ID: 1197199076

View in Genome Browser
Species Human (GRCh38)
Location X:123733138-123733160
Sequence CCGCTGGGTGGAGAGGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 363}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199076_1197199082 -8 Left 1197199076 X:123733138-123733160 CCACTTTCCTCTCCACCCAGCGG 0: 1
1: 0
2: 3
3: 35
4: 363
Right 1197199082 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 114
1197199076_1197199089 18 Left 1197199076 X:123733138-123733160 CCACTTTCCTCTCCACCCAGCGG 0: 1
1: 0
2: 3
3: 35
4: 363
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199076_1197199086 7 Left 1197199076 X:123733138-123733160 CCACTTTCCTCTCCACCCAGCGG 0: 1
1: 0
2: 3
3: 35
4: 363
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199076_1197199087 17 Left 1197199076 X:123733138-123733160 CCACTTTCCTCTCCACCCAGCGG 0: 1
1: 0
2: 3
3: 35
4: 363
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199076 Original CRISPR CCGCTGGGTGGAGAGGAAAG TGG (reversed) Intergenic
900333271 1:2147530-2147552 CAGATGGGTGGAGAGGTCAGTGG - Intronic
900648086 1:3718033-3718055 CCTCAGGGTGGAGAGCAAGGAGG - Intronic
900853259 1:5160617-5160639 ACGCAGAGAGGAGAGGAAAGAGG + Intergenic
901409783 1:9074383-9074405 AAGCTGGCTGGAGGGGAAAGAGG + Intronic
902096346 1:13949130-13949152 CCTCTGGGTACAGAGGAGAGGGG - Intergenic
902212514 1:14914012-14914034 CCTCTGAGTGGGGAGGAAGGAGG - Intronic
902802988 1:18841907-18841929 CTGCTGGTTGGAGAGGGGAGGGG - Intronic
903363592 1:22792549-22792571 CCAATGGATGGATAGGAAAGGGG - Intronic
903631813 1:24780033-24780055 CCACTGGTGGGAGGGGAAAGGGG - Intronic
903765157 1:25729275-25729297 CCGCAGGGTGGAGAGCAACAGGG - Intronic
903875935 1:26472928-26472950 CCGCAGGGAGGGGAGGGAAGGGG - Intronic
903953861 1:27011902-27011924 CCACGGGGTGGAGGGGGAAGGGG + Intronic
905463133 1:38134161-38134183 ACGCGGGGAGGAGAGGAGAGAGG + Intergenic
905615544 1:39395068-39395090 GGGGTGGGTGGGGAGGAAAGGGG + Intronic
905806489 1:40881251-40881273 CCTGGGGGTGGAGAGGAATGTGG - Intergenic
906533988 1:46541303-46541325 CCTCAGGCTGGAGAGGAAAGTGG - Intergenic
906861718 1:49367923-49367945 CCAATGGGTGGAGAGGAGTGGGG - Intronic
910825693 1:91404785-91404807 CCGCAGGGAGGTGAGGAGAGGGG - Exonic
912450734 1:109766043-109766065 CAGTGGGGTGGAGAGGAAGGGGG - Intronic
914349806 1:146831275-146831297 CCTCCAGGAGGAGAGGAAAGAGG + Intergenic
915040144 1:152961480-152961502 CCTCTGAGGAGAGAGGAAAGAGG + Intergenic
915570438 1:156742623-156742645 GCACTGTGTGGAGAGGAAAAAGG + Intronic
916069759 1:161163019-161163041 CGGCGGGGTGGAGAGGGAACTGG - Exonic
916127988 1:161588481-161588503 GCACTGGGAGGAGAGGAAAAGGG - Intronic
916137906 1:161670311-161670333 GCACTGGGAGGAGAGGAAAAGGG - Intronic
917771787 1:178287380-178287402 AAGGTGGGTGGAGAGGAAACTGG - Intronic
917838861 1:178961484-178961506 CCCCTGGGTGGAGAGCAAGCAGG - Intergenic
918012636 1:180602250-180602272 CCCATAGGTGGAGTGGAAAGGGG + Intergenic
918064552 1:181090229-181090251 CGGCTGCGTGGAGAAGGAAGCGG + Exonic
918068776 1:181119755-181119777 CAGCTAGGTGGAGAGGACTGTGG - Intergenic
918394918 1:184103767-184103789 GGGCTGGGAGGAGAGGACAGTGG - Intergenic
918555187 1:185790788-185790810 GCCCTGGGTTGAGAGGAAACTGG + Intronic
919324101 1:196083563-196083585 CTGCTGGGAGGAAAGTAAAGTGG + Intergenic
919769598 1:201148886-201148908 CCGCTGGGAGCAGCGGAAAAAGG + Intronic
921924851 1:220703152-220703174 CCCGTGGGAGGAAAGGAAAGAGG + Intergenic
922742706 1:228023114-228023136 CTGCTCCCTGGAGAGGAAAGCGG + Intronic
923253147 1:232195584-232195606 CCACAGCCTGGAGAGGAAAGAGG - Intergenic
923258207 1:232240500-232240522 CCACAGGCTGGAGAGGAAGGGGG + Intergenic
923387908 1:233483962-233483984 ACACTGGGTGGAGAGGGATGTGG - Intergenic
1062961217 10:1574874-1574896 TGGCAGAGTGGAGAGGAAAGAGG + Intronic
1064253296 10:13723438-13723460 CAGATGGGGGGAGAGAAAAGAGG + Intronic
1066228940 10:33413014-33413036 CAGCTGGATGGACAGGAAGGAGG + Intergenic
1067213537 10:44281624-44281646 CTGCCGGGTGGAGAGGAAGAAGG - Intergenic
1068801117 10:61141133-61141155 CTGCTGGGGGCAGAGGAAGGAGG + Intergenic
1069063405 10:63917434-63917456 CAGCTGGGTTTAGGGGAAAGAGG - Intergenic
1069514354 10:69065796-69065818 CCTCTGTGTGGAGTGGCAAGTGG + Intergenic
1069909090 10:71749040-71749062 CTGCTGTGTGGAGAGGGAGGCGG - Exonic
1070544255 10:77440200-77440222 ATGCTGGGTGGAGGGGAAAGAGG + Intronic
1070626561 10:78055060-78055082 CTGCTGAGTGGAGAAGAAGGTGG - Exonic
1070745742 10:78932629-78932651 CCTCAGGATGAAGAGGAAAGGGG + Intergenic
1071334280 10:84588780-84588802 CTGCTGGGCAAAGAGGAAAGTGG - Intergenic
1071660140 10:87492649-87492671 AGGCTGGAAGGAGAGGAAAGTGG - Intergenic
1073115199 10:101087884-101087906 ACAGTGGGTGGAGAGGAAGGAGG - Intergenic
1073144001 10:101267322-101267344 CGGCAGGGTGGATAGGAAACTGG + Intergenic
1073597588 10:104816679-104816701 CCACTTTGTGGTGAGGAAAGAGG + Intronic
1073824324 10:107303175-107303197 ATGGTGGGTGGAGAGGAAAGAGG + Intergenic
1074378601 10:112959925-112959947 CTACAGGGTAGAGAGGAAAGTGG + Intronic
1074581404 10:114722770-114722792 CTGCTAGCTGGAGAGGAAGGAGG + Intergenic
1075579167 10:123603801-123603823 TTGCTGGGAGGAGATGAAAGGGG - Intergenic
1075790806 10:125083102-125083124 CCGCTGGCTGCAGAGCCAAGGGG - Intronic
1076907689 10:133371652-133371674 CTGCTGGGTGGACAGCAAGGTGG + Intronic
1077132025 11:977846-977868 CTGCTGCGTGGAGAGGCATGTGG + Intronic
1077153569 11:1081879-1081901 CCGCTGGGTGGTGGGGGCAGCGG + Intergenic
1077241838 11:1514727-1514749 CCGCTGTGTGAAGAGAGAAGCGG - Intergenic
1077331172 11:1984376-1984398 CCACTGGGCGGGGAGGAGAGGGG + Intronic
1077351069 11:2093394-2093416 CGGCTGGGTGATGAGGAAAGGGG + Intergenic
1077353026 11:2101470-2101492 CAGGTGGCTGGAGAGGAAAGAGG - Intergenic
1077701119 11:4443516-4443538 GGGCAGGGTGGAGAGGGAAGGGG + Intergenic
1078142036 11:8699856-8699878 CCTCTGGCTGGAGAGGGGAGGGG - Intronic
1080607415 11:33875207-33875229 CAGGTGCTTGGAGAGGAAAGTGG + Intronic
1081134776 11:39426703-39426725 CTGAGAGGTGGAGAGGAAAGGGG + Intergenic
1081641345 11:44756567-44756589 GGGCTGGGAGGAGAGGAAAATGG - Intronic
1083424414 11:62575693-62575715 CTGCTGTGAGGAGGGGAAAGAGG - Exonic
1083810706 11:65104869-65104891 CCTTTGTGTGGAGGGGAAAGGGG + Intronic
1084369029 11:68726011-68726033 CTGCTGCGTGGAGGAGAAAGGGG + Intronic
1084534373 11:69748064-69748086 CGGGTGGGTGGAGAGCAGAGAGG - Intergenic
1085843133 11:80036900-80036922 CACCTGGGCGGAGAGCAAAGTGG - Intergenic
1088036374 11:105321261-105321283 TCTCTTGCTGGAGAGGAAAGAGG + Intergenic
1088066219 11:105723094-105723116 CCGCTGGCTAAAAAGGAAAGGGG + Intronic
1088321291 11:108556946-108556968 ATGCTGAGTGGAGAGGAAAGAGG - Intronic
1089368187 11:117933931-117933953 CCCCTGGATAAAGAGGAAAGAGG + Intergenic
1089491608 11:118887530-118887552 CCCGTGGGTAGAGATGAAAGAGG + Intronic
1090205172 11:124879881-124879903 GCGCAGTGGGGAGAGGAAAGCGG + Exonic
1091337283 11:134781892-134781914 GTGCTGGGTGGAGAGCAGAGGGG + Intergenic
1202814153 11_KI270721v1_random:39552-39574 CCACTGGGCGGGGAGGAGAGGGG + Intergenic
1091913140 12:4248058-4248080 CATCTGGGTGGAGGGGAACGGGG + Intergenic
1095743583 12:45633333-45633355 TCTCTGGGGGGAGAGGAATGGGG - Intergenic
1095945905 12:47753335-47753357 CTGGTGAGGGGAGAGGAAAGGGG - Intronic
1096152425 12:49323060-49323082 CCGCTGGGAGGCGGGGAAAGAGG - Intergenic
1096744335 12:53715693-53715715 CCTCTGGGAGGAGAGAAGAGGGG - Intronic
1097195473 12:57240365-57240387 CCTCTGGGTGCTGAGGAGAGGGG - Intronic
1097629134 12:62038091-62038113 CGGCAGGGTGGAGAGGAAATGGG + Intronic
1097893569 12:64802338-64802360 GCTCTGGGTGGAGACGAAAAGGG + Intronic
1097959711 12:65520566-65520588 CTGCTGGGTGGAGAATAAACTGG - Intergenic
1098231558 12:68376356-68376378 CCGCTGGGAGGAGAGGCCAGAGG - Intergenic
1101048750 12:100838630-100838652 CAGATGTGTGGAGAGGAAGGTGG + Intronic
1101920100 12:108925454-108925476 TGGCTGGGTGGAGAGGTCAGGGG - Intronic
1103861477 12:124018097-124018119 ACGCTGTGTTGTGAGGAAAGAGG + Intronic
1103906073 12:124327825-124327847 CTGCTGGGTGGTGATAAAAGGGG + Intronic
1104643972 12:130484182-130484204 CCCCTCGGTGGGGAGTAAAGCGG + Intronic
1104675275 12:130708219-130708241 GGGCTGGGAGGAGAGGAGAGAGG + Intronic
1104675523 12:130709730-130709752 CCGCTGGGTTGGGTGGGAAGGGG - Intronic
1104960499 12:132486494-132486516 CAGCAGAGTGGAGAGAAAAGGGG + Intergenic
1104996942 12:132664182-132664204 ACACTGGGTGAAAAGGAAAGGGG - Intronic
1105453197 13:20518468-20518490 GCGGTGGGGGGAGAGGAAGGAGG + Intronic
1105525715 13:21176374-21176396 GCGCTGGACGGAGAGGAAAGCGG - Exonic
1106230469 13:27817320-27817342 CAGCTGGGTGGAGAGGGCCGGGG + Intergenic
1106393312 13:29356555-29356577 CATGTGGGTGGACAGGAAAGGGG + Intronic
1108006564 13:45953270-45953292 CCACTGGGTGGAGGGGATGGGGG - Intergenic
1110004222 13:70246020-70246042 CAGATGAGTGGAGAGTAAAGGGG - Intergenic
1111963987 13:94842109-94842131 CCACTGCTTGGAGGGGAAAGAGG + Intergenic
1112211048 13:97377385-97377407 CGGCTTGATGGAGGGGAAAGAGG - Intronic
1112502913 13:99956222-99956244 CGGCTGGGCGGAGAGGGGAGTGG - Intergenic
1113939412 13:114010662-114010684 CGGCTGCGTGGGGAGGGAAGTGG + Intronic
1114728187 14:24961647-24961669 CAGCAGGGTGGAAAGGAATGAGG + Intronic
1114905215 14:27119269-27119291 CAGCTGGGTTGAGAGAATAGTGG - Intergenic
1115355194 14:32439380-32439402 CCCCAGTGTGGGGAGGAAAGGGG + Intronic
1115752728 14:36507364-36507386 TGGCTGGGTGGACAGGAATGTGG - Intronic
1118553485 14:66984827-66984849 CGGCAGGGTGAAGAGCAAAGGGG - Intronic
1119225666 14:72943015-72943037 CAGCTGCATGGAGAGGAAAAAGG + Exonic
1121321169 14:92992512-92992534 CCGCTGGGTGCAGAGAATGGGGG - Intronic
1121696558 14:95917962-95917984 GGGCTGGGTGGAGGGGGAAGTGG - Intergenic
1122100501 14:99405581-99405603 CCACCGTGTGGAGAGGAGAGGGG + Intronic
1122244377 14:100391590-100391612 CCTCTGGGTGGAGAGAAAATGGG - Intronic
1122250342 14:100434737-100434759 GAGCTGGGTAGAGAGGAAAAAGG - Intronic
1122755205 14:103973362-103973384 AGGTTGGGGGGAGAGGAAAGGGG - Intronic
1123632998 15:22275017-22275039 CAGGTGGGTGGATAGGATAGTGG - Intergenic
1123983003 15:25621015-25621037 CGGCTGGGGGAAGAGGAAAAGGG + Intergenic
1124653018 15:31486689-31486711 CCTCTGGGAGGGGAGGAAGGGGG + Intronic
1126789539 15:52208453-52208475 CCTCCTGGTGGAGAGGATAGAGG + Intronic
1127282157 15:57501752-57501774 CCCCTAGATGGGGAGGAAAGAGG + Intronic
1127387439 15:58477957-58477979 CCCCTGGCTGGAGAGGAGGGAGG - Intronic
1127645851 15:60958415-60958437 CCTAGAGGTGGAGAGGAAAGTGG + Intronic
1127900806 15:63339520-63339542 CAGGTGGGTGGACAGGAATGAGG - Intronic
1128498208 15:68210245-68210267 CCGGTGTGTGGAGAGGGGAGAGG - Intronic
1128567484 15:68710898-68710920 CAGCTGGGTGGAGAGGGATTGGG + Intronic
1128680661 15:69649075-69649097 CAGCAGGTTGGAGAGGCAAGAGG - Intergenic
1129160544 15:73745255-73745277 CTGCTTGCTGGAGAGGAAAGGGG - Intronic
1129226431 15:74173057-74173079 CCACTGGCTGGGGAGGAAACAGG - Intergenic
1129681313 15:77659925-77659947 CCTCCTGGTGGAGAGGAAAGGGG + Intronic
1130286067 15:82555661-82555683 AGGCTGAGTGGAGAGGAAAGAGG - Intronic
1130472220 15:84235849-84235871 TCGCGGGGTGGGGAGGGAAGCGG - Exonic
1130986752 15:88849418-88849440 CCCCTGGGGGCAGAGGCAAGGGG - Exonic
1131010668 15:89015794-89015816 AGGCTGGGTGGAAGGGAAAGGGG + Intergenic
1131800982 15:96069361-96069383 GCGCTGGGAGGACAGGAAACTGG + Intergenic
1131818915 15:96251737-96251759 CGCCTTGATGGAGAGGAAAGAGG + Intergenic
1132151798 15:99467383-99467405 GCGCTGGGTAGAGTGGGAAGAGG + Intergenic
1134463019 16:14446205-14446227 CTGCGGGGTGGAGAGGACATGGG + Intronic
1134687594 16:16169605-16169627 CAGCTGGGAGGAGAGGGATGAGG + Intronic
1135202608 16:20451617-20451639 CTGCTGGCTGGAGAGGAGGGTGG + Exonic
1135216495 16:20576249-20576271 CTGCTGGCTGGAGAGGAGGGTGG - Exonic
1135424226 16:22324374-22324396 CCGCTGGGTGGTTAGGAAAGAGG + Exonic
1136110929 16:28063329-28063351 CCAGTGCGTGGTGAGGAAAGCGG + Exonic
1136532562 16:30879357-30879379 CTGCTGGGTGGAGAAGAGATGGG - Intronic
1136631577 16:31492144-31492166 CCTCAGGGTGGGGAGGAGAGAGG - Intronic
1138231022 16:55336360-55336382 CAGAGGGGTGGAGAGGAAATTGG + Intergenic
1139099772 16:63751191-63751213 ACGCACGGTGGAAAGGAAAGGGG - Intergenic
1139984230 16:70884256-70884278 CCTCCAGGAGGAGAGGAAAGAGG - Intronic
1141347174 16:83257416-83257438 AAGCTGAGCGGAGAGGAAAGAGG - Intronic
1142252133 16:88996823-88996845 ACGCTGGGTGAAGAGGGAGGCGG - Intergenic
1142323873 16:89401794-89401816 ACGCTGGGTGAAGAGGGAGGCGG + Intronic
1142769736 17:2088010-2088032 CCACTGAATGGAGAGGAGAGGGG + Intronic
1142875963 17:2852516-2852538 ATGCTGGGTGGAGAGGGGAGAGG - Intronic
1143020699 17:3915976-3915998 CCCCTGGATGGAGAGGAAGAGGG + Intronic
1143973733 17:10814817-10814839 CGGCAGCGTGGAGAGGAGAGAGG + Intergenic
1144212451 17:13026851-13026873 CCGCTGTGTGGAGAGGAGGGGGG + Intergenic
1145900068 17:28484897-28484919 CTGCTGGGTGGAGAAGAGTGAGG + Intronic
1146450423 17:32969795-32969817 CTGCTGTGTGGAGTGGATAGGGG - Intergenic
1147238090 17:39072290-39072312 CTGCTGGGTGGGGAGGCAGGGGG - Intronic
1147650183 17:42057600-42057622 CCATTGGGAGGAGAGGCAAGGGG + Intronic
1147838170 17:43349990-43350012 CTCCTTGGAGGAGAGGAAAGAGG + Intergenic
1148444343 17:47728376-47728398 TGGCTGGGAGTAGAGGAAAGAGG + Intergenic
1152506986 17:80755881-80755903 CCGCTGGGTGCAGAGGACAGTGG - Intronic
1152799268 17:82323426-82323448 CCTGGGGGTGGAGAGCAAAGCGG + Intronic
1154063416 18:11084523-11084545 CCCGTGGGAGGTGAGGAAAGGGG - Intronic
1155205286 18:23553025-23553047 AAGCTGGAGGGAGAGGAAAGGGG + Intronic
1155842931 18:30668406-30668428 CCTCTGGCTGGTGAGGAAAGAGG + Intergenic
1156627790 18:38930499-38930521 CTGCTGAGGGGAGGGGAAAGGGG + Intergenic
1157105408 18:44770064-44770086 GAGCTGGGAGGAGGGGAAAGAGG - Intronic
1158965388 18:62617886-62617908 GGGCTGGGTGGAGAGGGAAAGGG + Intergenic
1159083809 18:63764447-63764469 CTGCTGAGTGGAGAGTCAAGAGG + Intronic
1159643916 18:70894865-70894887 CAGCTGGGAGGAGAGAAAAAAGG + Intergenic
1160231498 18:77052820-77052842 CTGCTGAGTGGAGAGGAGTGGGG - Intronic
1160622331 18:80180062-80180084 CTGCAGAGAGGAGAGGAAAGGGG + Intronic
1160873780 19:1288115-1288137 CCGCAGGCAGGAGAGGAAGGAGG - Intronic
1161117304 19:2505004-2505026 CCGCTGGGGGGTGAGGTGAGGGG - Intergenic
1161632428 19:5364946-5364968 CTGGTGGGTGGAGAGAAATGGGG - Intergenic
1162797816 19:13095640-13095662 CCGGAGGGTGGAGCAGAAAGGGG + Exonic
1162821983 19:13228793-13228815 CCGCTGAAAGGAGAAGAAAGGGG + Intronic
1163350598 19:16774316-16774338 TGGATGGATGGAGAGGAAAGTGG - Intronic
1163712177 19:18853378-18853400 CGGCTGGTGGGAGAGGAAAGTGG + Intronic
1165064081 19:33219097-33219119 CCACCGGGTGGACAGGAACGTGG - Intronic
1165082697 19:33318448-33318470 CTACTGGGGGGAGAGGAAAGGGG + Intergenic
1166006891 19:39914255-39914277 CACCTGGGTGGAGATGCAAGAGG + Exonic
1166853543 19:45771394-45771416 CAGCTGGAAGGAGAAGAAAGAGG + Exonic
1166939337 19:46353378-46353400 CAGCTGGGTGGAGTGGGCAGGGG - Intronic
1167304130 19:48697000-48697022 GCGCTGGGTGTAGGGGACAGAGG + Intronic
1167439267 19:49499121-49499143 CCTGTGGGTGGAGAGGAGGGTGG + Intronic
1167619132 19:50551494-50551516 TCGGTGGGTGGAGAGAAAGGAGG - Intronic
925402560 2:3586015-3586037 CTGCGGGGAGGAGAGGAAAAAGG + Intergenic
925476734 2:4225063-4225085 CTACTGGGAGGACAGGAAAGCGG + Intergenic
925845018 2:8027160-8027182 ACTCAGGGTGGACAGGAAAGAGG - Intergenic
926368480 2:12155809-12155831 CCTCTGGGTGGAGAGCAATTTGG + Intergenic
926410455 2:12597072-12597094 CAGCTGGGTGGAGAGAAGACAGG + Intergenic
929557880 2:42936795-42936817 CGGCTGGGAGGAGGGGAAGGAGG + Intergenic
929588132 2:43128672-43128694 CTGAGGGGTGGAGAGGAATGAGG + Intergenic
929627360 2:43423113-43423135 CCTCTGAATGGGGAGGAAAGGGG - Intronic
931239347 2:60438745-60438767 CAGCAGGGAGGAGAGGGAAGGGG - Intergenic
931644218 2:64406628-64406650 CTGGAGGGTGGAGAGGACAGAGG + Intergenic
931979253 2:67677011-67677033 ACATTGGGTGGTGAGGAAAGAGG - Intergenic
933289278 2:80419980-80420002 CCACTGGGTGGAGTGGACAGGGG - Intronic
936083300 2:109449659-109449681 CAGCTGGTTGGAGAGGAATCAGG + Intronic
936497123 2:113032086-113032108 TCTCTGGGTTGAGAGGAAGGAGG + Intronic
936786397 2:116098622-116098644 GCTCTGTGTGGAAAGGAAAGTGG + Intergenic
937232396 2:120405804-120405826 CCACTGGGTGGAGACGGAGGTGG - Intergenic
937329803 2:121019378-121019400 CGGCTGGGTGGAGGGGGCAGGGG - Intergenic
938149904 2:128873392-128873414 CAGCTGGGTGGAGATGACAGAGG + Intergenic
941207195 2:162588897-162588919 CCATTGGAGGGAGAGGAAAGAGG - Intronic
944501018 2:200360451-200360473 CCCCTGGTTGGGGAGGACAGAGG - Intronic
946324824 2:218979965-218979987 CCTCTAGGTGGTGAGGAAAGGGG + Intergenic
946634249 2:221707038-221707060 GGGCTGGGTGGGGAGGAAATTGG - Intergenic
947959712 2:234225589-234225611 CTGCTGGTGGGAGAGGGAAGTGG - Intergenic
1169038091 20:2470206-2470228 CTGCTGGATGGAGAGGAGGGCGG - Intronic
1170534791 20:17329865-17329887 CCGGGGTGTGGAGATGAAAGAGG - Intronic
1170881971 20:20304761-20304783 GCTGTGGGTGGAGAGGAGAGGGG + Intronic
1173106926 20:40145567-40145589 GGGCTGGGGGGAGAGGAAAATGG - Intergenic
1173166279 20:40689099-40689121 GGGCGGGGTGGAGAGGCAAGCGG + Exonic
1173326571 20:42038865-42038887 CTACTGGGTGGAGAGGAGAGAGG + Intergenic
1174129943 20:48336736-48336758 CCGCCTGGTGGGGAGGTAAGTGG - Intergenic
1174808077 20:53621903-53621925 CCGCAGGGTGCAGAGCACAGGGG + Intergenic
1176059922 20:63168062-63168084 CCACTGGCTGGAAAGGACAGAGG - Intergenic
1176105073 20:63382061-63382083 CCGCTGGGTGGTGAGGACCCCGG + Intergenic
1177941908 21:27421893-27421915 CCCATGGGAGGAGAGGGAAGAGG + Intergenic
1178923625 21:36757427-36757449 CCTCTGCCTGGAGAGGATAGTGG - Intronic
1179635069 21:42703552-42703574 TCGCTGGGAGCAGAGGAAAGAGG + Intronic
1180233823 21:46444265-46444287 GCTCTGGGTGGAGAGGGAAAAGG + Intronic
1180612891 22:17109128-17109150 CCGCTGGTCGGGGAGGAAGGAGG + Exonic
1182422148 22:30253867-30253889 CCACTGGGTGGGGAGGATGGAGG + Intergenic
1182902991 22:33914146-33914168 CTCCTGGGGGTAGAGGAAAGAGG - Intronic
1183074245 22:35416703-35416725 CCGCTGGGATGAGACGAAGGGGG + Exonic
1183214077 22:36467915-36467937 CACCTGGGTGGAGAGGACAAGGG + Exonic
1183261287 22:36797522-36797544 GCTCTGGGTGGAGAGGGGAGAGG + Intergenic
1183270695 22:36860932-36860954 CAGCTGGGAGGTGAGGTAAGAGG + Intergenic
1183324648 22:37184684-37184706 CCGCTGAGTGGAGTGGGAACAGG - Intronic
1183403517 22:37618583-37618605 CGGATGTGGGGAGAGGAAAGAGG + Intronic
1184142324 22:42585124-42585146 CCTCTGGGTGGAGACGACACGGG + Exonic
1184375205 22:44107626-44107648 CCTCTGGGTGGGGTGGAGAGGGG + Intronic
949980509 3:9499556-9499578 GCGCCGGGTGGAGAGGAGGGAGG - Exonic
950043411 3:9934191-9934213 GCATGGGGTGGAGAGGAAAGTGG - Intronic
950212148 3:11131687-11131709 TCGCTGGGTGGAGGGGACTGGGG - Intergenic
950954096 3:17032558-17032580 AGGCTGGGAGGAGAGGAAAAAGG - Intronic
951558551 3:23945002-23945024 CAGCCGGGAGGAGAGGAAAGAGG + Intronic
951640667 3:24830737-24830759 CCACTGAGAGAAGAGGAAAGAGG + Intergenic
952334495 3:32392505-32392527 GCGCTGGGTTCGGAGGAAAGAGG - Intronic
953759298 3:45674254-45674276 CCGTGGGGTGGGGAGGGAAGAGG - Intronic
953878676 3:46680539-46680561 CCTCTGGAAGGAGAGGAATGTGG + Exonic
954508436 3:51099556-51099578 CCTCTGTGAGGAGAGGAATGTGG + Intronic
955070082 3:55565407-55565429 CTGCTGGGAAGAGAGGAGAGAGG + Intronic
956766657 3:72490053-72490075 GCGCTGGGTCGAGAGGGCAGGGG - Intergenic
958254872 3:91314013-91314035 CCGGTGGGTGGACAGGAGAGCGG + Intergenic
961445296 3:126977830-126977852 CCACTGGGTGGAGAGGACATTGG - Intergenic
961457735 3:127032585-127032607 GAGCTGGGTGGAGAGGTAGGTGG + Exonic
961817131 3:129556865-129556887 CCTCTGGATGGAGAGGAGATTGG - Intronic
962021062 3:131502632-131502654 CCCCTGGGTGGAGGAGGAAGGGG - Intronic
962199288 3:133388442-133388464 CAGATGGTTGAAGAGGAAAGGGG - Intronic
963038310 3:141051185-141051207 CAGCTGGCGGGAGAGGGAAGTGG - Intergenic
963848149 3:150181039-150181061 CCGCTAGGTGGAAGGGACAGGGG - Intergenic
964423750 3:156531389-156531411 ACGCTGGGAGGAGAGGACACTGG - Exonic
965912445 3:173795907-173795929 CTGCTGGGTCAAGAGGACAGGGG + Intronic
966870768 3:184289341-184289363 CCCCTGGGTGGACAGGGATGGGG + Intronic
967773389 3:193359181-193359203 CTGGTTGGAGGAGAGGAAAGGGG - Intronic
968452257 4:681197-681219 CAGCTGGGTGGAGGGGGACGCGG + Intronic
968563111 4:1295491-1295513 CGCCTGGGAGGAGAGGAAGGAGG - Intronic
968727894 4:2256707-2256729 CCTCTGGGAGGAGAGGACAGAGG + Intronic
970349746 4:15190344-15190366 CCACAGGGTAGAGAGAAAAGAGG + Intergenic
971231050 4:24800368-24800390 CCTCTGGGTGGAGAGGGCTGCGG - Exonic
971838015 4:31794475-31794497 TAGTGGGGTGGAGAGGAAAGTGG - Intergenic
972644462 4:40954372-40954394 GCACGGGGTGGAGAGGAAAGAGG + Intronic
973090011 4:46124340-46124362 CCGAACGCTGGAGAGGAAAGAGG - Intergenic
976329062 4:83807410-83807432 GGGCTGGGAGGAGAGGAAAATGG - Intergenic
976775012 4:88698241-88698263 CCACTGCATGGAGAGGAATGCGG - Intronic
977176683 4:93827934-93827956 CCGCAGGGTGCTGGGGAAAGGGG + Intergenic
977697612 4:99983733-99983755 CCGTTGGTGGGAGAGCAAAGTGG - Intergenic
981434672 4:144706525-144706547 CTGCAGGGAGGAGATGAAAGAGG + Exonic
982204074 4:152983964-152983986 CCCCAGGGAGGAGAGGGAAGAGG + Intergenic
983879631 4:172918492-172918514 CAGCTGTTTGGAGAGGAAAAGGG - Intronic
984212320 4:176865346-176865368 TCAGTGGGTGCAGAGGAAAGAGG - Intergenic
985647808 5:1093330-1093352 CCGGACGGTGGAGAGGGAAGAGG + Intronic
986088599 5:4479164-4479186 CCTCTGGGAGGACAGGAGAGAGG - Intergenic
986344668 5:6823243-6823265 CCCCTGGCTGGAGAGGCAAATGG - Intergenic
990296361 5:54405695-54405717 AGGCTGAGTGGAAAGGAAAGTGG + Intergenic
992527918 5:77630006-77630028 CAGCTGGGTGGGAAGGGAAGAGG + Exonic
992776615 5:80094569-80094591 CCACTGCCTGGAGAGGATAGGGG + Intergenic
994276627 5:97846028-97846050 TCGGTGGGTGGAGAGGCTAGGGG - Intergenic
995458041 5:112372611-112372633 ATGGTGGGTGGAGGGGAAAGTGG + Intronic
996548880 5:124709220-124709242 CTTTGGGGTGGAGAGGAAAGGGG + Intronic
998584851 5:143416594-143416616 CAGCTGGCTGAAGAGGAAGGAGG - Intronic
999098364 5:149002046-149002068 CCGGTGGGTGAAGAGTACAGAGG - Intronic
1002297033 5:178237532-178237554 CTGCTGGGTGGGGAGGGAAAAGG - Intergenic
1002417423 5:179127781-179127803 CCGGTGGGTGGGCAGGAAGGGGG - Intronic
1002772961 6:304848-304870 GGGCTGGGAGGAGAGGAATGGGG - Intronic
1003034153 6:2628488-2628510 CCGAGGGAAGGAGAGGAAAGTGG + Intronic
1003034169 6:2628542-2628564 CCGGGGGAAGGAGAGGAAAGTGG + Intronic
1003346276 6:5270827-5270849 CCCCAGGGTAGAGGGGAAAGAGG - Intronic
1004505869 6:16246258-16246280 CAGCTGGGTGGGGAGGTCAGGGG - Intronic
1004845661 6:19639046-19639068 CCGCTGGGTGGCCAGGACATGGG - Intergenic
1005108946 6:22257231-22257253 ACGCTAGGTGGAGGGGAAAAAGG - Intergenic
1007260366 6:40559140-40559162 CCGCTGGGTGGGGGTGAGAGAGG + Intronic
1007726034 6:43916139-43916161 CATCTGGGTGAAGAGGAAAGGGG + Intergenic
1009000487 6:57707064-57707086 CCGGTGGGTGGACGGGAGAGTGG - Intergenic
1009188952 6:60606491-60606513 CCGGTGGGTGGACAGGAGAGTGG - Intergenic
1009624282 6:66118461-66118483 CCAAAGGGTGGAAAGGAAAGCGG + Intergenic
1010364550 6:75034111-75034133 CTGCTGGATGGAGATGAAGGTGG + Intergenic
1013575877 6:111483227-111483249 CCACTGGGGGGAGGGGAGAGGGG + Exonic
1014805050 6:125820115-125820137 AGGCTGGGTTAAGAGGAAAGCGG - Intronic
1015758483 6:136632149-136632171 CCACAGAGTGGAAAGGAAAGGGG + Intronic
1017597253 6:156043023-156043045 CCAGTGTGTGGAGTGGAAAGAGG - Intergenic
1017884722 6:158589176-158589198 GAGCAGGATGGAGAGGAAAGAGG + Intronic
1017889029 6:158624407-158624429 GCGCTGAGAGGACAGGAAAGGGG + Intronic
1017956428 6:159181958-159181980 TTGATGGGTGGAGTGGAAAGTGG - Intronic
1018034783 6:159872807-159872829 GGGCTGGGTGGAGGGGAAATGGG + Intergenic
1018887117 6:167948995-167949017 ACCCTGGGTAGAGGGGAAAGGGG + Intronic
1019297315 7:285047-285069 CAGCTGGGTGCAGAGCAAAGGGG - Intergenic
1021517243 7:21502362-21502384 CCCCTGCCTGGAGAGGCAAGAGG + Intronic
1022024195 7:26430590-26430612 CTTAGGGGTGGAGAGGAAAGAGG - Intergenic
1022036220 7:26537362-26537384 CTGCATGGTGGAGTGGAAAGGGG + Intronic
1022540871 7:31134564-31134586 CCGCCGGGAGGAGAGGAATGAGG - Intergenic
1024342906 7:48285228-48285250 CTGAAGGGAGGAGAGGAAAGGGG + Intronic
1025259114 7:57405259-57405281 GCTCTGGCTGGAGAGAAAAGAGG - Intergenic
1025279978 7:57619979-57620001 TCGCTTGGTGAAGAGGAGAGTGG + Intergenic
1025304756 7:57845522-57845544 TCGCTTGGTGAAGAGGAGAGTGG - Intergenic
1025609738 7:63067895-63067917 GCTCTGGCTGGAGAGAAAAGAGG + Intergenic
1025710237 7:63901302-63901324 GCTCTGGCTGGAGAGAAAAGAGG - Intergenic
1026737810 7:72960152-72960174 CCGCTGCCTGGAGGGGATAGGGG - Exonic
1026788845 7:73318953-73318975 CCGCTGCCTGGAGGGGATAGGGG - Exonic
1026928520 7:74210153-74210175 CCACTGGGTGGGGTGGGAAGAGG + Intronic
1026968636 7:74454855-74454877 CAGATGGGTGGAGAGGACAGAGG + Intronic
1027105924 7:75404916-75404938 CCGCTGCCTGGAGGGGATAGGGG + Exonic
1027180321 7:75934933-75934955 CCTCTGGTAGGAGAGGAATGTGG + Intronic
1027697454 7:81430012-81430034 AGGCTGGGTGGAGTGGAAGGAGG + Intergenic
1028990538 7:97044543-97044565 GGGCTGGGTTGAGAAGAAAGAGG + Intergenic
1029128701 7:98313461-98313483 TCGCAGGCTGGAGAGGACAGAGG - Intronic
1029364511 7:100108124-100108146 CTGCGGGGAGAAGAGGAAAGGGG + Intronic
1029686117 7:102149371-102149393 CCACTGGGTAGACAGGAAGGGGG + Intronic
1029714587 7:102319004-102319026 CAGCTGGGTAGAGAGGTGAGAGG - Intronic
1033577761 7:142702494-142702516 GCCCTGGGTGTAGTGGAAAGTGG + Intergenic
1034275056 7:149820338-149820360 CCTCTGGGTGGACACAAAAGAGG + Intergenic
1034535945 7:151725807-151725829 CCACTGGTGGGAGAAGAAAGAGG + Intronic
1034644554 7:152633602-152633624 CCGCGGTGTGGAGAGGCAGGGGG + Intergenic
1034713849 7:153220998-153221020 AAGCAGGCTGGAGAGGAAAGAGG - Intergenic
1034770318 7:153767908-153767930 CACCTGGGTGGTGAAGAAAGTGG + Intergenic
1034821631 7:154221520-154221542 AGGCTGGGTGGGGAGGAGAGGGG - Intronic
1034892432 7:154853012-154853034 CCGGTGAGTGCAGAGGACAGTGG + Intronic
1035251166 7:157598188-157598210 TCGCTGGGTGGGGAAGACAGAGG - Intronic
1035865750 8:3079892-3079914 GAGCTGGGTGGAGGGGACAGAGG - Intronic
1035954511 8:4061216-4061238 CTGCTGATTAGAGAGGAAAGAGG + Intronic
1037798578 8:22017793-22017815 GCACTGGGAGGAGAGGAAAACGG + Intergenic
1037928060 8:22860383-22860405 GAGCTGGGGGGAGAGGGAAGAGG - Intronic
1038959099 8:32498952-32498974 CAGCTGGGTAGAGATGAAGGAGG - Intronic
1039469065 8:37802532-37802554 CCCCTGGGTGGGGAGGGGAGTGG - Intronic
1039473267 8:37826714-37826736 CCGCTGGGAGGAGAGGAAATGGG - Intronic
1039612822 8:38932773-38932795 CCCCTGGATGGGGAGGAAGGTGG + Intronic
1042500240 8:69500813-69500835 CTGCTGTTTGGAGTGGAAAGAGG + Intronic
1046509583 8:115185091-115185113 ATGCTGGGAGGAGAGGAAAATGG - Intergenic
1047158287 8:122347036-122347058 GGGCTGGGAGGAGAGGAAAGAGG + Intergenic
1047224905 8:122948002-122948024 CAGTGGGGTGGAGAGGACAGGGG - Intronic
1047464604 8:125100099-125100121 CTGATAGGTGGAGAGGTAAGCGG + Intronic
1047538030 8:125737067-125737089 CAGGTGGGTGGTGAGGAAGGTGG + Intergenic
1047955694 8:129973609-129973631 CTGCTGAGAGGAGACGAAAGAGG - Intronic
1048971298 8:139646249-139646271 CAGCTGGTTGGAGAGGAAGGTGG - Intronic
1051419067 9:16871822-16871844 CCTCGGGCTGGAGAGGAAGGAGG + Intergenic
1052686786 9:31766657-31766679 CCACTGGTGGTAGAGGAAAGAGG + Intergenic
1053142739 9:35691145-35691167 CCGCCGGGAGGAGGGGGAAGGGG + Intergenic
1053312432 9:37027954-37027976 CGGCTGTGGGGAGGGGAAAGGGG + Intronic
1053463498 9:38288571-38288593 CCACAGGGTGCAGGGGAAAGGGG + Intergenic
1053529671 9:38867711-38867733 TTGCTGGGTGGAGAGGGAAAAGG + Intergenic
1054201896 9:62092138-62092160 TTGCTGGGTGGAGAGGGAAAAGG + Intergenic
1054636461 9:67496221-67496243 TTGCTGGGTGGAGAGGGAAAAGG - Intergenic
1054731305 9:68705148-68705170 CAAGTGGGTGGAGAGAAAAGGGG + Intergenic
1055467681 9:76581960-76581982 CAGCTGTGGGGAGAGGCAAGGGG + Intergenic
1055555574 9:77470184-77470206 CCTCTGGGTGGGGAGGACTGGGG + Intronic
1057068407 9:92075489-92075511 TTGCTGTGTGGAGAGGAAGGAGG - Intronic
1057745235 9:97745859-97745881 CTAGTGGGTGAAGAGGAAAGAGG - Intergenic
1057869983 9:98709684-98709706 CCGTCTGGTGGGGAGGAAAGGGG - Intergenic
1059302346 9:113324203-113324225 CGGCTGCGGGGAGAGGAAAATGG - Intronic
1059341619 9:113600669-113600691 GTGGTGGGTGGAGAGGCAAGAGG + Intergenic
1059465354 9:114465970-114465992 ACGATGCGTGGAGAGGATAGAGG - Intronic
1060141129 9:121211158-121211180 CCCCTGGGGGTAGAGGAATGGGG + Intronic
1060836029 9:126755728-126755750 ACGGTGGGTGGAGGTGAAAGGGG - Intergenic
1060967031 9:127717220-127717242 GAGCTGGGTGGAGAGGCAGGAGG - Intronic
1061879188 9:133560233-133560255 CCTCTGGGCCCAGAGGAAAGTGG + Intronic
1186685471 X:11920791-11920813 CAGCTGGGCCCAGAGGAAAGAGG - Intergenic
1189578040 X:42375973-42375995 CCACTGGCTGGAGAGCAAGGTGG + Intergenic
1189957159 X:46287648-46287670 CCCCTGTGTGGAGAGGACTGGGG + Intergenic
1191179106 X:57540510-57540532 CTGCTTGGTGGAGAGTCAAGAGG + Intergenic
1193908453 X:87271700-87271722 GTGCAGGGAGGAGAGGAAAGTGG + Intergenic
1194307860 X:92270626-92270648 GAGCTGGCTGGAGGGGAAAGAGG + Intronic
1194875903 X:99187527-99187549 GCGCAGGGAGGAGAGGAGAGAGG - Intergenic
1195280689 X:103330125-103330147 CTGCTGGTGGGAGGGGAAAGTGG + Intergenic
1197199076 X:123733138-123733160 CCGCTGGGTGGAGAGGAAAGTGG - Intergenic
1198107292 X:133473848-133473870 CCTTTAGGTGGAGAGTAAAGTGG + Intergenic
1199793283 X:151174717-151174739 CAGCTGTGTGGGGAGGACAGCGG + Intergenic