ID: 1197199078

View in Genome Browser
Species Human (GRCh38)
Location X:123733145-123733167
Sequence CGGGTTTCCGCTGGGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199078_1197199086 0 Left 1197199078 X:123733145-123733167 CCTCTCCACCCAGCGGAAACCCG 0: 1
1: 0
2: 0
3: 12
4: 249
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199078_1197199090 24 Left 1197199078 X:123733145-123733167 CCTCTCCACCCAGCGGAAACCCG 0: 1
1: 0
2: 0
3: 12
4: 249
Right 1197199090 X:123733192-123733214 GACTCGCGGGCCCCTTTGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1197199078_1197199089 11 Left 1197199078 X:123733145-123733167 CCTCTCCACCCAGCGGAAACCCG 0: 1
1: 0
2: 0
3: 12
4: 249
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199078_1197199087 10 Left 1197199078 X:123733145-123733167 CCTCTCCACCCAGCGGAAACCCG 0: 1
1: 0
2: 0
3: 12
4: 249
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199078 Original CRISPR CGGGTTTCCGCTGGGTGGAG AGG (reversed) Intergenic
902747237 1:18482135-18482157 CGGGTCTGGGCAGGGTGGAGCGG - Exonic
903098913 1:21009938-21009960 CAGTTTTCAGCTGGGTGGGGTGG - Intronic
903299332 1:22367131-22367153 GGGGTTTGGGCTGGGTGCAGTGG - Intergenic
904563453 1:31413540-31413562 CGGGTTTCCGCGGGCAGGAGGGG + Intronic
905218550 1:36427602-36427624 AGGCTTTCAGCTGGGTGCAGTGG - Intronic
912955667 1:114153022-114153044 CGCGTCTCCGCTGGGGGGCGGGG - Intronic
914826334 1:151140144-151140166 TGGGTTTCATCTGGTTGGAGAGG - Intronic
915213138 1:154324795-154324817 CGGGCATCTGCAGGGTGGAGGGG + Exonic
915322529 1:155063635-155063657 GGAGTTGGCGCTGGGTGGAGAGG + Intergenic
915328084 1:155091673-155091695 TGGGTTTGCGGTCGGTGGAGCGG + Intergenic
915335192 1:155136812-155136834 CAGGTTGCTGCAGGGTGGAGGGG - Exonic
916218511 1:162419902-162419924 CGGGTACCCTCTGGGTGGTGTGG + Intergenic
916827617 1:168457686-168457708 GGGGTACCCGCTGGGTGGTGTGG + Intergenic
923267971 1:232332016-232332038 GGGGTGGCTGCTGGGTGGAGGGG - Intergenic
924803279 1:247343455-247343477 CAGTTTTCCGCTGGGTGCGGTGG - Intergenic
924806952 1:247369030-247369052 CTGGTTTCCACTGGCTGGAGCGG + Intergenic
1063026989 10:2189574-2189596 CGGGTTTCCATTGGCTGGAATGG - Intergenic
1063471646 10:6292239-6292261 CTGGTTTCGGCTGGGTGCTGTGG - Intergenic
1065503807 10:26409253-26409275 CCTGTTTCCTCAGGGTGGAGAGG - Intergenic
1068986315 10:63110634-63110656 TGGTTTTCGGCTGGGTGCAGTGG - Intergenic
1069365649 10:67691683-67691705 GGGGTGGCTGCTGGGTGGAGGGG - Intronic
1071534114 10:86413723-86413745 GGGGTCTCCGCCGGGTGCAGTGG + Intergenic
1074004060 10:109401371-109401393 CAGGTGTCCACTGGGTGGAAAGG - Intergenic
1075654454 10:124152102-124152124 CTGGCTTCCGCTGGGCGGTGGGG + Intergenic
1076345639 10:129777272-129777294 GGGGTCTGCGCTGTGTGGAGGGG - Intergenic
1083539148 11:63499953-63499975 CCGGTTTCCACTGGCTGGAACGG - Intergenic
1084369107 11:68726788-68726810 AGGGTTTGGGCTGGGTGCAGTGG + Intronic
1084937700 11:72595863-72595885 AGGGTTTCTGCTCCGTGGAGGGG - Intronic
1085353383 11:75815178-75815200 CGGGTCTCAGCGGGGTGGAGGGG + Exonic
1088102834 11:106173997-106174019 CCGGTTTCCACTGGCTGGAACGG + Intergenic
1091696959 12:2634060-2634082 CTGGTTTTCGCAGGGTGCAGAGG - Intronic
1091963610 12:4720025-4720047 GGGGTATCCGCTGGGTGGTGTGG - Intronic
1092492458 12:8957753-8957775 CGTGTTTCCACTGGATGAAGGGG + Intronic
1092630589 12:10372049-10372071 CCGGTTTCCACTGGCTGGAACGG - Intergenic
1096640368 12:52989550-52989572 CAGGTTTAGGCTGGGTGCAGTGG + Intergenic
1099255547 12:80308211-80308233 GGGGTGGCTGCTGGGTGGAGGGG + Intronic
1099554301 12:84091715-84091737 GGGGTTTCCACTTGGTGAAGTGG - Intergenic
1100312746 12:93412642-93412664 CCGGTTTCCACTGGCTGGAACGG + Intronic
1100571976 12:95851566-95851588 CGGGTTGCCTATGGGTGTAGTGG - Intergenic
1101911588 12:108864007-108864029 AGGGTCTCAGCTGGGTGCAGTGG + Intronic
1102049275 12:109850586-109850608 TGGGTTTCGGCAGGGTGCAGTGG - Intergenic
1103337574 12:120201253-120201275 CGGCTTTCCGTTGGCTGGAGTGG - Intergenic
1103414058 12:120732390-120732412 GGGGTGTCTGCTGGGCGGAGGGG + Intronic
1103642113 12:122359843-122359865 CAGGTCTCCGCTGGGTGGTGGGG - Intronic
1105243549 13:18628434-18628456 CGGGTCTCCGCGGGTTGGACGGG - Intergenic
1107247915 13:38319739-38319761 GGGGTACCCGCTGGGTGGTGTGG - Intergenic
1107841509 13:44462032-44462054 AGGGTTTCTGCTGGAGGGAGAGG + Intronic
1108642850 13:52398527-52398549 CTGTTTTCTGCTGGGTGCAGTGG - Intronic
1110859948 13:80337468-80337490 CGTGTTTGTGCTGAGTGGAGGGG + Exonic
1111848023 13:93536063-93536085 AGAGTTTCCCCTGGGTGGTGTGG + Intronic
1113520301 13:110935959-110935981 CTGGTTTCAGCTGGGTGCGGTGG - Intergenic
1114055984 14:18967313-18967335 TGGGTTTTCCCTGGGTGGGGTGG + Intergenic
1114106565 14:19434440-19434462 TGGGTTTTCCCTGGGTGGGGTGG - Intergenic
1115953044 14:38743314-38743336 AGGGTTTCTTCTGGGTAGAGGGG + Intergenic
1119995250 14:79246471-79246493 CTGGATTCCACTGGATGGAGAGG - Intronic
1123499377 15:20866436-20866458 TGGGTTTTCCCTGGGTGGGGTGG - Intergenic
1123556629 15:21440166-21440188 TGGGTTTTCCCTGGGTGGGGTGG - Exonic
1123592851 15:21877401-21877423 TGGGTTTTCCCTGGGTGGGGTGG - Intergenic
1124322773 15:28727221-28727243 TGGGTTTCCGCCGGGCGCAGTGG - Intronic
1125546148 15:40507174-40507196 CGGGTTTCCACCGCTTGGAGGGG - Intergenic
1126191873 15:45886584-45886606 CGGGTTGCCGCTGGGGGGTAAGG - Intergenic
1128307469 15:66609099-66609121 CTGGTTTGTGATGGGTGGAGAGG + Intronic
1128740128 15:70078070-70078092 CGGGTGTCTAGTGGGTGGAGAGG - Intronic
1130380296 15:83366231-83366253 CGGGTTTTTGGTGGGGGGAGGGG - Intergenic
1202952593 15_KI270727v1_random:52546-52568 CGGGTCTCCGCCTGGTGGACGGG + Intergenic
1202964968 15_KI270727v1_random:167355-167377 TGGGTTTTCCCTGGGTGGGGTGG - Intergenic
1133205393 16:4230287-4230309 TGGTCTTCCACTGGGTGGAGGGG - Intronic
1135229689 16:20694222-20694244 CCGGTTTCCACTGGCTGGAACGG - Intronic
1135810014 16:25578468-25578490 CTGGTTTCCGTTGGCTGGAATGG + Intergenic
1136638857 16:31544820-31544842 CTGGTTTCCACTGGCTGGAATGG - Intergenic
1136919037 16:34246030-34246052 GGGGTGGCTGCTGGGTGGAGGGG + Intergenic
1139394759 16:66631089-66631111 GGGGTGGCTGCTGGGTGGAGGGG - Intronic
1139969642 16:70765766-70765788 CAGGTATCCCCTGGGTGCAGAGG - Intronic
1142204195 16:88775016-88775038 TGGGTGTCTGCTGGATGGAGTGG - Intronic
1142811533 17:2397742-2397764 AGGGTTGCCGCTGGGTGGGAAGG - Intronic
1143112337 17:4559604-4559626 GGAGTGTCCGCCGGGTGGAGGGG + Exonic
1144454905 17:15410876-15410898 AGGTTTACGGCTGGGTGGAGTGG + Intergenic
1144646819 17:16980809-16980831 TTGGGTTCTGCTGGGTGGAGGGG + Intergenic
1145925524 17:28644377-28644399 CTGGTTTCATCTGGGTGGAGGGG - Intronic
1146529602 17:33597141-33597163 CAGGTGTCCGCTGGGTTGATGGG - Intronic
1146533927 17:33633490-33633512 CCTGTTTCTGCTGGGTCGAGGGG + Intronic
1147023675 17:37560950-37560972 CGTGTTTAGGCTGGGTGCAGTGG - Intronic
1149105729 17:52962032-52962054 GGGGTACCCGCTGGGTGGTGTGG + Intergenic
1149668484 17:58383588-58383610 TGGGCTTCAGCTGGGTGCAGTGG - Intronic
1151235081 17:72714047-72714069 TGGGTTTTGGCTGGGTGCAGTGG + Intronic
1152036066 17:77874026-77874048 CGGGTTTGAGCAGGGTGGAGGGG - Intergenic
1152388858 17:79991405-79991427 TGGGTGTCTGGTGGGTGGAGAGG - Intronic
1152875312 17:82783078-82783100 AGGCTGTCAGCTGGGTGGAGGGG + Intronic
1153886792 18:9474976-9474998 CGGCTGGCCGCTGGGTGGGGCGG - Intergenic
1154457436 18:14543301-14543323 TGGGTTTTCCCTGGGTGGGGTGG - Intronic
1155574642 18:27231435-27231457 CTGGTTTCCACTGGCTGGAATGG + Intergenic
1158283037 18:55848852-55848874 CTGCTTTCGGCTGGGTGCAGTGG + Intergenic
1160745654 19:709696-709718 CGAGTTACCGCTGGAGGGAGAGG + Intronic
1161101863 19:2425460-2425482 CGGCTTCCCGCAGGGTGGCGTGG + Exonic
1161349246 19:3783288-3783310 CGGGTGGCCTCTGGGTGGGGTGG + Intronic
1161474358 19:4475813-4475835 CCAGTGTCCCCTGGGTGGAGGGG + Intronic
1161973002 19:7593823-7593845 CCTGTTTCTGCTGGGTGCAGTGG - Intergenic
1162226422 19:9226370-9226392 CCGGTTTCCACTGGCTGGAACGG + Intergenic
1162819244 19:13212641-13212663 CTGGGTCCAGCTGGGTGGAGGGG + Exonic
1163019659 19:14475411-14475433 CGGGCGTGCGCGGGGTGGAGCGG - Intergenic
1163390453 19:17027114-17027136 CGAGTGGACGCTGGGTGGAGAGG - Intergenic
1165118260 19:33542363-33542385 AGGTTTTCTGCTGGGTGCAGTGG + Intergenic
1165469238 19:35994005-35994027 CGGTTGCGCGCTGGGTGGAGGGG + Intergenic
1165511847 19:36270709-36270731 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165512399 19:36273210-36273232 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165512946 19:36275751-36275773 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165513502 19:36278306-36278328 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165514052 19:36280840-36280862 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165514604 19:36283377-36283399 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165515156 19:36285910-36285932 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165515706 19:36288446-36288468 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165516257 19:36290983-36291005 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165516809 19:36293509-36293531 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165517362 19:36296032-36296054 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165517914 19:36298567-36298589 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165518465 19:36301102-36301124 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165519014 19:36303634-36303656 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165519564 19:36306149-36306171 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
1165623954 19:37269904-37269926 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165624500 19:37272445-37272467 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165625043 19:37274972-37274994 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165625577 19:37277510-37277532 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165626117 19:37280035-37280057 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165626658 19:37282562-37282584 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165627198 19:37285083-37285105 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165627739 19:37287611-37287633 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165628277 19:37290135-37290157 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165628817 19:37292660-37292682 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165629359 19:37295186-37295208 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165629900 19:37297711-37297733 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165630443 19:37300239-37300261 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1165630980 19:37302777-37302799 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
1167319500 19:48787553-48787575 CGGGTTTCCATTGGCTGGAACGG + Intergenic
1168617537 19:57850609-57850631 GGGGTATCTGCTGGGTGGTGTGG - Intronic
926005851 2:9373100-9373122 CGGGTTAGCGCTGTGTGGACGGG + Intronic
929062035 2:37932980-37933002 GGGGTGGCTGCTGGGTGGAGGGG + Intronic
929990634 2:46783399-46783421 AGGGTTTCCCTGGGGTGGAGAGG - Intergenic
933419858 2:82031240-82031262 AGGGTACCCACTGGGTGGAGTGG + Intergenic
933768157 2:85725152-85725174 TGGGTCTCAGCTGGGTGGGGAGG + Intergenic
937198895 2:120184163-120184185 CTGGTTTCCCCTGGGCTGAGAGG + Intergenic
938133820 2:128737578-128737600 AGGGTTTCCGCCGGGAGCAGGGG + Intergenic
938286326 2:130120675-130120697 TGGGTTTTCCCTGGGTGGGGTGG - Intronic
938336965 2:130509390-130509412 TGGGTTTTCCCTGGGTGGGGTGG - Exonic
938352876 2:130611356-130611378 TGGGTTTTCCCTGGGTGGGGTGG + Intergenic
938429281 2:131218221-131218243 TGGGTTTTCCCTGGGTGGGGTGG + Exonic
939377305 2:141385046-141385068 GGGGTACCCGCTGGGTGGTGTGG + Intronic
942557294 2:177185007-177185029 CTGGTTTTAGCTGGGTGCAGTGG - Intergenic
942830993 2:180237398-180237420 CGGGTACCCGCTGGGTGGTGTGG + Intergenic
943833211 2:192487908-192487930 GGGGTACCCGCTGGGTGGTGTGG + Intergenic
944691033 2:202158647-202158669 CTGGTCTCAGCTGGGTGCAGTGG - Intronic
945768883 2:214015309-214015331 CTGGTTTCGGCTGGGTGCAGTGG + Intronic
946410009 2:219511094-219511116 AGGGTGTCCTCTGGGTGCAGGGG + Intergenic
946564033 2:220943404-220943426 GGGGTTTTGGCTGGGTGCAGTGG + Intergenic
948960305 2:241329717-241329739 CTGGTTTCCACTGGCTGGAACGG + Intronic
1169474318 20:5917243-5917265 CGGACTTCCTTTGGGTGGAGGGG + Intronic
1171173266 20:23034108-23034130 CAGCTTTCCGCTGGGTGGCTGGG - Intergenic
1171524657 20:25799425-25799447 GGGGTTGCGGCTGGGTGCAGGGG - Intronic
1171552170 20:26056458-26056480 GGGGTTGCGGCTGGGTGCAGGGG + Intergenic
1172178740 20:32987809-32987831 CGGGCTTCTGCCTGGTGGAGGGG + Intronic
1174696130 20:52560743-52560765 TGGGTTTTCCCTGGGTGGAATGG + Intergenic
1175866986 20:62184069-62184091 CAGGTTTCCGCTGGGCGCGGTGG + Intronic
1176450591 21:6858412-6858434 CGGGTCTCCGCGGGTTGGACGGG - Intergenic
1176816721 21:13610052-13610074 TGGGTTTTCCCTGGGTGGGGTGG + Intronic
1176828761 21:13723430-13723452 CGGGTCTCCGCGGGTTGGACGGG - Intergenic
1178887597 21:36496141-36496163 AGGGTTTCTGCCGGGTGCAGTGG + Intronic
1179016317 21:37596894-37596916 CCGGTTTCCACTGGCTGGAAGGG - Intergenic
1180168088 21:46040437-46040459 CGTGTCCCCGCTGGGTGGGGAGG - Intergenic
1180474463 22:15689905-15689927 TGGGTTTTCCCTGGGTGGGGTGG + Intergenic
1181761592 22:25062459-25062481 GGGGCTTCCGCTGGATGGGGTGG - Intronic
1182380381 22:29883070-29883092 CGGGTCTCCGCCGGTTGGACGGG - Intergenic
1182768811 22:32778666-32778688 AGGGTTTACGCTGAGTGAAGCGG + Intronic
1184347070 22:43920198-43920220 AGGTTATCCGCTGGGCGGAGTGG - Intergenic
1184378141 22:44128068-44128090 AGGGATTCGGCTGGGTGTAGTGG - Intronic
1184723881 22:46331960-46331982 CTGTTTTCTGCTGGGTGCAGCGG + Intronic
949974752 3:9445998-9446020 CTGGTTTCCGCTGGGCGCGGTGG + Intronic
950378352 3:12590611-12590633 CAGGTTCCAGCTGGGTGGGGTGG - Intronic
951779567 3:26347335-26347357 CTGGTTTCGGCTGGGCGCAGTGG - Intergenic
953723166 3:45374038-45374060 CTGGTTTCCACTGGCTGGAGCGG - Intergenic
954067020 3:48114938-48114960 CTGGTTTCCACTGGCTGGAACGG - Intergenic
961219886 3:125191472-125191494 CGGTTCTCAGCTGGGTGGGGTGG + Intronic
961450686 3:127001067-127001089 CGGCATGCTGCTGGGTGGAGCGG + Intronic
961664229 3:128486298-128486320 CGGGTTTGCCCTGGCTGGACGGG - Exonic
961828316 3:129610413-129610435 CAGGGTTGCGCTGGGAGGAGGGG + Intergenic
961965189 3:130894405-130894427 CGGGTATCCCCTGGATGGGGGGG + Intronic
962542221 3:136394191-136394213 CATGTTTCAGCTGGGTGCAGTGG - Intronic
966211640 3:177459472-177459494 CTGGATTCGTCTGGGTGGAGAGG + Intergenic
966351012 3:179032793-179032815 GGGGTGGCTGCTGGGTGGAGGGG - Intronic
968118741 3:196109599-196109621 CTGGCTTCGGCTGGGTGCAGTGG + Intergenic
968452255 4:681190-681212 CCGGGGTCAGCTGGGTGGAGGGG + Intronic
970766602 4:19556645-19556667 GGGGTACCCGCTGGGTGGTGTGG + Intergenic
971196014 4:24472101-24472123 CGGGTTCCCGCTGGGCTGGGAGG + Intergenic
971978183 4:33718394-33718416 CAGGTTTTGGCTGGGTGCAGTGG + Intergenic
973756578 4:54080476-54080498 GGGGTCTCGGCTGGGTGCAGTGG + Intronic
975222804 4:71832918-71832940 AGTGTTTCAGCTGGGTGCAGTGG - Intergenic
976561853 4:86511194-86511216 CAGGTTTCGGCTGGGTGTGGTGG + Intronic
979126610 4:116980768-116980790 GGGGTACCCGCTGGGTGGTGTGG + Intergenic
980354368 4:131724148-131724170 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980354906 4:131726654-131726676 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980355446 4:131729131-131729153 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980355992 4:131731632-131731654 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980356524 4:131734120-131734142 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980357062 4:131736608-131736630 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980358143 4:131741589-131741611 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980358673 4:131744083-131744105 TGGGTTTTTGCTGGGTGCAGCGG + Intergenic
980359215 4:131746556-131746578 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980359757 4:131749024-131749046 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980360297 4:131751519-131751541 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980360837 4:131753991-131754013 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980361920 4:131758946-131758968 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980362463 4:131761429-131761451 TGGGTTTTGGCTGGGTGCAGCGG + Intergenic
980363007 4:131763912-131763934 TGGGTTTTGGCTGGGTGCAGGGG + Intergenic
980378282 4:131977080-131977102 TGGGTTTTGGCTGGGTGCAGGGG - Intergenic
983327434 4:166274586-166274608 GGGGTACCCGCTGGGTGGTGTGG + Intergenic
984260133 4:177435196-177435218 CAGTTTTCAGCTGGGTGCAGTGG - Intronic
984904965 4:184618112-184618134 CTGGTTTTGGCTGGGTGCAGTGG + Intergenic
986048765 5:4067258-4067280 CTGGTTCTCGCTGTGTGGAGGGG - Intergenic
987084168 5:14453738-14453760 CGGGTTTCCCCAGGCTGGAAAGG + Intronic
992707500 5:79411829-79411851 CAGGGTGCAGCTGGGTGGAGTGG + Intronic
992902700 5:81314965-81314987 GGGGATTCAGCTGGGTGTAGTGG - Intergenic
993202515 5:84834416-84834438 CCGGTTTCCACTGGCTGGAACGG - Intergenic
994917457 5:105998980-105999002 AGGGTACCCGCTGGGTGGTGTGG - Intergenic
995416052 5:111914546-111914568 CCGGTTTCCACTGGCTGGAACGG - Intronic
998859961 5:146432898-146432920 CCGGTTTCCACTGGCTGGAACGG + Intergenic
1001461965 5:171924207-171924229 GGGGTTTTGGCTGGGTGCAGTGG - Intronic
1003475589 6:6479192-6479214 CCGGTTTCCACTGGCTGGAACGG + Intergenic
1003529890 6:6928621-6928643 CGGGCTTCTGCTGTGAGGAGGGG - Intergenic
1005592660 6:27344728-27344750 CTGGTTTCAGCTGGGTGCATTGG - Intergenic
1006412244 6:33880924-33880946 CCGGTTTCCACTGGCTGGAACGG - Intergenic
1006937629 6:37729308-37729330 TGGGTTTCAGCTGGGGGCAGTGG + Intergenic
1007306027 6:40905655-40905677 GAGGTTTCCCCTGAGTGGAGTGG + Intergenic
1008660850 6:53665884-53665906 CGGGGCTCCGGTTGGTGGAGAGG + Intergenic
1010974613 6:82297929-82297951 GGGGTACCCGCTGGGTGGTGTGG - Intergenic
1018037987 6:159898177-159898199 CGTGTTTAGGCTGGGTGGAGTGG - Intergenic
1019727166 7:2609430-2609452 AGCGTTTCTGCTGGGTGCAGTGG - Intronic
1023957993 7:44903099-44903121 CGGGGTTCCGCTGTGTTGACCGG + Intergenic
1027377353 7:77565041-77565063 CGAGTTTCAGCTGGGTGCGGTGG - Intronic
1029408654 7:100393917-100393939 CGGGGATCGGCTGTGTGGAGAGG - Intronic
1031592332 7:123609131-123609153 CAGGTTTCGGCTGTGTGGAATGG - Intronic
1032075188 7:128832695-128832717 CTGGTTCCCGCTGGGAGGAAGGG + Intronic
1034512635 7:151548873-151548895 AGGGTTCCCACTGGGAGGAGAGG + Intergenic
1038494034 8:27989413-27989435 GGGGCTTCAGCTGGGTGCAGTGG - Intronic
1039088834 8:33806511-33806533 CTGGTTTCCCCTGGGTTGACAGG + Intergenic
1039473271 8:37826721-37826743 CGGCTGCCCGCTGGGAGGAGAGG - Intronic
1042039522 8:64577548-64577570 CTGGTTTCGGCCGGGCGGAGGGG - Intergenic
1045864777 8:106852423-106852445 TGGGTTTCGGGTGGGTGCAGTGG - Intergenic
1047782137 8:128118942-128118964 GGGGTGGCTGCTGGGTGGAGGGG + Intergenic
1049399417 8:142418276-142418298 CGCGGCTCCCCTGGGTGGAGCGG + Intergenic
1053003895 9:34591958-34591980 CGGGTGGCGGCTGTGTGGAGAGG - Intergenic
1057312731 9:93952096-93952118 CGGGTTTCCGCCGAGTGAGGGGG + Exonic
1059122162 9:111650781-111650803 CAGGTTTTGGCTGGGTGCAGTGG - Intronic
1059231192 9:112722997-112723019 AGGGTTTTCGCTGGGTACAGTGG + Intergenic
1061134479 9:128725281-128725303 CGTCTTTACGCTGGGCGGAGAGG + Intergenic
1062121049 9:134834191-134834213 CTGGTTTCCCCTGAGTAGAGGGG - Intronic
1062313650 9:135954167-135954189 AGGGCTTCAGCTGGGTGCAGTGG + Intronic
1203518591 Un_GL000213v1:26105-26127 CGGGTCTCCGCGGGTTGGACGGG + Intergenic
1203530640 Un_GL000213v1:139442-139464 TGGGTTTTCCCTGGGTGGGGTGG - Intergenic
1189784303 X:44545546-44545568 CCGGTTTCCACTGGCTGGAACGG + Intergenic
1194369302 X:93051208-93051230 CTGGTTTCCGTTGGCTGGAATGG + Intergenic
1197199078 X:123733145-123733167 CGGGTTTCCGCTGGGTGGAGAGG - Intergenic
1197692084 X:129513235-129513257 CTGGTATCGGCTGGGTGCAGTGG + Intronic
1199234452 X:145474870-145474892 CCGGTTTCCGTTGGCTGGAACGG + Intergenic
1200762444 Y:7052600-7052622 CCGGTTTCCACTGGCTGGAATGG + Intronic