ID: 1197199075

View in Genome Browser
Species Human (GRCh38)
Location X:123733137-123733159
Sequence CGCTGGGTGGAGAGGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199075_1197199082 -7 Left 1197199075 X:123733137-123733159 CCCACTTTCCTCTCCACCCAGCG 0: 1
1: 0
2: 0
3: 31
4: 350
Right 1197199082 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1197199075_1197199089 19 Left 1197199075 X:123733137-123733159 CCCACTTTCCTCTCCACCCAGCG 0: 1
1: 0
2: 0
3: 31
4: 350
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199075_1197199086 8 Left 1197199075 X:123733137-123733159 CCCACTTTCCTCTCCACCCAGCG 0: 1
1: 0
2: 0
3: 31
4: 350
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199075_1197199087 18 Left 1197199075 X:123733137-123733159 CCCACTTTCCTCTCCACCCAGCG 0: 1
1: 0
2: 0
3: 31
4: 350
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199075 Original CRISPR CGCTGGGTGGAGAGGAAAGT GGG (reversed) Intergenic
900040744 1:461813-461835 CGAAGGTGGGAGAGGAAAGTGGG + Intergenic
900062174 1:696784-696806 CGAAGGTGGGAGAGGAAAGTGGG + Intergenic
900165911 1:1244274-1244296 CGCTGGGGGGAGAGAGAAGCAGG + Exonic
900848353 1:5121631-5121653 GGCTGGGTGAAGGGGAAAGGAGG - Intergenic
901409784 1:9074384-9074406 AGCTGGCTGGAGGGGAAAGAGGG + Intronic
904068525 1:27773778-27773800 AGGTGGGTGGGGAGGAAGGTGGG - Intronic
906576647 1:46897129-46897151 GGCTGGGGGGAGGGGAAAATGGG + Intergenic
906595271 1:47070456-47070478 GGCTGGGGGGAGGGGAAAATGGG - Intronic
907550338 1:55299541-55299563 GGCTGGCTGGAGAGGAGAGCAGG - Intergenic
909948682 1:81693126-81693148 CTCTTGGAGGAGAGGAAAGAAGG - Intronic
913658503 1:120984535-120984557 CATGGGGTGGAGGGGAAAGTAGG + Intergenic
914009870 1:143767644-143767666 CATGGGGTGGAGGGGAAAGTAGG + Intergenic
914648490 1:149676305-149676327 CATGGGGTGGAGGGGAAAGTAGG + Intergenic
915145478 1:153793884-153793906 CCCTGGGAGGAGGGGACAGTGGG + Intergenic
915474797 1:156147219-156147241 GGGTGAGTGTAGAGGAAAGTAGG - Intergenic
915879909 1:159658604-159658626 AGTTGGGAGGAGAAGAAAGTAGG + Intergenic
916127987 1:161588480-161588502 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916137905 1:161670310-161670332 CACTGGGAGGAGAGGAAAAGGGG - Intronic
916462760 1:165044374-165044396 CTGTGGTAGGAGAGGAAAGTAGG - Intergenic
917277130 1:173342718-173342740 GGATTGGAGGAGAGGAAAGTTGG - Intergenic
917752659 1:178067608-178067630 AGCTGGGTCTAGAGTAAAGTAGG + Intergenic
917798944 1:178552949-178552971 GGCTGGGTGGGGAGAAAAGGAGG + Intergenic
918155486 1:181841901-181841923 AGCTGGGGGCAGAGCAAAGTGGG - Intergenic
918199363 1:182252888-182252910 CGGAGGCTGGAAAGGAAAGTAGG + Intergenic
918394917 1:184103766-184103788 GGCTGGGAGGAGAGGACAGTGGG - Intergenic
920874456 1:209821355-209821377 CACTGGGGGAAGAGGAAAGCTGG - Intergenic
923387907 1:233483961-233483983 CACTGGGTGGAGAGGGATGTGGG - Intergenic
1064091857 10:12392361-12392383 GGCTGGGGGGAGAGGGAAGGAGG - Intronic
1064349759 10:14566264-14566286 CAGTAGGTGGAGAGGAATGTGGG - Intronic
1065706924 10:28479038-28479060 AGAAGGGTGGGGAGGAAAGTGGG + Intergenic
1065809502 10:29428361-29428383 AGCTGGGTAGAGAGAAAAGCTGG + Intergenic
1065967899 10:30783921-30783943 TGCAGGGAGGAGAAGAAAGTGGG + Intergenic
1069906634 10:71736036-71736058 GGCTGGGAGGAGAGGCCAGTGGG + Intronic
1070105912 10:73431118-73431140 GGCTGGGTGGAAGGGAAAATGGG + Intronic
1070548590 10:77473227-77473249 TTCTGGGTTGAGATGAAAGTTGG - Intronic
1070574432 10:77666865-77666887 TGGTGGGTGGAGAGGGAAATTGG - Intergenic
1070664482 10:78333518-78333540 TGCTGGGTGCAGAGGTAAATGGG + Intergenic
1070868193 10:79723143-79723165 GGCTGGAAGGAGAGGAAAATGGG + Intergenic
1071635103 10:87245344-87245366 GGCTGGAAGGAGAGGAAAATGGG + Intergenic
1071660139 10:87492648-87492670 GGCTGGAAGGAGAGGAAAGTGGG - Intergenic
1072553701 10:96498226-96498248 CGCTAGGCGGAGAGGGAAGGAGG + Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1073506469 10:103997077-103997099 AGCTGGGAGGAGTGGAAAATGGG - Intronic
1074118499 10:110475965-110475987 GGCTAGGTGGGGAGGAAAATGGG - Intergenic
1074382841 10:112994243-112994265 GGCTGGGGGGAGAGGAAATGAGG - Intronic
1074897731 10:117791611-117791633 CTCTGTGTGGGCAGGAAAGTGGG - Intergenic
1074950041 10:118324674-118324696 GGCTGGGTGGAGGGGAGAATGGG + Intronic
1075045223 10:119141043-119141065 GGCTGGCTGGAGAAGACAGTGGG - Exonic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1076496976 10:130903895-130903917 GGCGGTGTGGAGAGGAGAGTGGG - Intergenic
1076907690 10:133371653-133371675 TGCTGGGTGGACAGCAAGGTGGG + Intronic
1076967016 11:98039-98061 CGAAGGTGGGAGAGGAAAGTGGG + Intergenic
1077132026 11:977847-977869 TGCTGCGTGGAGAGGCATGTGGG + Intronic
1077351070 11:2093395-2093417 GGCTGGGTGATGAGGAAAGGGGG + Intergenic
1077353025 11:2101469-2101491 AGGTGGCTGGAGAGGAAAGAGGG - Intergenic
1078564356 11:12401678-12401700 CACTGGATGCAAAGGAAAGTTGG - Intronic
1078846180 11:15120271-15120293 CGCTGGGGGTAGAGGTAAGTAGG + Intronic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1080951319 11:37036463-37036485 AGAGAGGTGGAGAGGAAAGTTGG + Intergenic
1081641344 11:44756566-44756588 GGCTGGGAGGAGAGGAAAATGGG - Intronic
1081765325 11:45606390-45606412 CGTGGGGTTGAGAGGAAAGCAGG + Intergenic
1083305138 11:61758111-61758133 CCCTGGGTGGGGAGTACAGTTGG + Intronic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1084079359 11:66810537-66810559 CGCAGGCTGGAGAGGAAAGATGG + Intronic
1085275753 11:75298578-75298600 CGCTGGTGGGAATGGAAAGTGGG + Intronic
1087624259 11:100578814-100578836 AGCTGGGTAGAGAAGAAAGAAGG + Intergenic
1088036375 11:105321262-105321284 CTCTTGCTGGAGAGGAAAGAGGG + Intergenic
1090458320 11:126868427-126868449 CCCTAGGTGGAGAGCAAAGGAGG + Intronic
1091041502 11:132285281-132285303 CACAGGGTGGAGAGGAAGGCTGG - Intronic
1093696507 12:22166437-22166459 AACTGGGTGGAGAGGCAGGTTGG - Intronic
1095228822 12:39709500-39709522 GGCTGGGGGGAGGGGCAAGTAGG - Intronic
1095743582 12:45633332-45633354 CTCTGGGGGGAGAGGAATGGGGG - Intergenic
1096496948 12:52044179-52044201 GGCGGGGTGGAGAGGAGAGGAGG - Intronic
1096844541 12:54398697-54398719 CGCTGTGGGTAGGGGAAAGTTGG + Exonic
1096985816 12:55756364-55756386 CTCTGGTTGGTGAGGAAAGCAGG - Exonic
1097629135 12:62038092-62038114 GGCAGGGTGGAGAGGAAATGGGG + Intronic
1098231557 12:68376355-68376377 CGCTGGGAGGAGAGGCCAGAGGG - Intergenic
1099355819 12:81633835-81633857 AGCAGGGGGGAGAGGAAGGTGGG + Intronic
1102405874 12:112673812-112673834 GGCTGTGTGGGGAGGGAAGTAGG - Intronic
1103303743 12:119947951-119947973 GGCTGGGAGGAGAGGAGAATGGG + Intergenic
1103496920 12:121370153-121370175 GGCTGGGGAGAGGGGAAAGTGGG - Intronic
1103861478 12:124018098-124018120 CGCTGTGTTGTGAGGAAAGAGGG + Intronic
1104664221 12:130635911-130635933 GGCTGTGTGGAGAAGACAGTAGG - Intronic
1105453198 13:20518469-20518491 CGGTGGGGGGAGAGGAAGGAGGG + Intronic
1106798663 13:33233491-33233513 CTCTGGGTGGAGAGGAGAACTGG - Intronic
1107978583 13:45713642-45713664 CGCTGGGCCGAGAGGAGAGCCGG + Exonic
1108046202 13:46387075-46387097 CGCGGGGTGGAGAGGGTGGTTGG - Intronic
1110493870 13:76142167-76142189 GGCTGGGTGGAGAGAAAAATTGG + Intergenic
1112095379 13:96126887-96126909 AGCTGGGGGTAGAGGAAAGGAGG - Intronic
1112502912 13:99956221-99956243 GGCTGGGCGGAGAGGGGAGTGGG - Intergenic
1112651976 13:101409447-101409469 GGCTGGGAGGAGGGGAAAATGGG - Intronic
1113503956 13:110800181-110800203 CGCTCGGTGGAGAGGAGTCTGGG - Intergenic
1113939413 13:114010663-114010685 GGCTGCGTGGGGAGGGAAGTGGG + Intronic
1114549292 14:23523926-23523948 CACTGGGTGGAGGGGGAGGTAGG + Exonic
1115469150 14:33749875-33749897 CACTGTGTGGAGAGGAAGATTGG - Intronic
1116712267 14:48383463-48383485 CTCTCAGTGGAGAGGAAAGGTGG + Intergenic
1118557214 14:67038288-67038310 GGCTGGGAGGAGAGGGAAATAGG + Intronic
1119776552 14:77252774-77252796 GGCTGGGCGGAGAGGGCAGTGGG - Intronic
1120572192 14:86133942-86133964 AGCTGGGAGAATAGGAAAGTTGG + Intergenic
1121696557 14:95917961-95917983 GGCTGGGTGGAGGGGGAAGTGGG - Intergenic
1121995403 14:98598713-98598735 AGCCTGGTGGAGAGGAAAATGGG - Intergenic
1122250341 14:100434736-100434758 AGCTGGGTAGAGAGGAAAAAGGG - Intronic
1122423543 14:101592094-101592116 CACTGGCTGAAGAGGTAAGTGGG + Intergenic
1122718745 14:103710292-103710314 AGCTGGGGGGAGAGGAAGTTGGG + Intronic
1122737202 14:103849601-103849623 GGCTGGGTGGAGAGGAGGATGGG - Intergenic
1123794387 15:23756866-23756888 TTCTGGGTGGAGTGGAAACTTGG + Intergenic
1123976219 15:25556907-25556929 GGCTGAGTGGACAAGAAAGTTGG - Intergenic
1124782060 15:32645447-32645469 GTCTGAGTGGAGAGGGAAGTGGG + Intronic
1125888677 15:43249422-43249444 GGCTGGGAGGAGGGGATAGTTGG - Intronic
1126634281 15:50766083-50766105 CGTTTGGAGGAGAGGGAAGTTGG - Intergenic
1127645852 15:60958416-60958438 CTAGAGGTGGAGAGGAAAGTGGG + Intronic
1129160543 15:73745254-73745276 TGCTTGCTGGAGAGGAAAGGGGG - Intronic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130909340 15:88260484-88260506 TGCTAGGTGGAGGGGAATGTGGG - Intergenic
1131010669 15:89015795-89015817 GGCTGGGTGGAAGGGAAAGGGGG + Intergenic
1131687992 15:94792042-94792064 AGCTGGGCAGAGAGGGAAGTTGG + Intergenic
1132352876 15:101150759-101150781 CCCAGGGTGGACAGCAAAGTAGG + Intergenic
1132434015 15:101781990-101782012 CGCGGGGTGGGGAGGGAGGTGGG + Intergenic
1132441159 15:101865803-101865825 CGACGGTGGGAGAGGAAAGTGGG - Intergenic
1133387069 16:5378374-5378396 GGCTGGGTGGAGTGGAAACGAGG - Intergenic
1134313974 16:13101110-13101132 GGCTGTGGGGAGAGGGAAGTGGG + Intronic
1136450140 16:30349820-30349842 GGCTGGGGGGTGAGGAAAGGTGG + Intergenic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1136876604 16:33863291-33863313 AGCTGGGTAGAGGGGAAATTTGG + Intergenic
1137366317 16:47862687-47862709 GGCTGGGAGGTGAGAAAAGTTGG + Intergenic
1139274400 16:65714172-65714194 GGCTGGGTGGGGTGGGAAGTTGG - Intergenic
1140230373 16:73112816-73112838 CCCTGGATGCAGAGGAATGTGGG - Intergenic
1141541356 16:84725199-84725221 GGCTGGGAGGAGAGGAGAATGGG - Intronic
1142875962 17:2852515-2852537 TGCTGGGTGGAGAGGGGAGAGGG - Intronic
1144002585 17:11069647-11069669 GGCTGGGAGGAGGGGAAAATGGG - Intergenic
1144212452 17:13026852-13026874 CGCTGTGTGGAGAGGAGGGGGGG + Intergenic
1144674392 17:17152655-17152677 TGCTGGGTGGAGAGTCAGGTTGG + Intronic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1144872732 17:18380877-18380899 TGGTGGGTGGAGGGGACAGTGGG - Intronic
1145996847 17:29109829-29109851 CCCAGAGTGGAGAGGAAAGGAGG + Intronic
1146113184 17:30110585-30110607 GGCTGGGGGTAGGGGAAAGTGGG - Intergenic
1146649787 17:34599497-34599519 CAGTGGGTGGAGGGGAGAGTAGG + Intronic
1146910200 17:36643528-36643550 CTGTGGGTGGAGAGGATGGTGGG + Intergenic
1147426416 17:40347884-40347906 AGCTGGGGGCAGAGGAAACTGGG - Intronic
1147487196 17:40827858-40827880 AAATGGCTGGAGAGGAAAGTAGG + Intronic
1148155850 17:45425037-45425059 CTCTGGGTGGACAGCAATGTGGG + Intronic
1148444344 17:47728377-47728399 GGCTGGGAGTAGAGGAAAGAGGG + Intergenic
1148495083 17:48048619-48048641 CGCGGGGCCGAGAGGAAAGCTGG + Intronic
1149185614 17:53993438-53993460 AGTTGGGTGGATAGGTAAGTAGG + Intergenic
1149750939 17:59144759-59144781 CGCTGGGGGGAGGGGAAAAGAGG + Intronic
1151306664 17:73267053-73267075 CGCTCCGTGGAGAGGAAGGCAGG - Intergenic
1152802858 17:82339962-82339984 CACTGGGGGGAGAGGACACTGGG - Intergenic
1154236527 18:12611156-12611178 GGGTAGCTGGAGAGGAAAGTGGG - Intronic
1154246518 18:12703839-12703861 GGCTGGGAGTAGGGGAAAGTAGG + Intronic
1154315441 18:13300274-13300296 CGCGGGGTGGGCAGGAGAGTGGG - Intronic
1157621597 18:49020386-49020408 CCCTGGGTGGAGAAGAAGGCCGG - Intergenic
1158063345 18:53374998-53375020 CCATGGGTGGATTGGAAAGTAGG + Intronic
1158797250 18:60861750-60861772 TGCTGAGTGGGGAGGAAAATAGG - Intergenic
1158965389 18:62617887-62617909 GGCTGGGTGGAGAGGGAAAGGGG + Intergenic
1159275509 18:66215793-66215815 GGCTGGGTTGAGGGGAGAGTGGG - Intergenic
1159413762 18:68116992-68117014 GGCTGGGTGGTGGGGAGAGTGGG + Intergenic
1160643819 19:167662-167684 CGAAGGTGGGAGAGGAAAGTGGG + Intergenic
1160814788 19:1030004-1030026 CGCTGGAGGGAGAATAAAGTAGG - Intronic
1160957728 19:1701400-1701422 GGCTGGGTGGACAGGAGACTCGG - Intergenic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1163712178 19:18853379-18853401 GGCTGGTGGGAGAGGAAAGTGGG + Intronic
1165082698 19:33318449-33318471 TACTGGGGGGAGAGGAAAGGGGG + Intergenic
1166211456 19:41309219-41309241 AGCTGGGTTAAGAGGAAGGTAGG - Intronic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1167304131 19:48697001-48697023 CGCTGGGTGTAGGGGACAGAGGG + Intronic
1168504201 19:56919574-56919596 CTCTGGGTGAAAAGGAAAGTTGG + Intergenic
1168644449 19:58051144-58051166 GGCTGCGTGGAGAGAAGAGTGGG - Intronic
925337616 2:3109385-3109407 GGCTGCCTTGAGAGGAAAGTGGG - Intergenic
927552641 2:24012565-24012587 TGCTGGGTGGAGTGGATTGTAGG + Intronic
927850823 2:26498243-26498265 CGGAGGGTGGAGGGGAAGGTGGG + Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
931979252 2:67677010-67677032 CATTGGGTGGTGAGGAAAGAGGG - Intergenic
932841577 2:75088191-75088213 AGCAGGGTGCAGAGGAGAGTGGG - Intronic
932910391 2:75800206-75800228 TGGTGGGTGGGGAGGAACGTTGG + Intergenic
934668541 2:96191626-96191648 CACTGGATAGAGAGGAAAGCAGG - Intronic
935022048 2:99241014-99241036 GGCTGGGTTGAGAGGTCAGTGGG + Intronic
935159146 2:100514111-100514133 AGCTGGGTGGATGGTAAAGTTGG + Intergenic
936126529 2:109793168-109793190 GGCTGGGTGGAGGGGAAATCTGG - Intronic
936218164 2:110578300-110578322 GGCTGGGTGGAGGGGAAATCTGG + Intergenic
936464324 2:112733557-112733579 AGCTGGCTGGAGAGTGAAGTTGG + Intronic
936497124 2:113032087-113032109 CTCTGGGTTGAGAGGAAGGAGGG + Intronic
938149905 2:128873393-128873415 AGCTGGGTGGAGATGACAGAGGG + Intergenic
938236610 2:129710987-129711009 CTCTGGATGGAGAGGAGAGGAGG - Intergenic
938320445 2:130359055-130359077 CTCTGGGAGGAGAGCACAGTGGG - Intronic
939956354 2:148530655-148530677 AGCTGGGTGGAGAGAGAAGCTGG - Intergenic
940168921 2:150805693-150805715 TGCTGGGTGGATAGCACAGTAGG - Intergenic
942428625 2:175885055-175885077 AGCCGTGTAGAGAGGAAAGTAGG - Intergenic
944310374 2:198226238-198226260 GGCTGGGGGGAGAGGAAAATAGG + Intronic
945916721 2:215712065-215712087 CGCTGCATGGAGAGGAAGGTAGG - Intergenic
946109405 2:217401161-217401183 CGGAGGGTGGAGAGCAAAGTTGG + Intronic
946627451 2:221629018-221629040 AGCTGCGTCAAGAGGAAAGTTGG + Intergenic
947227478 2:227854004-227854026 CCCTGGGTGGGAAGGAGAGTTGG + Intergenic
947329056 2:229009192-229009214 GGCTGTGTGGAGATCAAAGTAGG - Intronic
948303002 2:236922378-236922400 CAGTGGATGGAGAGGAAGGTTGG + Intergenic
948668974 2:239554294-239554316 CACTGGGCTGAGATGAAAGTGGG + Intergenic
949062786 2:241970810-241970832 CGCTGGGTGAAAGGGAAAGCAGG - Intergenic
1169027549 20:2383373-2383395 GGATGGGTGGAGAGCTAAGTCGG + Intronic
1171095164 20:22325911-22325933 AACTGGGTGGAGAGTAGAGTGGG - Intergenic
1173106925 20:40145566-40145588 GGCTGGGGGGAGAGGAAAATGGG - Intergenic
1173326572 20:42038866-42038888 TACTGGGTGGAGAGGAGAGAGGG + Intergenic
1173639428 20:44590213-44590235 CACTTGGTGGAGAGGAAAGCTGG - Intronic
1175542139 20:59754581-59754603 CGGTGGGTGCAGAGGTGAGTTGG + Intronic
1176308616 21:5137473-5137495 CCCTGGGTGGAGAGGAGACATGG + Exonic
1178058036 21:28821160-28821182 TGGTGGGTGGAGTGGAAGGTTGG - Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178384883 21:32141002-32141024 CTCTGGGTGGAGATTAAAGGTGG - Intergenic
1179170459 21:38969030-38969052 GGCTGGGTGGAGAGGAGGGCAGG + Intergenic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179774915 21:43655618-43655640 TGCTGGGTGGAGAGAGAGGTTGG - Intronic
1179848443 21:44124559-44124581 CCCTGGGTGGAGAGGAGACATGG - Exonic
1180226785 21:46398242-46398264 CGCTGGATGGAGAGGTGAGGAGG + Exonic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180860314 22:19075584-19075606 GGCTGGGAGGAGAGAAAAATTGG - Intronic
1182753004 22:32656955-32656977 TGTTGGGTGGAGAAGAAAGCTGG + Intronic
1182896005 22:33859956-33859978 GGCTGGGAGGAGGGGAAAATAGG + Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183652659 22:39167370-39167392 GCCTGGGTGCAGAGGAGAGTCGG + Intergenic
1184206679 22:43008709-43008731 CGCTGGGTGGGTTTGAAAGTTGG - Intronic
949271423 3:2222382-2222404 GGCTGGGAGGAGAGGAGAGTAGG + Intronic
949566885 3:5253347-5253369 CGCTGGTAGGAGAGGAAACTTGG - Intergenic
949799847 3:7891769-7891791 TGCTTGGTGGAAAGGAAAGATGG - Intergenic
949866705 3:8553185-8553207 GGGTGGGTGTAGGGGAAAGTGGG - Intronic
950226687 3:11241407-11241429 CCCTGGGTGGAGTGGGAACTTGG + Intronic
952976443 3:38700278-38700300 AGCTGGGAGGAGGGGAAATTGGG + Intronic
953912146 3:46898594-46898616 CGGTGGGTGGACAGGAAGCTGGG - Intronic
956451059 3:69375174-69375196 GGATGGGTGGACAGGTAAGTGGG - Intronic
956692614 3:71891773-71891795 CACTTGCTGGACAGGAAAGTGGG + Intergenic
957219200 3:77360386-77360408 TGAAGGGTGGAGAGGAAAGGTGG + Intronic
958254873 3:91314014-91314036 CGGTGGGTGGACAGGAGAGCGGG + Intergenic
958996630 3:100913120-100913142 GGGTGGGTGGAGTGCAAAGTTGG - Intronic
961053142 3:123764536-123764558 CGCAGGGTGGGAAGGTAAGTTGG + Intronic
961445295 3:126977829-126977851 CACTGGGTGGAGAGGACATTGGG - Intergenic
962242165 3:133758937-133758959 CAGAGGCTGGAGAGGAAAGTTGG + Intronic
964381770 3:156104755-156104777 CTCTGAGTGGACAGGAAACTGGG - Intronic
964423749 3:156531388-156531410 CGCTGGGAGGAGAGGACACTGGG - Exonic
968254411 3:197253692-197253714 GGATGGGGTGAGAGGAAAGTAGG + Intronic
968480384 4:830538-830560 GGCTGGGTGGTGAGCACAGTGGG + Intergenic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
969032989 4:4228130-4228152 CGCAGGTTGGAGAGGGGAGTTGG + Intergenic
969237221 4:5873982-5874004 CGCTGGGTGGAAATGGAAGAAGG + Intronic
969432234 4:7162060-7162082 CGCCGTGTGAAGAGGAAAGCAGG - Intergenic
970502873 4:16696090-16696112 CCTTGGGGAGAGAGGAAAGTAGG + Intronic
970693313 4:18644743-18644765 CCCTTGTTGGAGAAGAAAGTAGG + Intergenic
971385917 4:26140459-26140481 CGCAGGGAGGAGAGCCAAGTTGG - Intergenic
971838014 4:31794474-31794496 AGTGGGGTGGAGAGGAAAGTGGG - Intergenic
972644463 4:40954373-40954395 CACGGGGTGGAGAGGAAAGAGGG + Intronic
973288599 4:48447188-48447210 AGCTGGGGGGAGGGGAAATTGGG - Intergenic
973855723 4:55008509-55008531 CGCTGGGGAGAGAGGAAGGCTGG - Intergenic
975472114 4:74781866-74781888 GGCTGGGAGGAGAGGCAAGTAGG - Intronic
976107594 4:81635797-81635819 GGCTGTGTGGAGAGGACACTTGG - Intronic
976190387 4:82481210-82481232 AGCTGGGTGGAGAGAGAAGCAGG + Intergenic
976329061 4:83807409-83807431 GGCTGGGAGGAGAGGAAAATGGG - Intergenic
978255984 4:106693614-106693636 CGCAGCGTGGAGAGGAAATGTGG + Intergenic
979231653 4:118353648-118353670 CTCTGGTTAGAGAGGAAATTTGG - Intergenic
985192659 4:187393139-187393161 CGGTGGCTGAAGAGGGAAGTCGG - Intergenic
985289765 4:188375774-188375796 CTCACGGTGGAGAGGAAAGAAGG - Intergenic
985913439 5:2900464-2900486 AGCTGGGAAGAGAGGAGAGTGGG - Intergenic
985984606 5:3504228-3504250 CGCGGGCAGGTGAGGAAAGTAGG - Intergenic
986371810 5:7087754-7087776 CCCTCGGTGGAGAGGGAAATTGG - Intergenic
987913273 5:24178494-24178516 GGCTGGGTGGAGAAAAAAATGGG - Intergenic
989573121 5:42963822-42963844 GGCATGGGGGAGAGGAAAGTAGG + Intergenic
990996423 5:61736601-61736623 CTTTGGGTGGAGAGGCGAGTGGG - Intronic
991602713 5:68369660-68369682 GACTGGGGGGAGGGGAAAGTGGG - Intergenic
993035541 5:82752516-82752538 GGCTGGGTGGAGAGGAGAATAGG - Intergenic
996277690 5:121687186-121687208 GGCTGGGTGGAGGAGAAAATAGG + Intergenic
997405135 5:133639676-133639698 CAATGGGTGCAGAGGAAACTTGG + Intergenic
997964265 5:138345285-138345307 CGCAGGGTCGAGAGGAATCTTGG - Exonic
998168845 5:139860233-139860255 CCCTGGGAGGAAAGGTAAGTGGG + Intronic
999135190 5:149314019-149314041 CGCTGGCTGGAGGGGCAAGAAGG + Intronic
999683018 5:154077320-154077342 CACTGGGTGGAAAGGAGAGATGG - Intronic
1002520941 5:179793049-179793071 GGCCAGGTGGAGAGGAAAGGTGG - Intronic
1002733101 5:181357119-181357141 CGAAGGTGGGAGAGGAAAGTGGG - Intergenic
1002751436 6:116986-117008 CGAAGGTGGGAGAGGAAAGTGGG + Intergenic
1003034154 6:2628489-2628511 CGAGGGAAGGAGAGGAAAGTGGG + Intronic
1003034170 6:2628543-2628565 CGGGGGAAGGAGAGGAAAGTGGG + Intronic
1003453218 6:6256671-6256693 CTCTGGGTCGGGAGGACAGTGGG - Intronic
1003853553 6:10249975-10249997 TGCTGGGTGGAGACGATAGACGG - Intergenic
1004466252 6:15887932-15887954 GGATGGGTGGAGGGGAAAGGAGG + Intergenic
1005114480 6:22320155-22320177 CTCTTTGTGGAGTGGAAAGTGGG - Intergenic
1006423047 6:33947458-33947480 GGCTGGGAGGAGAGGGCAGTGGG + Intergenic
1007022588 6:38536825-38536847 TGCTGGGGGTGGAGGAAAGTGGG + Intronic
1009000486 6:57707063-57707085 CGGTGGGTGGACGGGAGAGTGGG - Intergenic
1009188951 6:60606490-60606512 CGGTGGGTGGACAGGAGAGTGGG - Intergenic
1010364551 6:75034112-75034134 TGCTGGATGGAGATGAAGGTGGG + Intergenic
1012019859 6:93904988-93905010 GGCTGTGTGGAGAGGAAATGTGG - Intergenic
1013391761 6:109692215-109692237 CTGTGGGTGGAAAGCAAAGTTGG + Intronic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1014191819 6:118504916-118504938 TGCTGAGTGGAGAGTAGAGTGGG + Intronic
1016417700 6:143850421-143850443 TCCTGTTTGGAGAGGAAAGTGGG + Intronic
1017040077 6:150301026-150301048 GGCTTAGTGAAGAGGAAAGTAGG + Intergenic
1017884723 6:158589177-158589199 AGCAGGATGGAGAGGAAAGAGGG + Intronic
1018034784 6:159872808-159872830 GGCTGGGTGGAGGGGAAATGGGG + Intergenic
1019237353 6:170629441-170629463 CGACGGTGGGAGAGGAAAGTGGG - Intergenic
1019771630 7:2886923-2886945 GCCAGGGTGGAGAGGACAGTCGG + Intergenic
1020111816 7:5451878-5451900 CCCTGGGAGGAGGGGAGAGTGGG - Intronic
1021133130 7:16934968-16934990 TGCTGGGGGGAGAGGACACTGGG - Intergenic
1021989574 7:26128996-26129018 CCATGGGAGGGGAGGAAAGTGGG + Intergenic
1022540870 7:31134563-31134585 CGCCGGGAGGAGAGGAATGAGGG - Intergenic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1023118872 7:36889400-36889422 CACTGAGTGGAAAAGAAAGTGGG + Intronic
1023145938 7:37151225-37151247 CCCTGGCAGGAAAGGAAAGTTGG - Intronic
1023609592 7:41959326-41959348 CACTGGGTGCTGAGGAAAGGTGG + Intergenic
1025259113 7:57405258-57405280 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1025609739 7:63067896-63067918 CTCTGGCTGGAGAGAAAAGAGGG + Intergenic
1025710236 7:63901301-63901323 CTCTGGCTGGAGAGAAAAGAGGG - Intergenic
1027180322 7:75934934-75934956 CTCTGGTAGGAGAGGAATGTGGG + Intronic
1027697455 7:81430013-81430035 GGCTGGGTGGAGTGGAAGGAGGG + Intergenic
1027869382 7:83687422-83687444 AGCTGGGAGGAAAGGAAAATAGG + Intergenic
1028347382 7:89799013-89799035 GGCTGAATGGAGAGGAAACTGGG - Intergenic
1028414123 7:90561871-90561893 CTCTGGGTGAAGAGAAAAATGGG + Intronic
1031751746 7:125583410-125583432 GGCTGGGGGAAGAGGGAAGTAGG - Intergenic
1033577763 7:142702495-142702517 CCCTGGGTGTAGTGGAAAGTGGG + Intergenic
1033729802 7:144166631-144166653 TGCTGGGGGGAGAGAAAAATGGG + Intergenic
1034572746 7:151970178-151970200 CGCTGGGTGAAAGGGAAAGCAGG + Intronic
1034713848 7:153220997-153221019 AGCAGGCTGGAGAGGAAAGAGGG - Intergenic
1034770319 7:153767909-153767931 ACCTGGGTGGTGAAGAAAGTGGG + Intergenic
1034895725 7:154875301-154875323 AGCTGGGAGGAGAGCACAGTGGG + Intronic
1035117849 7:156539810-156539832 TGCTGGGTGGAGGGGGAAGAAGG - Intergenic
1035251165 7:157598187-157598209 CGCTGGGTGGGGAAGACAGAGGG - Intronic
1035510414 8:177171-177193 CGAAGGTGGGAGAGGAAAGTGGG + Intergenic
1036614439 8:10377805-10377827 TGCTGGGTGTGGAGGCAAGTGGG + Intronic
1037698352 8:21248212-21248234 GGCTGGGTGGAGGGGAGAATGGG + Intergenic
1037798579 8:22017794-22017816 CACTGGGAGGAGAGGAAAACGGG + Intergenic
1037928059 8:22860382-22860404 AGCTGGGGGGAGAGGGAAGAGGG - Intronic
1038257966 8:25968520-25968542 AGCTGGGGGGAGGGGAAAATGGG + Intronic
1038446692 8:27609368-27609390 AGCTGGGTGCAGAAGAAACTTGG + Intronic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039516530 8:38138311-38138333 TGCGGGCTGGAGGGGAAAGTAGG + Intronic
1039612824 8:38932774-38932796 CCCTGGATGGGGAGGAAGGTGGG + Intronic
1039946182 8:42130723-42130745 AGCTAGGAGGAGGGGAAAGTAGG - Intergenic
1040597844 8:48857624-48857646 GGCTGAGTGGAGGGGAACGTAGG + Intergenic
1042839313 8:73107852-73107874 CCCTTAGAGGAGAGGAAAGTTGG - Intronic
1043692759 8:83176499-83176521 CACTGGGTGGAATGGAAAGATGG - Intergenic
1044818378 8:96136555-96136577 GGGTGGGTGGAGAGGAGAGGAGG - Intergenic
1045223641 8:100222922-100222944 GGCTGGGGGGAAAGGAAAATGGG - Intronic
1045413710 8:101945321-101945343 TGGTGGGTGGAGATGAAGGTGGG + Intronic
1046018751 8:108637905-108637927 TTCTGGGTGGAAAGCAAAGTTGG + Intronic
1046509582 8:115185090-115185112 TGCTGGGAGGAGAGGAAAATGGG - Intergenic
1046897708 8:119490774-119490796 GGGTGGGTGGAGAGGTAAGAAGG - Intergenic
1047158288 8:122347037-122347059 GGCTGGGAGGAGAGGAAAGAGGG + Intergenic
1049163939 8:141115401-141115423 AGCAGGGTGGAGAGGAAAGCAGG + Intergenic
1049401784 8:142431116-142431138 AGCTGCATGGAGAGGAAAGGTGG - Intergenic
1052127518 9:24795946-24795968 GGCTGGGTGAAGGGGGAAGTGGG + Intergenic
1052701699 9:31945345-31945367 GGCTGGGAGGTGTGGAAAGTGGG + Intergenic
1053353052 9:37425642-37425664 CGCTGGGTGGACAGTCCAGTGGG + Intronic
1053529672 9:38867712-38867734 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1054201897 9:62092139-62092161 TGCTGGGTGGAGAGGGAAAAGGG + Intergenic
1054336919 9:63815990-63816012 AGCAAGGTGGAGAGGGAAGTAGG - Intergenic
1054636460 9:67496220-67496242 TGCTGGGTGGAGAGGGAAAAGGG - Intergenic
1055081992 9:72276496-72276518 CACTGAGTGGAGAGGGAAATGGG - Intergenic
1057068406 9:92075488-92075510 TGCTGTGTGGAGAGGAAGGAGGG - Intronic
1057695983 9:97323365-97323387 GGCAGGGTGCAGGGGAAAGTGGG - Intronic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1060291731 9:122309036-122309058 GGCTGGGGGAAGAGGTAAGTGGG - Intronic
1060425457 9:123501097-123501119 TGCTGGGAGGAGAGGGAAATGGG - Intronic
1060836028 9:126755727-126755749 CGGTGGGTGGAGGTGAAAGGGGG - Intergenic
1062098257 9:134713841-134713863 AGGTGGGTGGAGTGGAGAGTGGG + Intronic
1062757508 9:138309443-138309465 CGAAGGTGGGAGAGGAAAGTGGG - Intergenic
1186141767 X:6582008-6582030 TGATGGGTGGAGAGGTAGGTAGG - Intergenic
1186601618 X:11043913-11043935 GGGTGGGTGGAGGGGCAAGTAGG - Intergenic
1186826221 X:13342716-13342738 GGCTGGGAGGTGAGGAAAATGGG - Intergenic
1187553722 X:20331421-20331443 GGCTGGGTAGAGGGGAAGGTCGG - Intergenic
1187592138 X:20729145-20729167 AGCTAGGTGGAGTGGAAAGCTGG + Intergenic
1188181555 X:27062634-27062656 GGCTGGTGGGAGAGGAAAATGGG - Intergenic
1189173811 X:38934226-38934248 TGCTGGGTGGAGAGGTAGGAAGG - Intergenic
1189578041 X:42375974-42375996 CACTGGCTGGAGAGCAAGGTGGG + Intergenic
1190325415 X:49204343-49204365 GGCTGGGTGAAGAGTAAAGCTGG + Intergenic
1190427508 X:50346629-50346651 CTATGGGTGGAGAGGAGAGGAGG - Intronic
1190757866 X:53416370-53416392 GGCTGGGAGGAGGGGAAAATGGG + Intronic
1191980096 X:66916134-66916156 GGATGGGAGGAGAGTAAAGTCGG + Intergenic
1192193944 X:69016325-69016347 CGCTGGCTGGAGAGGGAAGGAGG - Intergenic
1192276689 X:69638928-69638950 GGCTGGGGGGAGGGGAGAGTAGG - Intronic
1192613828 X:72596286-72596308 GGCTGGGTAGAGGGGAAAATGGG + Intronic
1194307861 X:92270627-92270649 AGCTGGCTGGAGGGGAAAGAGGG + Intronic
1195280690 X:103330126-103330148 TGCTGGTGGGAGGGGAAAGTGGG + Intergenic
1196694432 X:118595900-118595922 GGCTGGGAGGAGAGGGAAATGGG + Intronic
1196920586 X:120581339-120581361 CTCTTGGTGCAGTGGAAAGTGGG + Intergenic
1197155607 X:123266714-123266736 GGATGGGTGGAGAAGAGAGTAGG - Intronic
1197199075 X:123733137-123733159 CGCTGGGTGGAGAGGAAAGTGGG - Intergenic
1197899141 X:131350235-131350257 GGCTGGGAGGAGAGAAAAATGGG + Intronic
1200061056 X:153483912-153483934 GGCTGGGGGCACAGGAAAGTGGG + Intronic
1202048468 Y:20757299-20757321 GGCTGGGGGGAGAAAAAAGTAGG + Intronic