGGGAGGAGAGGAGAATGGGG + Intergenic
1103830769 12:123777280-123777302 GATGAGGGGAGAGGAAAGTTAGG + Intronic
1103998848 12:124847486-124847508 GCTGGATGGAGTGGCAGGTGGGG - Intronic
1104064528 12:125296261-125296283 GGTGGGTGGGAAGAAAAGTGAGG - Intronic
1104171658 12:126287434-126287456 GCTGGGAGGTGGGGAAACTGAGG - Intergenic
1104331145 12:127846912-127846934 GCTGGGAGGAGAGGAGAATGTGG + Intergenic
1104414399 12:128585881-128585903 GCTGGGATGAGGGGGAAGTGGGG + Intronic
1104664220 12:130635910-130635932 GCTGTGTGGAGAAGACAGTAGGG - Intronic
1104738705 12:131156765-131156787 GCTGGGGGGTGAGGGAAATGGGG + Intergenic
1104971574 12:132533205-132533227 GCTGGGTCGGGAGGAGACTGTGG - Intronic
1104971580 12:132533227-132533249 GCTGGGTCGGGAGGAGACTGTGG - Intronic
1104971599 12:132533313-132533335 GCTGGGTCGGGAGGAGACTGAGG - Intronic
1104971609 12:132533356-132533378 GCTGGGTCGGGAGGAGACTGTGG - Intronic
1104971619 12:132533399-132533421 GCTGGGTCGGGAGGAGACTGAGG - Intronic
1104971628 12:132533442-132533464 GCTGGGTCGGGAGGAGACTGTGG - Intronic
1105439848 13:20405908-20405930 GCAGGGAGGGGAGGAATGTGAGG - Intronic
1105453199 13:20518470-20518492 GGTGGGGGGAGAGGAAGGAGGGG + Intronic
1105583487 13:21722692-21722714 GTTGTGGGGAGAGGAAAATGAGG - Intergenic
1105732606 13:23233514-23233536 GTTGGGTGGAGGGGAGAATGGGG + Intronic
1107163548 13:37259597-37259619 TCAGGGTGGAGATGGAAGTGTGG + Intergenic
1107660115 13:42630561-42630583 GGTGAGTGGAGAGGAAGGAGGGG - Intergenic
1107831093 13:44374153-44374175 GCGGGGTGGGGCGGAAGGTGGGG + Intronic
1107844776 13:44500571-44500593 GGGGTGTGGTGAGGAAAGTGAGG - Intronic
1108510807 13:51153990-51154012 GCTGGGGGTAGGGGAAAATGGGG - Intergenic
1108680219 13:52773673-52773695 GCTGGGGAGAAAGGAGAGTGAGG - Intergenic
1109207742 13:59500671-59500693 GCTGGGAGGGGGGGAAGGTGGGG + Intergenic
1110278876 13:73669605-73669627 GCTGGGGTGAGAGGAAAAGGTGG - Intergenic
1110493871 13:76142168-76142190 GCTGGGTGGAGAGAAAAATTGGG + Intergenic
1110618485 13:77568671-77568693 GGTGGGTGGGGAAGGAAGTGAGG - Intronic
1110890831 13:80695584-80695606 GGTGGGTGGAGGGGCAAGGGAGG + Intergenic
1110969193 13:81739739-81739761 GCTGGGTGGTGGGGTTAGTGGGG - Intergenic
1111418859 13:87983823-87983845 GCGGGCTGGAGGGGAAAGAGAGG - Intergenic
1112098777 13:96164626-96164648 GATAGGTGAAGAGGAATGTGTGG - Intronic
1112307237 13:98286099-98286121 ACTGGGTGGAAGGGACAGTGAGG - Intronic
1112651975 13:101409446-101409468 GCTGGGAGGAGGGGAAAATGGGG - Intronic
1112942607 13:104883479-104883501 GCCTGTTGGAGAGGGAAGTGGGG - Intergenic
1112971229 13:105265721-105265743 GCTCAGTGGAGAAGAAAGTGAGG + Intergenic
1113231056 13:108215070-108215092 GGTGTGTGGAGAGTCAAGTGGGG - Intronic
1113481529 13:110625462-110625484 GCGGGGTGGAGAGGTGGGTGGGG + Intronic
1113564987 13:111314388-111314410 GAAGGGTGGAGAGGACACTGGGG + Intergenic
1113565001 13:111314437-111314459 GAAGGGTGGAGAGGACACTGGGG + Intergenic
1113565015 13:111314486-111314508 GAAGGGTGGAGAGGACACTGGGG + Intergenic
1113785578 13:113000606-113000628 GCTTGCTGGAGAGGAAAGCGTGG - Intronic
1113939414 13:114010664-114010686 GCTGCGTGGGGAGGGAAGTGGGG + Intronic
1113952497 13:114079825-114079847 GCCGGGTGGGGAGGCCAGTGCGG - Intronic
1114682636 14:24499212-24499234 GCTGGTTGAAGAGGCCAGTGTGG + Intergenic
1115936579 14:38559584-38559606 GCAGGGTGGAGGGGGAAATGTGG - Intergenic
1116034176 14:39608251-39608273 GGGGGGGGGAGGGGAAAGTGGGG - Intergenic
1116424689 14:44776006-44776028 GTTGGGGGAGGAGGAAAGTGAGG + Intergenic
1116885092 14:50212805-50212827 ACTGGGAGGACAGGGAAGTGAGG + Intronic
1118113201 14:62746005-62746027 GCTGTGTGGAGAACAAAATGGGG + Intronic
1118375267 14:65171275-65171297 GCAGGGTAGAGAGGAGAGTCAGG - Intergenic
1118557215 14:67038289-67038311 GCTGGGAGGAGAGGGAAATAGGG + Intronic
1118785650 14:69043660-69043682 CCTCGGTGGGGTGGAAAGTGGGG - Intergenic
1119222478 14:72920309-72920331 GGTGGGTGGAGAGAGAAATGAGG - Intergenic
1120013466 14:79443972-79443994 GCTGGGTAGAGAAGGAAGGGAGG + Intronic
1120572193 14:86133943-86133965 GCTGGGAGAATAGGAAAGTTGGG + Intergenic
1121092340 14:91191289-91191311 GCTGGGAGGAGAGGGGAATGGGG + Intronic
1121092484 14:91192335-91192357 GCTGGGAGGAGAGGGGAATGGGG + Intronic
1121273535 14:92652822-92652844 GGTTGTTGGAGAGGAAAGCGTGG - Exonic
1121293281 14:92794709-92794731 GATGGGTGGGGAGCAGAGTGGGG + Intronic
1121696556 14:95917960-95917982 GCTGGGTGGAGGGGGAAGTGGGG - Intergenic
1122136155 14:99634039-99634061 ACTCGGTGGTGAGGAAAGGGAGG + Intergenic
1122600173 14:102917460-102917482 GCTGTGTGGAGAGGGTAGTGAGG - Intergenic
1122718746 14:103710293-103710315 GCTGGGGGGAGAGGAAGTTGGGG + Intronic
1122737201 14:103849600-103849622 GCTGGGTGGAGAGGAGGATGGGG - Intergenic
1122899159 14:104775034-104775056 GCAGGGTGGAGATGAGGGTGCGG - Intronic
1122962824 14:105105439-105105461 GCTGGGAGGAGGGGGAAATGGGG + Intergenic
1124242973 15:28046481-28046503 TCTGGGAGGACAGGAAAGGGAGG + Intronic
1124619067 15:31263953-31263975 GCTGGGTGGGGAGGGGAGTGTGG - Intergenic
1124639437 15:31387620-31387642 ACTGGGTGGTGGGAAAAGTGGGG + Intronic
1124782061 15:32645448-32645470 TCTGAGTGGAGAGGGAAGTGGGG + Intronic
1125472294 15:40015979-40016001 GGTGGGAGGAGAGGGAAGGGAGG + Intronic
1125679626 15:41522755-41522777 GCTGTGTGGCCAGGTAAGTGTGG - Exonic
1125888676 15:43249421-43249443 GCTGGGAGGAGGGGATAGTTGGG - Intronic
1125900853 15:43345490-43345512 GGTGGGAGGAGAGGAAAGAGTGG + Intronic
1126087485 15:45023388-45023410 GCTGGGCTCAGAGGAGAGTGAGG - Intronic
1127364803 15:58278635-58278657 GCTGGGATCAGAAGAAAGTGAGG + Intronic
1128256259 15:66199333-66199355 ACTGGGAGGAGAGGAGGGTGGGG - Intronic
1128555668 15:68630105-68630127 GAGGGGTGGAGAGGAAAACGAGG - Intronic
1128559685 15:68656325-68656347 GCTGAGTGGAATGGAAAGGGGGG - Intronic
1128639511 15:69325788-69325810 GGTGGGTGGAGAGGTAGATGAGG - Intronic
1128648327 15:69393087-69393109 GCTGAGGGGAGAGGGAGGTGAGG + Intronic
1129356747 15:74996558-74996580 GGTGGGAGGAGAGGCAAGAGAGG + Intronic
1129519761 15:76178237-76178259 GCTGGATGGAGAGGGCAGGGTGG + Intronic
1129909093 15:79211375-79211397 GCTGGGAGGAGCGGAGAGTCCGG + Intergenic
1130289042 15:82580672-82580694 GCTAGGAGGAGAGGGTAGTGGGG - Intronic
1130472218 15:84235847-84235869 GCGGGGTGGGGAGGGAAGCGGGG - Exonic
1131192451 15:90327429-90327451 GCTGGGGACAGGGGAAAGTGGGG + Intergenic
1131196876 15:90362680-90362702 GCTGGGAGAAGATGAAAGTCTGG - Exonic
1131471987 15:92705479-92705501 GCTGGTGGGAGAGAAAAATGGGG - Intronic
1132248377 15:100315298-100315320 GGTGGGGGGAGAGAAAAGAGGGG - Intronic
1132286043 15:100663307-100663329 GGTGGGTGGAGAGGGGAGCGTGG - Intergenic
1132434016 15:101781991-101782013 GCGGGGTGGGGAGGGAGGTGGGG + Intergenic
1132478228 16:153134-153156 ACTGTGGGGAGAGGACAGTGAGG + Intronic
1132480303 16:163710-163732 ACTGTGGGGAGAGGACAGTGAGG + Intronic
1132581253 16:685718-685740 GCTGGGTGACGTGGAAGGTGAGG - Exonic
1132854466 16:2038664-2038686 GCTGGGTGGGGAGCAGGGTGTGG - Exonic
1133220872 16:4318683-4318705 GGAGGGTGGAGGGGAGAGTGGGG - Intronic
1133328902 16:4959023-4959045 GGTGGGGGTAGAGGAAAGTTTGG + Intronic
1133696909 16:8273384-8273406 GGAGGGTGGAGGGGGAAGTGGGG - Intergenic
1133791775 16:9014551-9014573 GCTGGGTGGAGAGGGCAGCCTGG - Intergenic
1133835542 16:9364177-9364199 GGTGGGTGGGGAGGAAAGGCAGG - Intergenic
1134014978 16:10881827-10881849 GCTGGGTGGAAGGGGCAGTGGGG - Intronic
1134241007 16:12506808-12506830 GGTGGGTTGGGAGGGAAGTGTGG - Intronic
1134313975 16:13101111-13101133 GCTGTGGGGAGAGGGAAGTGGGG + Intronic
1134482671 16:14632750-14632772 TCTGGGTGAAGAGGAAGGGGCGG + Intergenic
1135464080 16:22670352-22670374 GCTGGGGGGATAGGGCAGTGGGG + Intergenic
1136450141 16:30349821-30349843 GCTGGGGGGTGAGGAAAGGTGGG + Intergenic
1136611027 16:31365193-31365215 GCTGGGTGTGGGGGAAAGTCAGG + Intronic
1136651610 16:31677769-31677791 GCTCTGTGGAGAGGCATGTGGGG + Intergenic
1136774951 16:32866969-32866991 GCTGGGTCGAGAGGACATTCCGG + Intergenic
1136895667 16:33994543-33994565 GCTGGGTCGAGAGGACATTCCGG - Intergenic
1137003911 16:35255249-35255271 GCTGGGGGGAGTGGGAGGTGAGG - Intergenic
1137366318 16:47862688-47862710 GCTGGGAGGTGAGAAAAGTTGGG + Intergenic
1137936703 16:52641834-52641856 GCTATGTGGAGAGGAAGATGAGG + Intergenic
1138523287 16:57585567-57585589 TCTGGGAGGAGAGAGAAGTGAGG - Intronic
1138751645 16:59429949-59429971 GCTGGGTGGGGTGGGAGGTGGGG + Intergenic
1138927723 16:61612213-61612235 GATGGGGGAAGAGGAAAGGGGGG + Intergenic
1139113770 16:63924210-63924232 GCTGGGAGGTGGGGAAAATGGGG + Intergenic
1139818616 16:69700092-69700114 GCAGGGAGGGGAGGAAAGGGAGG - Intronic
1140553079 16:75888414-75888436 GCTGGGTGAAGAAGAATGGGAGG - Intergenic
1141541355 16:84725198-84725220 GCTGGGAGGAGAGGAGAATGGGG - Intronic
1142018468 16:87765448-87765470 GCTGGGTGGTGAGAAGAGGGAGG - Intronic
1142046790 16:87930610-87930632 GCTGGGTGGGGAGGAGAGAGCGG + Intronic
1142052190 16:87965896-87965918 GCGGAGTGGACAGGAGAGTGGGG + Intronic
1203077369 16_KI270728v1_random:1129078-1129100 GCTGGGTCGAGAGGACATTACGG + Intergenic
1142628550 17:1208200-1208222 CCTGGGTGGAAAGGAAATGGTGG + Intronic
1142769631 17:2087335-2087357 GCTGGCTGCCCAGGAAAGTGCGG + Intronic
1142831756 17:2554301-2554323 GCTGGGGGGAGGGGAGAATGGGG - Intergenic
1143428120 17:6856439-6856461 GCTGGGGGAAGAGGAAAGGGAGG + Intergenic
1143446440 17:7012819-7012841 GCTGGGAGGCGAGGAAACTCTGG + Intronic
1143491653 17:7288706-7288728 GGTGGGTGGCCAGGAAGGTGAGG - Intronic
1143973735 17:10814819-10814841 GCAGCGTGGAGAGGAGAGAGGGG + Intergenic
1144002584 17:11069646-11069668 GCTGGGAGGAGGGGAAAATGGGG - Intergenic
1144058805 17:11563106-11563128 GCTGGCTGGAGAGAAAGGTCTGG + Exonic
1144284412 17:13759173-13759195 GCAGAGTGGAGAGCAGAGTGAGG + Intergenic
1144454667 17:15408937-15408959 GCTGGGTGCCGGGGAAGGTGGGG + Intergenic
1144517656 17:15929858-15929880 GCTGGGGGAAGGGGAAAATGGGG + Intergenic
1144792117 17:17866308-17866330 GCTGGGAGGAGAGGGAAGATGGG + Exonic
1144839335 17:18175951-18175973 TCCAGGTGGAGAGGACAGTGAGG - Intronic
1146113183 17:30110584-30110606 GCTGGGGGTAGGGGAAAGTGGGG - Intergenic
1146356677 17:32140365-32140387 ACTTGGTAGAGAGGAAACTGAGG + Intergenic
1146910201 17:36643529-36643551 TGTGGGTGGAGAGGATGGTGGGG + Intergenic
1146940542 17:36841308-36841330 GTTGGGAGAAGAGGAAAATGTGG - Intergenic
1147134189 17:38425767-38425789 CCCGGATGGAGAGGAAGGTGAGG + Intergenic
1147371757 17:39997482-39997504 CCTGGGGAGAGAGGCAAGTGAGG - Exonic
1147389928 17:40102916-40102938 ACTGGGTAGTGAGGACAGTGAGG + Intergenic
1147426415 17:40347883-40347905 GCTGGGGGCAGAGGAAACTGGGG - Intronic
1147487197 17:40827859-40827881 AATGGCTGGAGAGGAAAGTAGGG + Intronic
1147716462 17:42512064-42512086 GCTGGGCAGAGAGGAAACTGAGG + Intronic
1147846009 17:43404258-43404280 AGTGGGTAGAGAGGAAAGGGAGG + Intergenic
1148155851 17:45425038-45425060 TCTGGGTGGACAGCAATGTGGGG + Intronic
1148160306 17:45445989-45446011 GCTGGGAGGACAGGAAAGAGTGG - Intronic
1148386798 17:47239913-47239935 GAGGGGTGGAGAGGAGAGGGAGG + Intergenic
1148737469 17:49872968-49872990 GCAGGGAGGAGTGCAAAGTGGGG + Intergenic
1148740067 17:49887692-49887714 GCTGGTTGGAGAAGGAAGTATGG - Intergenic
1148955376 17:51349415-51349437 CCTGGGTGGAGATGGAAATGAGG + Intergenic
1149331104 17:55582890-55582912 GCTGCTAGGAGAAGAAAGTGTGG + Intergenic
1149999305 17:61423369-61423391 GCTGGGAGGAGAGGGTAATGAGG + Intergenic
1150180710 17:63117626-63117648 GCTGGCTGGAGATTAAAGTGTGG + Intronic
1150391598 17:64792868-64792890 GCTGGGAGGACAGGAAAGAGTGG - Intergenic
1150533277 17:66008686-66008708 GCTGGGTGGGGAGGGATGTCAGG - Intronic
1150543391 17:66127607-66127629 TCTGGGTGGAGAGCAGAGTAAGG - Intronic
1150630227 17:66875283-66875305 GCTGGGTGGAGAGGGCTGTTTGG + Intronic
1150933606 17:69611646-69611668 GCTGAGGGGAGGGGAAAATGGGG + Intergenic
1151387133 17:73761823-73761845 GAAGGCTGGAGAGGAAAGTGTGG + Intergenic
1151479554 17:74362087-74362109 GCTGGGTGGTAAGGAGATTGGGG - Intergenic
1151826026 17:76524874-76524896 GCAGGGCAGAGAGGACAGTGCGG - Intergenic
1152366781 17:79860930-79860952 CCTGGGTGGACATGAATGTGGGG - Intergenic
1152790216 17:82274635-82274657 GAGGGGTGGAGAGGAAAGACTGG - Intergenic
1152802857 17:82339961-82339983 ACTGGGGGGAGAGGACACTGGGG - Intergenic
1152887065 17:82858806-82858828 GCTTGGTGGCGAGGAGGGTGCGG + Intronic
1152931049 17:83110074-83110096 GCTGAGAGGACAGCAAAGTGCGG + Intergenic
1153432493 18:5033264-5033286 GCTGGGGAGAGGGGAAAATGGGG + Intergenic
1153778758 18:8476414-8476436 GGTGGGGGGAGAGGGAAGGGAGG + Intergenic
1155178661 18:23324138-23324160 GCTGGGAGGAGAGCAAACTCTGG - Intronic
1155510670 18:26573249-26573271 GCTGGGGGGAGGGGAGAATGAGG + Intronic
1156141129 18:34112697-34112719 GCTGGAGGGTGAGGAAAATGAGG + Intronic
1156204415 18:34870678-34870700 GCTGGGTGTAGAGAGAAATGAGG - Intronic
1156454413 18:37284989-37285011 GAGGGGTGGAGAGGGAAGAGAGG - Intronic
1156891029 18:42189445-42189467 GCTGAGTGGAGAAGTAAGTGTGG + Intergenic
1157322001 18:46641907-46641929 TGAGGGTGGAGATGAAAGTGAGG - Intronic
1157489803 18:48115072-48115094 GCTGGATGGAAAGGGAAATGGGG - Intronic
1157573614 18:48729912-48729934 TCTGGGTGGATTGGAAAGAGCGG - Intronic
1157595394 18:48860897-48860919 GTTGGCTGGAGAGGAAGGTGTGG + Exonic
1157648750 18:49305114-49305136 GTTGGGTGAGGAGGGAAGTGAGG - Intronic
1158240477 18:55371723-55371745 GCTAGGTGCAGAGGAACCTGGGG - Intronic
1158267597 18:55677345-55677367 GGTGGGCAGAGAGGAAGGTGAGG + Intergenic
1158487736 18:57882741-57882763 ACTGGGAGGAGAGGAGAATGGGG - Intergenic
1158608738 18:58919528-58919550 CCTGGGGGGAGAGGAAAGGACGG - Exonic
1158797249 18:60861749-60861771 GCTGAGTGGGGAGGAAAATAGGG - Intergenic
1158811497 18:61042606-61042628 GCTGGGAGTAGGGGAAAATGGGG - Intergenic
1159275508 18:66215792-66215814 GCTGGGTTGAGGGGAGAGTGGGG - Intergenic
1161031994 19:2061797-2061819 GCTGGGGGCAGAGGTAAGGGAGG + Intergenic
1161066554 19:2241361-2241383 GATGTGTGGAGAGGCAAGTGCGG + Intronic
1161206537 19:3044236-3044258 GCAGGCTGGAGGGGAAACTGAGG - Intronic
1161270640 19:3387661-3387683 GCTGGGTGGAGGGAGCAGTGAGG + Intronic
1161285975 19:3468480-3468502 GCTGGGTGGGCAGGAAGCTGGGG - Intronic
1162297410 19:9822797-9822819 GCTGAGAGAAGAGGAAAATGGGG - Intronic
1162741939 19:12778418-12778440 AGCGGGTGGAGAGGATAGTGGGG + Intronic
1162801980 19:13116351-13116373 CCCGGGCGGAGCGGAAAGTGAGG + Exonic
1163448632 19:17362371-17362393 GCTGGGTTGAGAGGAAAATTTGG - Intronic
1163610551 19:18299164-18299186 GCTGGCTGGCGAGCAAAGTGAGG - Intergenic
1163712179 19:18853380-18853402 GCTGGTGGGAGAGGAAAGTGGGG + Intronic
1164442781 19:28291987-28292009 GATGGATGGAGAAGAAAGTCAGG - Intergenic
1164741198 19:30576658-30576680 GTGGGCTGCAGAGGAAAGTGAGG - Intronic
1164742253 19:30584400-30584422 TCTGGGTGTAGTGGAAAGTGTGG + Intronic
1165430019 19:35767196-35767218 GATGTGTGGAGAGGACACTGAGG - Intronic
1165748622 19:38246351-38246373 GCTGGGTGGGGAGGCTAGTGTGG + Intronic
1166211455 19:41309218-41309240 GCTGGGTTAAGAGGAAGGTAGGG - Intronic
1166598117 19:44069380-44069402 GGTTGGTGGTGAGGGAAGTGGGG - Intergenic
1166671955 19:44715688-44715710 GCCGGCAGGAGAGGAAGGTGGGG + Intergenic
1166777872 19:45323447-45323469 ACTGAGTGGAGGGGAAACTGAGG + Intergenic
1166882848 19:45939822-45939844 GATGGGAGGAGAGAAAAGGGTGG + Exonic
1167215155 19:48159634-48159656 GGTGGCAGGAGAGGAAAGTCAGG + Intronic
1167304132 19:48697002-48697024 GCTGGGTGTAGGGGACAGAGGGG + Intronic
1167621652 19:50564135-50564157 GCTGGTTAGAGGGGAGAGTGGGG + Intronic
1167787875 19:51650643-51650665 TCTGGCTGGAGACAAAAGTGGGG + Intergenic
1168093888 19:54103362-54103384 GGTAGGTGGAGAGGAACGCGGGG - Intronic
1168113329 19:54207312-54207334 GGTGGGTGGAGAGGAAAGAGTGG + Intronic
1168138241 19:54366110-54366132 GCTGGGAGGAGGGGGAAATGGGG + Intronic
1168159705 19:54501951-54501973 GCTGGGAGGAGGGGGAAATGGGG - Intronic
1168383085 19:55940792-55940814 GGGGTGTGGGGAGGAAAGTGGGG - Intergenic
925909289 2:8562621-8562643 GCTGGAAGGAGAGGGAAATGGGG + Intergenic
925921749 2:8643098-8643120 GGTGGGAGGAGCTGAAAGTGAGG + Intergenic
926369003 2:12161727-12161749 GCTGAGAGGAGAGGAAAGAAAGG - Intergenic
926775962 2:16423561-16423583 GGTGGGTGCAGTGGTAAGTGAGG + Intergenic
926811741 2:16760908-16760930 CCTGGGTGGAGAAGAAACTGCGG - Intergenic
927487594 2:23499311-23499333 GGTGACTGGAGAGGAAATTGAGG + Intronic
927552642 2:24012566-24012588 GCTGGGTGGAGTGGATTGTAGGG + Intronic
927651058 2:24914048-24914070 GCTGGGTGAGGAGGAAGGAGGGG - Intronic
927690930 2:25207569-25207591 CCCTGGTGGAGAGGACAGTGTGG - Intergenic
928102159 2:28445248-28445270 GCCGGGTGCAGAGGACATTGAGG + Intergenic
928121728 2:28588544-28588566 ACTGGCTGGAGAGGGAAGTCAGG - Intronic
928218577 2:29383154-29383176 GGAGGGTGGAGAGGGAAGGGTGG - Intronic
928296044 2:30085030-30085052 GCTGTGTGGAGATAAAACTGTGG + Intergenic
928404357 2:31003390-31003412 GGAGGGTGAGGAGGAAAGTGGGG - Intronic
928490512 2:31778307-31778329 GCTGGTTGGGGAGGAAAGGCCGG - Intergenic
929043822 2:37771989-37772011 CCTGGGTGGGGAGGACACTGTGG - Intergenic
929163689 2:38859367-38859389 GCTGGGGGAAGGGGAAAATGAGG + Intronic
929536359 2:42786811-42786833 GCTCAGTGAGGAGGAAAGTGTGG + Intronic
929835250 2:45390631-45390653 AATGGGTGGAGGGGAAAATGAGG - Intronic
930908059 2:56597688-56597710 GCTAGGAAGAGAGGGAAGTGGGG + Intergenic
931721558 2:65070814-65070836 GCTATGAGGGGAGGAAAGTGAGG + Intronic
931798311 2:65733405-65733427 GATGAGTGGAGGGGAAGGTGAGG - Intergenic
932403995 2:71501574-71501596 GCTGGGGGGAGGAGGAAGTGAGG - Intronic
932841602 2:75088313-75088335 GCTGCGTGGAGAGGGAAGGAAGG - Intronic
932841768 2:75089719-75089741 GGTGAGAGGTGAGGAAAGTGAGG + Intronic
932910392 2:75800207-75800229 GGTGGGTGGGGAGGAACGTTGGG + Intergenic
933575524 2:84063171-84063193 GCTGGGTGTAGGGGTCAGTGGGG - Intergenic
933774836 2:85765703-85765725 CCTGGGTGAAGAGGAGGGTGCGG - Intronic
933809122 2:86021496-86021518 ACAGAGTGGAGAGGACAGTGGGG - Exonic
934766314 2:96882081-96882103 GCAGGGAGGAGATGGAAGTGTGG - Intronic
934937087 2:98473276-98473298 TGTGGGTGGAGTGGAGAGTGTGG + Intronic
934937101 2:98473336-98473358 TGTGGGTGGAGTGGAGAGTGAGG + Intronic
935146794 2:100401112-100401134 GATGGGAGGTGAGGGAAGTGGGG - Intronic
935385863 2:102499661-102499683 TCTGGGAGGAGAGGAAGCTGGGG - Intronic
935810151 2:106789711-106789733 GCTGGGTGGAGGGGATTGTATGG - Intergenic
936112599 2:109677202-109677224 GCTGGCTGGTGACAAAAGTGAGG - Intergenic
936126528 2:109793167-109793189 GCTGGGTGGAGGGGAAATCTGGG - Intronic
936149629 2:110008141-110008163 CCTGGCGGGAGAGGAAAGGGTGG - Intergenic
936195049 2:110363228-110363250 CCTGGCGGGAGAGGAAAGGGTGG + Intergenic
936218165 2:110578301-110578323 GCTGGGTGGAGGGGAAATCTGGG + Intergenic
936235187 2:110736380-110736402 GCTGGGGGAAGAGGGGAGTGGGG - Intronic
936279770 2:111128094-111128116 GCTGGGGGGAGGGGGAAATGGGG - Intronic
936464325 2:112733558-112733580 GCTGGCTGGAGAGTGAAGTTGGG + Intronic
936514440 2:113173027-113173049 GCTGTGTGGACATGCAAGTGAGG + Intronic
936826982 2:116593760-116593782 GCTGGGTGGAGGGGAGAATATGG - Intergenic
936959111 2:118055145-118055167 GGTGATTGGAGAGGAATGTGTGG - Intergenic
937094447 2:119226289-119226311 CGTGGGTGGACAGGAAAGAGTGG - Intronic
937179395 2:119976683-119976705 GCTGGGTGAAGAGGTAAATTAGG + Intronic
937839493 2:126511282-126511304 GGAGGGTGGTGAGGAAAGAGAGG - Intergenic
937992168 2:127670467-127670489 GCTGGGAGGAGGGGGAAATGAGG + Intronic
939079947 2:137647703-137647725 GCAGGGAGGAGAGGAAAGAAAGG - Intronic
939270667 2:139935348-139935370 TCTGTGAGGAGAGGAAAGAGGGG - Intergenic
939409290 2:141803369-141803391 GCAGGGGGGATAGGAAGGTGGGG - Intronic
939444152 2:142287461-142287483 GATGGAAGGAGAAGAAAGTGAGG + Intergenic
939956353 2:148530654-148530676 GCTGGGTGGAGAGAGAAGCTGGG - Intergenic
940164912 2:150760395-150760417 GCTGGGTGGAGAGGACATGCAGG - Intergenic
940168920 2:150805692-150805714 GCTGGGTGGATAGCACAGTAGGG - Intergenic
940907659 2:159183608-159183630 GTTGGGTTGAGAGGAGAGAGAGG + Intronic
941099861 2:161283688-161283710 TCTGGGTAGAGAGCAGAGTGGGG - Intergenic
942070870 2:172314106-172314128 GGTGGGTGGAGTGGGAGGTGAGG - Intergenic
942428624 2:175885054-175885076 GCCGTGTAGAGAGGAAAGTAGGG - Intergenic
942591529 2:177552316-177552338 GGAAGGGGGAGAGGAAAGTGGGG - Exonic
943624625 2:190184716-190184738 GCTGGGTGGAGATAAAGGCGAGG + Intronic
944310375 2:198226239-198226261 GCTGGGGGGAGAGGAAAATAGGG + Intronic
945265542 2:207888082-207888104 ACTGGGTGGAGAGGAAAGGGAGG - Intronic
945552852 2:211242465-211242487 ACTGGGAGGACAGGAAATTGGGG - Intergenic
945819962 2:214651763-214651785 GCTGGGTGGTGTGAAAAATGAGG - Intergenic
945916720 2:215712064-215712086 GCTGCATGGAGAGGAAGGTAGGG - Intergenic
946064035 2:216970795-216970817 ACTGCATGGAGAGGAAAGGGAGG - Intergenic
946179870 2:217942792-217942814 GCTGGGTGGGGAGGAGATGGAGG - Intronic
946199767 2:218064834-218064856 GCTGGGTGGGGAGGAACTGGAGG - Intronic
947315967 2:228858801-228858823 GCTGGCTGGAGAAGAATCTGAGG - Intronic
947505952 2:230708663-230708685 GATGGCTGGAGGGGAATGTGGGG - Intergenic
947862417 2:233370130-233370152 GCTGGGAGGAGGGGGAAATGAGG - Intronic
948093792 2:235317268-235317290 GCTGGGAGGTGGGGAAAATGGGG + Intergenic
948251871 2:236536004-236536026 GGTGGGTGCAGAGGATGGTGGGG + Intergenic
948400002 2:237677193-237677215 GCTGGATGGAGAAGAGAATGGGG - Intronic
948656289 2:239478592-239478614 GCTGAGTGGAAGGGAAAATGGGG + Intergenic
948668975 2:239554295-239554317 ACTGGGCTGAGATGAAAGTGGGG + Intergenic
948765688 2:240217575-240217597 GGTGGGTGGAGCTGAAAGAGTGG - Intergenic
1168980606 20:2000449-2000471 GCTAGGCGGAGGGGGAAGTGGGG + Intergenic
1169070600 20:2726927-2726949 GCTGGGGGGAGAGGGAGATGGGG - Intronic
1169188507 20:3641100-3641122 GCTGGGAGAAGGGGAAAATGGGG + Intronic
1169840204 20:9927126-9927148 GCTGGGAGTAGGGGAAAATGAGG + Intergenic
1170473190 20:16688610-16688632 GCTGGGTGGAGTAGCAAGAGTGG + Intergenic
1170520174 20:17177243-17177265 GCCTTGTGGAGAGGACAGTGCGG + Intergenic
1172173602 20:32959538-32959560 GCATGGTGGAGAGGACAGAGTGG + Intronic
1172358231 20:34294370-34294392 GCTGTGTGGAAGGGAAAGGGTGG + Intronic
1172891923 20:38271592-38271614 GCAGGGTGGAGAAGATTGTGCGG - Intronic
1173016166 20:39227757-39227779 GCTGGCTGGGGAGGAGAGGGGGG + Intergenic
1173125237 20:40330367-40330389 GATGGTTAGAGAGGAAAATGAGG - Intergenic
1173180464 20:40802966-40802988 GCTGGGTGGAGAGGACTTTAAGG - Intergenic
1173312951 20:41916716-41916738 GCTGGCTGTAGTGGAAAGTGAGG + Intergenic
1173677641 20:44851244-44851266 GCTGGGTGGAGGGAAGAATGGGG + Intergenic
1174293619 20:49527587-49527609 GCTGGGAGGAAAGGCAGGTGGGG + Intronic
1174381386 20:50157639-50157661 GCTGGGGAAAGAGGGAAGTGAGG - Intergenic
1174615059 20:51829068-51829090 CCTAGGGAGAGAGGAAAGTGAGG - Intergenic
1175491683 20:59384385-59384407 GGTGAGTGGGGAGGAAGGTGGGG + Intergenic
1175655110 20:60763158-60763180 ACTGGGTGCATAGGAAAGGGCGG + Intergenic
1175891489 20:62317952-62317974 GAGGGGTAGAGAGAAAAGTGGGG + Intronic
1175969759 20:62678896-62678918 CTGGGGTGGAGAGGAAACTGTGG + Intronic
1175973997 20:62701380-62701402 GGTGGGGGGAGAGGAAGGAGGGG - Intergenic
1176085114 20:63292425-63292447 ACTGGGTGGTGACGCAAGTGTGG - Intergenic
1176266285 20:64211147-64211169 GCTGGGTGGTGAGCAGAGAGGGG - Intronic
1177552805 21:22647852-22647874 GCTGTTTGGAGAAGAAAGCGTGG + Intergenic
1178358256 21:31926497-31926519 GCTGGGGGAAGAGGGAAATGGGG - Intronic
1178389743 21:32188546-32188568 GCTGGGTGGAAGAGAAAATGAGG + Intergenic
1178389953 21:32189971-32189993 GCTGGGTGGAGGAGAAAGTGAGG - Intergenic
1178628093 21:34235040-34235062 GCTGGGAGGAGGGGAGAATGGGG + Intergenic
1178669824 21:34580610-34580632 GCTGGGTGGAGAGATGGGTGTGG + Intronic
1178888929 21:36504889-36504911 GCTGGGTGGAAAAGAAAATTTGG + Intronic
1178905895 21:36635754-36635776 ACTAGGTTGAGAGGAAAGAGAGG - Intergenic
1179047312 21:37857512-37857534 GCTGAGTGGAAAAGAAACTGTGG + Intronic
1179066868 21:38033064-38033086 GCTGAGAGGAGAGGGAAATGGGG - Intronic
1179089793 21:38254251-38254273 GCAGGGTTGAGAGGTGAGTGGGG - Intronic
1179654559 21:42837401-42837423 GCTGGGCGCAGAGGAAAATGTGG - Intergenic
1179774914 21:43655617-43655639 GCTGGGTGGAGAGAGAGGTTGGG - Intronic
1180171708 21:46062553-46062575 GATGGGTGAAGAGGAAACTGAGG - Intergenic
1180514947 22:16132073-16132095 GCTCCCTGGAGCGGAAAGTGGGG - Intergenic
1180729107 22:17968180-17968202 GCAGAGTGAAGAGGAAAGAGAGG + Intronic
1180860313 22:19075583-19075605 GCTGGGAGGAGAGAAAAATTGGG - Intronic
1181317348 22:21979211-21979233 GTTGGGTGAAGAGGGAGGTGAGG + Intronic
1182207295 22:28641501-28641523 GATGGAAGGAGAGGAAAATGAGG + Intronic
1182325860 22:29512136-29512158 GCTGGGAAGAGAGGAGAGAGGGG + Exonic
1182896006 22:33859957-33859979 GCTGGGAGGAGGGGAAAATAGGG + Intronic
1182948453 22:34347935-34347957 ACAGGGTGGAGAGGGAAGAGGGG + Intergenic
1183214080 22:36467917-36467939 CCTGGGTGGAGAGGACAAGGGGG + Exonic
1183309239 22:37100529-37100551 GCTGGGTGGAAAAGAAAGAAAGG + Intronic
1183864684 22:40694851-40694873 GCTGGCAGGAGAATAAAGTGGGG - Intergenic
1184014303 22:41774256-41774278 GCTGGAGGAAGAGGAACGTGAGG - Intronic
1184274357 22:43401699-43401721 GCTGTGAGGAGAGGAAGGTCTGG + Intergenic
1184938118 22:47739906-47739928 GCTGGGTGGGGAGGAAGCTGAGG - Intergenic
1185252964 22:49815137-49815159 TCTGAGTGCAGAGGAAGGTGCGG + Intronic
949628377 3:5893777-5893799 GCTGGGAGGTGAGGGAAATGGGG - Intergenic
949653387 3:6187776-6187798 GTTGGGAAAAGAGGAAAGTGGGG - Intergenic
949658694 3:6252113-6252135 GCTGGGTGGAGAAGCAAGGCTGG - Intergenic
949866704 3:8553184-8553206 GGTGGGTGTAGGGGAAAGTGGGG - Intronic
949925177 3:9035509-9035531 GCTGGGTGGGGCACAAAGTGGGG + Intronic
950583141 3:13876065-13876087 TGGGGGTGGTGAGGAAAGTGAGG + Intronic
951022952 3:17800194-17800216 GCTAGATGTGGAGGAAAGTGAGG + Intronic
951433419 3:22634573-22634595 GCTGGGGAGAGGGGGAAGTGGGG - Intergenic
952238100 3:31501126-31501148 TTTGGGTGGAGAGGGCAGTGTGG + Intergenic
952874113 3:37927840-37927862 GCTGGGAGGAGGGGGAAATGAGG - Intronic
952976444 3:38700279-38700301 GCTGGGAGGAGGGGAAATTGGGG + Intronic
953605732 3:44412037-44412059 TCTGGGTGGGGATAAAAGTGAGG - Intergenic
953761495 3:45690719-45690741 GAAAGGTGGAGAGGAAAATGTGG - Intronic
953903156 3:46854604-46854626 GCTGTGTGGAGAAGAGACTGTGG - Intergenic
954280421 3:49573254-49573276 GGTAGGTGGGGAGGAAAGGGGGG + Intronic
954416529 3:50396028-50396050 GCTGGGGAGAGAGGAGGGTGTGG - Intronic
954457684 3:50608708-50608730 GCTGGGTAGAGGGGAAGCTGAGG - Intronic
954622505 3:52004103-52004125 GCTGGGAGGGGAGGAAGCTGTGG + Intergenic
954746310 3:52789465-52789487 GAGGGGTGGAGAGGAAGGAGAGG + Intronic
954808791 3:53235482-53235504 GTTGGAATGAGAGGAAAGTGAGG + Intronic
955034409 3:55252224-55252246 GATGAGTGGGGAGAAAAGTGTGG - Intergenic
955130063 3:56157310-56157332 GCTGGGGAGAGAGGAAAGGGAGG + Intronic
955159185 3:56447411-56447433 GCGGGGAGGAGAGGAAAGAGAGG + Intronic
955225050 3:57053389-57053411 GCAGGCTGGAGGGGAAGGTGAGG - Intronic
955235820 3:57138091-57138113 GCTGCGGGGAGAGGAGAATGGGG + Intronic
955814285 3:62825578-62825600 CCTTGTTGGTGAGGAAAGTGAGG + Intronic
955824407 3:62930037-62930059 GCTGAATGGAGAGGAATCTGAGG + Intergenic
955869744 3:63425021-63425043 GCAGGGAGGAGGGGAAAGTGTGG + Intronic
956158188 3:66320258-66320280 GCTGGGGTGAGGGGAGAGTGGGG - Intronic
956733084 3:72214630-72214652 GCTGGGTAAGGAGGGAAGTGGGG - Intergenic
957219201 3:77360387-77360409 GAAGGGTGGAGAGGAAAGGTGGG + Intronic
957995767 3:87688092-87688114 GCAGTGTGGAGAGGAAAATGAGG + Intergenic
958154927 3:89744396-89744418 GCTGGGGTGTGAGGAAAATGGGG - Intergenic
958922741 3:100124609-100124631 GCTGGGTGGTGAGGACTGCGAGG - Intronic
959582953 3:108000594-108000616 GCTAGGGGGAGGGGAAAATGAGG + Intergenic
959611428 3:108299463-108299485 GGTGGGAGGAGAGAAAGGTGAGG + Intronic
959648886 3:108732463-108732485 GGTGGGGAGAGAGGAAACTGGGG + Intergenic
960433691 3:117600248-117600270 GCTGGCTGGAGAGGAATGTGAGG - Intergenic
960610063 3:119547593-119547615 ACTGTGTAGTGAGGAAAGTGAGG - Intronic
960664054 3:120093707-120093729 CCTGGGAGGAGAGAAAAGAGAGG + Intronic
961062365 3:123841691-123841713 AGTGGGTGGAAAGGAAATTGTGG - Intronic
961740760 3:129031963-129031985 GCTGGGTGGAGAGGAAGAGGAGG + Intronic
961781023 3:129320077-129320099 GCTGGGTGGAAAGGGTAGAGAGG - Intergenic
961845387 3:129758822-129758844 GCTGGGAAGAGAGGGAAATGGGG - Intronic
962206445 3:133438585-133438607 GGTGCGGGGAGAGGAAAGTGTGG + Intronic
962264799 3:133937190-133937212 GATGGGCTGAGAGGAATGTGAGG + Intronic
962289106 3:134115759-134115781 GCTGTGGGGAGAGGAAAAAGGGG + Intronic
962502423 3:136008979-136009001 GCAGTGTGAGGAGGAAAGTGGGG - Intronic
962526431 3:136241841-136241863 ACTGGGTGGAGAAGAAAATAAGG + Intergenic
963257209 3:143157490-143157512 GCTGGATGGAGGGGACAATGGGG + Intergenic
963587593 3:147212064-147212086 CCTGGGTCCAAAGGAAAGTGAGG + Intergenic
964587412 3:158322244-158322266 GCTGGGAGGGGTGGAAGGTGGGG - Intronic
964590522 3:158358754-158358776 GCTTGGGGGAAAGGAAACTGGGG - Intronic
964871295 3:161316222-161316244 GATGGGTGGAAAGGAGGGTGGGG + Intergenic
965311644 3:167135359-167135381 GGTGGGGGGAGAGGGGAGTGGGG + Intergenic
966103268 3:176302515-176302537 GCTGGAGGGAGGGGACAGTGGGG - Intergenic
966809426 3:183830233-183830255 GCTGTGTGAACAGGAGAGTGGGG - Intronic
966888106 3:184387723-184387745 GCTTACAGGAGAGGAAAGTGAGG - Intronic
968759789 4:2436820-2436842 GCTGGGCCGGGAGGAAAGGGCGG - Intronic
968956470 4:3722241-3722263 GCTGGGTAGAGAGTCAGGTGGGG + Intergenic
968956517 4:3722355-3722377 GCTGGGTGGAGGGTCAGGTGGGG + Intergenic
969077396 4:4590769-4590791 GGTGGGAGGATAGGAAAGTCAGG - Intergenic
969267187 4:6072211-6072233 GCGGGCTGGAGGGGAAAGAGGGG - Intronic
969692178 4:8709805-8709827 GCTGAGAGGTTAGGAAAGTGTGG - Intergenic
969926291 4:10588925-10588947 GCTGGGTGGAGGAGAAAATGAGG + Intronic
970435265 4:16027555-16027577 GATGGGTGGAGGGGTCAGTGAGG - Intronic
971053321 4:22885608-22885630 GGTGTGTTGAGAGGAAAGAGAGG - Intergenic
971190169 4:24420682-24420704 GCTGGCTTGTGTGGAAAGTGTGG - Intergenic
971732946 4:30408897-30408919 GGTAGGTGCAGAGGAAATTGTGG + Intergenic
971838013 4:31794473-31794495 GTGGGGTGGAGAGGAAAGTGGGG - Intergenic
972011223 4:34184797-34184819 GCTGGGAGAAGAGGGAAATGGGG - Intergenic
972258824 4:37387621-37387643 GCTGGGTGGAGAGCAGGCTGCGG - Intronic
972720337 4:41690278-41690300 GCTAGGTAGAGAGGAAAGAATGG - Intronic
972772361 4:42209399-42209421 GCTGGGAGGAGAAGGAAATGGGG - Intergenic
973288598 4:48447187-48447209 GCTGGGGGGAGGGGAAATTGGGG - Intergenic
974730357 4:65856551-65856573 GCTTGGTTGAGAGGATATTGTGG - Intergenic
974757873 4:66235288-66235310 GCTGGGGAGAAAGGAAAATGGGG + Intergenic
975422784 4:74188573-74188595 GCTGAGGGGATAGGAAAGAGAGG + Intronic
975472113 4:74781865-74781887 GCTGGGAGGAGAGGCAAGTAGGG - Intronic
975634813 4:76437434-76437456 GCAGAGTGGAGAGATAAGTGGGG - Intronic
975656964 4:76651146-76651168 GCTGGGTGGGGAGGTAAGGATGG + Intronic
976251181 4:83053410-83053432 GCTAGGTAAAGAGGGAAGTGAGG + Intronic
976329060 4:83807408-83807430 GCTGGGAGGAGAGGAAAATGGGG - Intergenic
976632116 4:87249505-87249527 GCTGAGGGGAGAGTAGAGTGAGG + Intergenic
977631426 4:99247804-99247826 GCTGGGGGGAGGGGCAACTGTGG - Intergenic
978508598 4:109489557-109489579 GCTGAGGGGAGGGGAAAATGGGG - Intronic
978638446 4:110840021-110840043 GGTGGGTGGGGAGGACACTGTGG - Intergenic
978676810 4:111327789-111327811 GCTGAGGGGAGAAGAAAGGGTGG + Intergenic
978713962 4:111819546-111819568 GCTGGGGAGAGGGGAAAATGGGG + Intergenic
979317508 4:119281967-119281989 GCTGGGAGGAGGGGAGAATGGGG - Intronic
980093735 4:128468129-128468151 GAGGGGTGGAGAGGAAAGCCTGG - Intergenic
980305117 4:131051249-131051271 GAGGGGAGGAGAGGAAAGAGAGG - Intergenic
980470962 4:133250931-133250953 GATGGATGGAGAGGAAAGGATGG + Intergenic
981012117 4:139936030-139936052 GCTGGGAGGCGGGGAAAATGAGG - Intronic
981952114 4:150422540-150422562 ACGGGGTGCAGAGGATAGTGTGG - Intronic
982064345 4:151639884-151639906 GGTGGGTGGAGCTGAGAGTGGGG + Intronic
983043621 4:162959133-162959155 CCTGACTGGGGAGGAAAGTGGGG - Intergenic
983631884 4:169857427-169857449 GCTGGGAGGAGGGGGAGGTGGGG + Intergenic
984104633 4:175529778-175529800 ACTGGCTGGAGAGGAAACAGTGG + Intergenic
984549258 4:181141131-181141153 ACTGGGTAAAGAGGAAATTGAGG - Intergenic
985658624 5:1144535-1144557 GCTGGGTGGAGGGCACGGTGAGG + Intergenic
986148667 5:5106028-5106050 TCTGGGTGGGGAGGAAAGGCAGG + Intergenic
986374143 5:7113325-7113347 GCTGGCAGGAGGGGAAAATGGGG - Intergenic
987558029 5:19480701-19480723 GTATGGTGGAGAGGAAAGTCAGG - Intronic
987913272 5:24178493-24178515 GCTGGGTGGAGAAAAAAATGGGG - Intergenic
988644084 5:33074717-33074739 GCTGGGGTGACAGGATAGTGGGG + Intergenic
989145595 5:38246359-38246381 GCTGTGGGGTGAGGGAAGTGTGG + Intergenic
989161885 5:38399184-38399206 GCTAGGTGGAGAGGGAAGGTAGG + Intronic
989406321 5:41065091-41065113 GCTGGATGAAGGGGAAGGTGAGG + Intronic
989573122 5:42963823-42963845 GCATGGGGGAGAGGAAAGTAGGG + Intergenic
990996422 5:61736600-61736622 TTTGGGTGGAGAGGCGAGTGGGG - Intronic
991328510 5:65464924-65464946 GCTGGGTTGTGAGGGAAGTGAGG - Intronic
991602712 5:68369659-68369681 ACTGGGGGGAGGGGAAAGTGGGG - Intergenic
991987772 5:72307963-72307985 TTTGGGCGGAAAGGAAAGTGAGG + Intronic
992481558 5:77156904-77156926 GATGGGAGAAGAGGAAAGTCAGG + Intergenic
992527920 5:77630008-77630030 GCTGGGTGGGAAGGGAAGAGGGG + Exonic
992560031 5:77942364-77942386 GCTGGGAGGAGGGGAAAAAGGGG + Intergenic
992643424 5:78789976-78789998 GCAGGGTGGTGAGGGAAGCGTGG + Intronic
992796388 5:80257751-80257773 GACGGGTGGAGAGGAAGGAGGGG + Intergenic
992868636 5:80983210-80983232 GCTGGGAGCAGAGGAAACAGGGG - Intronic
994313255 5:98301726-98301748 TCTCTGTGGAGAAGAAAGTGGGG + Intergenic
994515912 5:100772794-100772816 GCTGGGTTGAGAGGACTGAGAGG + Intergenic
996277691 5:121687187-121687209 GCTGGGTGGAGGAGAAAATAGGG + Intergenic
996470832 5:123858388-123858410 GCTGGGTGGTGAGGAAGAGGAGG + Intergenic
997031036 5:130128508-130128530 GCTGAGGGGAGAGGGAAATGGGG + Intronic
997256931 5:132436089-132436111 GGTGGGTGGAGAGGACAAAGAGG + Intronic
997905121 5:137808765-137808787 GGTGGGTGTAGAGGTCAGTGGGG - Intergenic
998168847 5:139860234-139860256 CCTGGGAGGAAAGGTAAGTGGGG + Intronic
998231563 5:140364246-140364268 GCTGGGTGAATAGGAGAGAGTGG + Intronic
998518234 5:142775632-142775654 GGTTGGGGGAGGGGAAAGTGGGG - Intronic
998570044 5:143248984-143249006 GGTAGGTGGAGAGGAGAGAGAGG + Intergenic
999367360 5:151031817-151031839 GCTAGGTGGAGAGGTAGGGGTGG - Intronic
999880654 5:155860049-155860071 GCTCTTTGGAGAGGAAAATGTGG + Intergenic
1000148392 5:158475677-158475699 GATGGGTGGTGAGGATAATGTGG + Intergenic
1000206683 5:159067085-159067107 GCTGGCAGGAGAGGGAAATGAGG + Intronic
1000234481 5:159344756-159344778 ACAGGGTGGGGAGGGAAGTGTGG + Intergenic
1001329435 5:170751995-170752017 GCAGAGTGGGGAGGAAAATGTGG - Intergenic
1001592221 5:172873399-172873421 GCAGGTTGGGGAGGCAAGTGGGG + Intronic
1002297031 5:178237530-178237552 GCTGGGTGGGGAGGGAAAAGGGG - Intergenic
1002326437 5:178411620-178411642 GCTGGGAGGAGGGGGAAATGGGG + Intronic
1002446472 5:179293157-179293179 TCGGGGAGCAGAGGAAAGTGGGG - Intronic
1002637300 5:180614727-180614749 GCTGGGAAGAGAGGGGAGTGGGG - Intronic
1002762485 6:212677-212699 GCTGGGTGGATTGGGGAGTGGGG + Intergenic
1002776601 6:333246-333268 GCTGGTGGAAGAGGAAAGTGAGG - Intronic
1003411577 6:5868020-5868042 GCTGGGGGGAGAAGGAAATGGGG + Intergenic
1003859167 6:10306342-10306364 GCTGGGAAAAGAGGAAAATGGGG + Intergenic
1003989810 6:11474490-11474512 AGTGGGTGGTGAGGAAAGAGTGG - Intergenic
1004030453 6:11863425-11863447 GCTGGGAGGAGAGAGAAATGGGG - Intergenic
1004088443 6:12474375-12474397 GCTGGGTGGAGAGAGAGGAGAGG + Intergenic
1004466253 6:15887933-15887955 GATGGGTGGAGGGGAAAGGAGGG + Intergenic
1004778357 6:18874656-18874678 GCTGGGGGGTGGGGAAATTGGGG - Intergenic
1005388086 6:25305814-25305836 GCTGCCTGGTGGGGAAAGTGAGG + Intronic
1005824080 6:29622023-29622045 ACTGGTTGGAGAGGAAAGCCAGG - Intronic
1005986893 6:30881267-30881289 GCAGGGAGGAGGGGAAAGAGAGG + Intronic
1006016913 6:31088783-31088805 GCTGGGCGGAAAGGAGAATGGGG + Intergenic
1006268350 6:32944311-32944333 GCAGGATGGGGAGGAATGTGAGG - Intronic
1006317491 6:33298999-33299021 GCGGGGGGGAGCGGAAAGGGCGG - Exonic
1006585934 6:35112404-35112426 GCTGAGGGGAGAAGAAAATGGGG + Intergenic
1007022589 6:38536826-38536848 GCTGGGGGTGGAGGAAAGTGGGG + Intronic
1007360680 6:41353178-41353200 GAAGGCTGGAGAGGGAAGTGGGG + Intergenic
1007599397 6:43072364-43072386 CCAGGAGGGAGAGGAAAGTGAGG + Intronic
1007748706 6:44058915-44058937 GCTGCTTGGAGGGGAAGGTGGGG - Intergenic
1008282316 6:49611543-49611565 TCTGGGTGGAGAAGGAAATGGGG - Intronic
1008484677 6:52023091-52023113 CCTAAGTGGAGAGGAAACTGAGG - Intronic
1009000485 6:57707062-57707084 GGTGGGTGGACGGGAGAGTGGGG - Intergenic
1009623916 6:66111573-66111595 GCTAGGTGGAGAGGGAAATGAGG - Intergenic
1009666626 6:66689879-66689901 GGTGGGTGGAGAGAAAATTTAGG + Intergenic
1010942558 6:81935766-81935788 CCTGTATGGAAAGGAAAGTGGGG - Intergenic
1011399784 6:86948025-86948047 GCGGGGTGGAGGGTAAAGGGAGG - Intronic
1011726852 6:90218463-90218485 GGTGGGGGAAGAGGAAAGAGGGG - Intronic
1012019858 6:93904987-93905009 GCTGTGTGGAGAGGAAATGTGGG - Intergenic
1012160914 6:95885223-95885245 TCTGGGCAGAGAAGAAAGTGAGG + Intergenic
1013526690 6:110981090-110981112 GCTGGCAGGAGGGGGAAGTGGGG + Intergenic
1013805310 6:113989913-113989935 GCCTGCTGGAGAGGAAACTGTGG + Intronic
1014179966 6:118373866-118373888 GCTGGGAGGAGAGGAAATTCAGG + Intergenic
1014383652 6:120775426-120775448 TCTGGGTAGATAGGAAAGTCAGG - Intergenic
1015353373 6:132248616-132248638 CCTGGATGGGGTGGAAAGTGTGG + Intergenic
1015366443 6:132401731-132401753 GCTCGGTGGGAAGGAAAGCGAGG + Intergenic
1015416358 6:132953239-132953261 TCTGGGTGGGAAGGAAAGTACGG - Intergenic
1015476075 6:133660106-133660128 GCTGATGGGAGAGGAAGGTGAGG - Intergenic
1016132609 6:140494866-140494888 TCTGAGAGAAGAGGAAAGTGAGG - Intergenic
1016417702 6:143850422-143850444 CCTGTTTGGAGAGGAAAGTGGGG + Intronic
1016938456 6:149465863-149465885 GCTGGGTGGAGCTGGAATTGGGG - Intronic
1018213826 6:161507571-161507593 GCTGGGCCGAGAGGAAAGCTTGG - Intronic
1018837906 6:167498823-167498845 GCTGGGAGGGGAGGTCAGTGGGG - Intergenic
1018889973 6:167976496-167976518 GTTGGGAGGAGAAGACAGTGGGG + Intergenic
1018889984 6:167976538-167976560 GTTGGGAGGAGAAGACAGTGGGG + Intergenic
1018938806 6:168294167-168294189 TCTGGTTTGAGAGGAAAGTGTGG - Intronic
1019053613 6:169203628-169203650 GCTGGGGGCAGGGGAAAATGAGG - Intergenic
1019313261 7:373025-373047 GCTGGGTGAGGAGGAAGCTGGGG - Intergenic
1019434520 7:1015205-1015227 GCTGAGGGGTGAGGAAAGAGAGG + Intronic
1019771632 7:2886924-2886946 CCAGGGTGGAGAGGACAGTCGGG + Intergenic
1020035214 7:4959802-4959824 GGTGGAGGGAGTGGAAAGTGGGG + Intergenic
1020035250 7:4959884-4959906 GGTGGAGGGAGTGGAAAGTGGGG + Intergenic
1020035337 7:4960094-4960116 GGTGGGGGGAGTGGGAAGTGGGG + Intergenic
1020111814 7:5451877-5451899 CCTGGGAGGAGGGGAGAGTGGGG - Intronic
1021113948 7:16727743-16727765 GCTGAGGGGAGAGGTAAATGGGG - Intergenic
1021536581 7:21712032-21712054 GCTGGGAGGAGGGGAGAATGAGG - Intronic
1021667847 7:23004603-23004625 GATGGGTTGAGAGGAAAGGAAGG - Intronic
1021741524 7:23690772-23690794 GCTGGGGAGAGAGAAAAGTAAGG - Intronic
1021989575 7:26128997-26129019 CATGGGAGGGGAGGAAAGTGGGG + Intergenic
1022385695 7:29896985-29897007 GCTGGGGGAAGAGGAGAATGGGG - Intronic
1022607003 7:31825324-31825346 AATGGGTGGAGAGGAAGATGTGG + Intronic
1023872746 7:44271649-44271671 GCTGGGTGGGGACGAAGGAGTGG + Intronic
1023980760 7:45068720-45068742 GCTGGGTGGAGACTAGGGTGAGG - Intronic
1024584435 7:50829408-50829430 GCTGGGAGGAGAGGCAAGTGAGG - Intergenic
1024594059 7:50917424-50917446 GGTGGGTGGGGAGGAATGGGAGG + Intergenic
1024615753 7:51110253-51110275 GCAGGGTGGAGGGGAGAGGGAGG - Intronic
1027164203 7:75823144-75823166 GCAGGGGGGAGAGGGCAGTGGGG + Intronic
1027869383 7:83687423-83687445 GCTGGGAGGAAAGGAAAATAGGG + Intergenic
1028153374 7:87401745-87401767 GTTGGGTAGACAGGAAAGTTTGG - Intronic
1028414124 7:90561872-90561894 TCTGGGTGAAGAGAAAAATGGGG + Intronic
1029421544 7:100474414-100474436 GCTGGGGCGAGAGTCAAGTGGGG + Exonic
1029479493 7:100803950-100803972 GCTGGGTGGAGAGGAAGAGGAGG + Intronic
1029524218 7:101085385-101085407 GCCGGGTGGGGAGGAAGGCGGGG + Intergenic
1029847623 7:103428990-103429012 ACTGGGAGGAGAGAAAAATGGGG - Intronic
1030247130 7:107395250-107395272 GTGGGGTGGAAAGAAAAGTGGGG + Intronic
1030557953 7:111049988-111050010 GCTGGCTGAAGAGGACTGTGAGG + Intronic
1030707310 7:112707210-112707232 GATGGGTGGAGGGGGATGTGAGG + Intergenic
1030821120 7:114093017-114093039 GCTGTGTGGAGAATAAACTGCGG - Intronic
1031074084 7:117195911-117195933 GCTGTGGGGAGGGGAAAATGAGG - Intronic
1031751745 7:125583409-125583431 GCTGGGGGAAGAGGGAAGTAGGG - Intergenic
1031797109 7:126188553-126188575 GCTGGGGTGAGAGGGAAATGGGG - Intergenic
1032238654 7:130144329-130144351 GGTTGGGGGAGAGGAAAGAGGGG + Intergenic
1032275490 7:130451576-130451598 GCTGAGGGGAGGGGAGAGTGGGG + Intergenic
1032410273 7:131689388-131689410 ACTGGGTGGACAGGAAGGTGTGG + Intergenic
1032519292 7:132531064-132531086 GCTGGGAGGAGAAGAGAATGGGG + Intronic
1032581192 7:133105128-133105150 GGTGGGTGGAGGGGGCAGTGTGG - Intergenic
1032800392 7:135313015-135313037 GCTGGGTGGAAAGGATGGGGAGG + Intergenic
1033577765 7:142702496-142702518 CCTGGGTGTAGTGGAAAGTGGGG + Intergenic
1034044233 7:147911112-147911134 GCTAGGAGGAGAGGGAAATGGGG - Intronic
1034322864 7:150201213-150201235 CCTGGGTGGTGAAGAATGTGGGG - Intergenic
1034362654 7:150514206-150514228 GTGGGGTAGAGAGGAAGGTGGGG + Intergenic
1034438925 7:151076832-151076854 GCTGTGGGGAGAGGAGAGGGCGG + Exonic
1034770321 7:153767910-153767932 CCTGGGTGGTGAAGAAAGTGGGG + Intergenic
1035109667 7:156470696-156470718 GATGGCTGGAGCGGCAAGTGTGG - Intergenic
1035117848 7:156539809-156539831 GCTGGGTGGAGGGGGAAGAAGGG - Intergenic
1035248675 7:157582155-157582177 GATGGGTGAAGAAGAGAGTGAGG - Intronic
1035421112 7:158729643-158729665 GCTGGGGAGAGGGGCAAGTGTGG + Intergenic
1035435845 7:158858809-158858831 GGGGAGGGGAGAGGAAAGTGGGG - Intronic
1035534263 8:379069-379091 GCCGGCAGGAGAGGAAACTGCGG + Intergenic
1036235396 8:7035464-7035486 GCTGGGAGGAGAGGGAAGAGAGG - Intergenic
1036410610 8:8496645-8496667 CTTGGGTGGAGAGGTAGGTGAGG - Intergenic
1036563157 8:9914407-9914429 GCTGGCAGGTGAGGAAATTGAGG + Intergenic
1036784522 8:11677167-11677189 GCTGTGGGGAGAGGGAGGTGGGG + Intronic
1037219815 8:16504885-16504907 GTGGGGTGGAGTGGGAAGTGGGG - Intronic
1037383729 8:18315541-18315563 GCTGGGTGACCAGGAAAGGGAGG - Intergenic
1037798580 8:22017795-22017817 ACTGGGAGGAGAGGAAAACGGGG + Intergenic
1037830099 8:22182754-22182776 GCTGGGAGGAGAGTAAGGAGCGG - Intronic
1038208185 8:25489307-25489329 GCTGGATGGACAGGAAGTTGGGG - Intronic
1038711915 8:29955073-29955095 GGAGGGAGGAGACGAAAGTGGGG + Intergenic
1038982648 8:32776561-32776583 GGTGGGAGGAGAGCAGAGTGAGG - Intergenic
1039946181 8:42130722-42130744 GCTAGGAGGAGGGGAAAGTAGGG - Intergenic
1041514270 8:58682917-58682939 GCTGAGAGGAGAGAATAGTGGGG + Intergenic
1042500242 8:69500815-69500837 GCTGTTTGGAGTGGAAAGAGGGG + Intronic
1042593973 8:70425628-70425650 GCTGGATAAGGAGGAAAGTGAGG - Intergenic
1042781947 8:72500919-72500941 GATGGGAGGAGAGAAAATTGAGG + Intergenic
1043141504 8:76595395-76595417 GCTGGGGGAAGAGGAAAATAAGG + Intergenic
1043996825 8:86828196-86828218 GCTGGATGTAGAGGAAGGGGAGG + Intergenic
1044737298 8:95292296-95292318 GCTGGGGGAAGAGGGAAATGAGG + Intergenic
1044818377 8:96136554-96136576 GGTGGGTGGAGAGGAGAGGAGGG - Intergenic
1044825759 8:96195358-96195380 GCTGGGTAGAGAGGGAAATGAGG + Intergenic
1045223640 8:100222921-100222943 GCTGGGGGGAAAGGAAAATGGGG - Intronic
1045413711 8:101945322-101945344 GGTGGGTGGAGATGAAGGTGGGG + Intronic
1046720085 8:117609402-117609424 GCTGGGTGTGGAGGATGGTGTGG + Intergenic
1047044426 8:121036005-121036027 GCTGTGTGGTGGGGAAAATGGGG + Intergenic
1047215544 8:122873099-122873121 AATGGGTGGTGAGGAAATTGGGG + Intronic
1047724490 8:127672121-127672143 GATGGGTGGACAGGATAGTCAGG - Intergenic
1047962429 8:130020392-130020414 GCTGGGAGGAGGGGAGAATGGGG + Intergenic
1048461079 8:134622632-134622654 GCTGGGTGGAGAGGGGGGAGGGG - Intronic
1048617634 8:136095254-136095276 GCAGGCAGGAGAGGAAAATGGGG + Intergenic
1049037494 8:140087738-140087760 GCAGGGTGGAGAGGGAAACGTGG - Intronic
1049046257 8:140154390-140154412 GCTGGATGGGGAGGCCAGTGTGG - Intronic
1049208332 8:141373745-141373767 TCTAGGTGGAGAGAACAGTGGGG - Intergenic
1049218099 8:141416970-141416992 GCAGGGTGGAGCGGCAAGGGTGG - Intronic
1049401783 8:142431115-142431137 GCTGCATGGAGAGGAAAGGTGGG - Intergenic
1049405145 8:142449068-142449090 GGTGGGTGTAGATGGAAGTGGGG - Intergenic
1049659782 8:143814822-143814844 GCTGGGTGCAGGGGTGAGTGGGG - Intronic
1050366677 9:4879510-4879532 GGTGGGTGGAGAGGAGAGTGTGG - Intronic
1050485215 9:6126864-6126886 GCTGGGAGAAGGGGAAAATGGGG + Intergenic
1051550000 9:18316993-18317015 GATGAGTGGATAGGAAATTGTGG + Intergenic
1052127519 9:24795947-24795969 GCTGGGTGAAGGGGGAAGTGGGG + Intergenic
1052701700 9:31945346-31945368 GCTGGGAGGTGTGGAAAGTGGGG + Intergenic
1052776398 9:32737484-32737506 GGTGGTTGGAGTAGAAAGTGAGG + Intergenic
1053150481 9:35739919-35739941 GGTGGGTGGAGAGTAAATCGAGG + Intronic
1053162177 9:35820731-35820753 GAGGCGTGGAAAGGAAAGTGAGG + Intronic
1053176937 9:35932932-35932954 GCTAGGGGGAGGGGGAAGTGGGG - Intergenic
1053379343 9:37636154-37636176 GCAGTGGGGAGAGGAAAGGGTGG + Intronic
1053433276 9:38058182-38058204 GATGGGTCCAGAGGAAGGTGTGG - Intronic
1053529673 9:38867713-38867735 GCTGGGTGGAGAGGGAAAAGGGG + Intergenic
1054201898 9:62092140-62092162 GCTGGGTGGAGAGGGAAAAGGGG + Intergenic
1054336918 9:63815989-63816011 GCAAGGTGGAGAGGGAAGTAGGG - Intergenic
1054636459 9:67496219-67496241 GCTGGGTGGAGAGGGAAAAGGGG - Intergenic
1054785002 9:69201951-69201973 GCTGAGGGGAGAGGGAAATGGGG + Intronic
1055000805 9:71447084-71447106 GCCGGGTGGAGAGCAATTTGGGG - Intergenic
1056031930 9:82561929-82561951 TCTGGGTGGGGAGAAAAATGGGG + Intergenic
1056077990 9:83061307-83061329 GTTGGGAGGAGAAGGAAGTGAGG + Intronic
1056159899 9:83878739-83878761 GCTGGGGGAAGGGGAAAATGAGG + Intronic
1056360327 9:85851078-85851100 GCTGGGGGAAGGGGAAAATGAGG - Intergenic
1056840284 9:89993145-89993167 GCTGCGTGGAGCTGACAGTGAGG - Intergenic
1057209821 9:93193663-93193685 GCTGGGTGGAGAGGACTGAGTGG + Intronic
1057422286 9:94922036-94922058 GAAGGGTGGGGAGGGAAGTGTGG + Intronic
1057695982 9:97323364-97323386 GCAGGGTGCAGGGGAAAGTGGGG - Intronic
1057798158 9:98172696-98172718 GCTGGCAGGAGAGGATGGTGAGG + Exonic
1057988033 9:99737558-99737580 GCTTCGTGGAGAGTAGAGTGTGG - Intergenic
1058693253 9:107536853-107536875 GCTGGGGAGAGAGGAAAATTTGG + Intergenic
1059611647 9:115903524-115903546 GATTGGTGGAGAGGATTGTGAGG - Intergenic
1060063575 9:120483070-120483092 GCTGGGTGGAGAGGGGAGAGTGG - Intronic
1060206218 9:121684385-121684407 GCTGGGAGGAGAGGACAGGAAGG - Intronic
1060291730 9:122309035-122309057 GCTGGGGGAAGAGGTAAGTGGGG - Intronic
1060425456 9:123501096-123501118 GCTGGGAGGAGAGGGAAATGGGG - Intronic
1060464890 9:123894917-123894939 GCTAGGTGGAGAGGAGTGGGGGG + Intronic
1060549913 9:124480001-124480023 TCTGGCTGGAGAGTAAAGAGAGG - Intergenic
1060621620 9:125072686-125072708 GCTAGGAGGAGGGGAAAATGGGG - Intronic
1060787496 9:126461885-126461907 GCTGGGTGGAGATGAATGGCTGG - Intronic
1060836027 9:126755726-126755748 GGTGGGTGGAGGTGAAAGGGGGG - Intergenic
1060919475 9:127409567-127409589 GGTGGGGGGAGATGATAGTGAGG + Intergenic
1061153932 9:128845777-128845799 GGTGGGTGGAGCGGAGAGGGAGG + Intronic
1061179913 9:129019020-129019042 GCTGGCTGGAGGTGAAAATGGGG + Intronic
1061945933 9:133908157-133908179 ACTGGGTGGAGGCTAAAGTGAGG + Intronic
1061954769 9:133955763-133955785 GGGGGGTGGGGAGGAACGTGGGG - Intronic
1062129157 9:134883402-134883424 CCTGGCTGCAGAGGAACGTGAGG + Intronic
1062218020 9:135399598-135399620 GCAGGGTAGAGCGGACAGTGCGG + Intergenic
1062597434 9:137305595-137305617 GCTGGGTAGTGAGGGACGTGTGG + Intergenic
1062728980 9:138097891-138097913 GCTGAGTGGAAAGGAGGGTGGGG - Intronic
1185445746 X:257184-257206 GCAGGGTGGACAGGAGGGTGGGG + Intergenic
1185535101 X:854878-854900 GGAGGGAGGAGAGGAAAATGAGG - Intergenic
1186104480 X:6191569-6191591 GCTGGGTGGGAAGGAAGTTGTGG + Intronic
1186410821 X:9342952-9342974 CCTGGGTGGAGAGGGACTTGGGG + Intergenic
1186601617 X:11043912-11043934 GGTGGGTGGAGGGGCAAGTAGGG - Intergenic
1186673351 X:11790004-11790026 GCTGGGGGAAAAGGGAAGTGAGG - Intergenic
1186888206 X:13936028-13936050 GCTGGGGGGAGAAGAGAATGAGG + Intronic
1186943672 X:14540875-14540897 GCAAGGTGGGGAGGAAAGGGAGG + Intronic
1187397183 X:18928805-18928827 GCTGGCTGGAGAGGAGGGAGAGG + Intronic
1187442055 X:19329339-19329361 GCTGAGGGGAGAGGAAGCTGGGG - Intergenic
1187553721 X:20331420-20331442 GCTGGGTAGAGGGGAAGGTCGGG - Intergenic
1187592139 X:20729146-20729168 GCTAGGTGGAGTGGAAAGCTGGG + Intergenic
1187859158 X:23665238-23665260 GGGGGCTGGGGAGGAAAGTGGGG + Intronic
1188181554 X:27062633-27062655 GCTGGTGGGAGAGGAAAATGGGG - Intergenic
1188813502 X:34682647-34682669 GCTGGGCAGAGGGGAAAATGGGG - Intergenic
1190105787 X:47560591-47560613 GCCAGGTGAAGAGGGAAGTGCGG - Intergenic
1190247104 X:48697556-48697578 GCTGTAGGGAGAGGAAAGCGTGG + Intronic
1190325416 X:49204344-49204366 GCTGGGTGAAGAGTAAAGCTGGG + Intergenic
1190765830 X:53474950-53474972 GCTGGGTAAAGAGGGAAGTGAGG + Intergenic
1191980097 X:66916135-66916157 GATGGGAGGAGAGTAAAGTCGGG + Intergenic
1192276688 X:69638927-69638949 GCTGGGGGGAGGGGAGAGTAGGG - Intronic
1192386339 X:70675495-70675517 GCTAGGAGGAGGGGAAAATGTGG - Intronic
1192450970 X:71244633-71244655 GATGGGGGGAGAGCAAAGTTTGG + Intronic
1192552353 X:72064593-72064615 AGTGGGTGGACAGGGAAGTGCGG - Intergenic
1192898409 X:75469390-75469412 ACTGGGAGGAGAGGGAAATGTGG - Intronic
1192958353 X:76097700-76097722 ACTGGGAGGAGAGAAAAATGAGG + Intergenic
1193694955 X:84697073-84697095 GCTGGTTGGGTAGGAAAGTGAGG + Intergenic
1195036789 X:100977323-100977345 ACAGGGTGGAAAGGATAGTGAGG - Intronic
1195066953 X:101245747-101245769 GCTGAGGGGAGGGGAAAATGGGG + Intronic
1195097571 X:101519318-101519340 GCTGGGTGTAGGGGGAAATGGGG - Intronic
1195108475 X:101623076-101623098 GCTGGTGGGAGGGGAAATTGGGG + Exonic
1195280691 X:103330127-103330149 GCTGGTGGGAGGGGAAAGTGGGG + Intergenic
1195311371 X:103634689-103634711 TCTGTGTGGACAGGAAGGTGGGG - Intergenic
1195651325 X:107288062-107288084 GCTGTGGGGAGGGGCAAGTGCGG - Intergenic
1195722061 X:107876977-107876999 GCTGGATGGGGAGGAAGGGGTGG + Intronic
1196007947 X:110855483-110855505 GCTGGGTGCAGGGGAAGATGTGG + Intergenic
1196694433 X:118595901-118595923 GCTGGGAGGAGAGGGAAATGGGG + Intronic
1196874946 X:120148355-120148377 GTTGGGCTCAGAGGAAAGTGAGG + Intergenic
1196920587 X:120581340-120581362 TCTTGGTGCAGTGGAAAGTGGGG + Intergenic
1197050661 X:122054915-122054937 GCTGGGTAAAAAAGAAAGTGAGG + Intergenic
1197199074 X:123733136-123733158 GCTGGGTGGAGAGGAAAGTGGGG - Intergenic
1197899142 X:131350236-131350258 GCTGGGAGGAGAGAAAAATGGGG + Intronic
1198608404 X:138370184-138370206 GCTGGGAAGAGAGGGAAATGGGG - Intergenic
1199748369 X:150791023-150791045 GATTGGTGGAGAGGACAGAGTGG - Intronic
1200061057 X:153483913-153483935 GCTGGGGGCACAGGAAAGTGGGG + Intronic
1200098298 X:153674274-153674296 GCTGGGTAGAGAAGAAAGCGAGG - Exonic
1200104985 X:153707090-153707112 GCTGGGTCGAGAGGACATTCCGG - Intronic
1200775178 Y:7164150-7164172 ACAGAGTGGAGAGGAGAGTGGGG - Intergenic
1200945201 Y:8828699-8828721 GCTGTGTGTAGAGTAAATTGTGG + Intergenic
1201272935 Y:12272942-12272964 GCTGGGAGGAGAGGAATCTGTGG - Intergenic
1202048469 Y:20757300-20757322 GCTGGGGGGAGAAAAAAGTAGGG + Intronic