ID: 1197199080

View in Genome Browser
Species Human (GRCh38)
Location X:123733150-123733172
Sequence TGCCTCGGGTTTCCGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199080_1197199093 30 Left 1197199080 X:123733150-123733172 CCACCCAGCGGAAACCCGAGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1197199093 X:123733203-123733225 CCCTTTGCGAGGTTACTACACGG 0: 1
1: 0
2: 0
3: 4
4: 37
1197199080_1197199086 -5 Left 1197199080 X:123733150-123733172 CCACCCAGCGGAAACCCGAGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199080_1197199090 19 Left 1197199080 X:123733150-123733172 CCACCCAGCGGAAACCCGAGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1197199090 X:123733192-123733214 GACTCGCGGGCCCCTTTGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1197199080_1197199089 6 Left 1197199080 X:123733150-123733172 CCACCCAGCGGAAACCCGAGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199080_1197199087 5 Left 1197199080 X:123733150-123733172 CCACCCAGCGGAAACCCGAGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199080 Original CRISPR TGCCTCGGGTTTCCGCTGGG TGG (reversed) Intergenic
902349970 1:15847398-15847420 GGCCTGGGGTTGCCGCTGGAGGG + Intergenic
904563450 1:31413535-31413557 CGGCTCGGGTTTCCGCGGGCAGG + Intronic
910209100 1:84775576-84775598 TGCCTGGGCTTTCTTCTGGGAGG + Intergenic
914492435 1:148160711-148160733 TGCCGCGGTTCTACGCTGGGTGG + Intergenic
915574721 1:156767979-156768001 AGCCTGGGGTCTCCGGTGGGTGG - Exonic
917132317 1:171755449-171755471 TGCCTGGGGCTTGTGCTGGGAGG + Intergenic
917298380 1:173545885-173545907 TGCCTCAGTTTTCCTCTAGGTGG + Intronic
918097116 1:181344850-181344872 TGCCTCTGGTTTACACTGGCTGG + Intergenic
921391155 1:214615490-214615512 TGGCTCGTGTTTTCTCTGGGTGG + Intronic
921532312 1:216299502-216299524 TGGCTGGGGTTACCGGTGGGTGG + Intronic
922477350 1:225915785-225915807 GGCCCTGGGTTACCGCTGGGAGG - Intronic
1063615293 10:7594937-7594959 CCCTTCGGGTTTCCCCTGGGGGG + Intronic
1074119261 10:110481335-110481357 TCCCTCTGGCTTCCTCTGGGAGG - Intergenic
1075654450 10:124152097-124152119 TGCTCCTGGCTTCCGCTGGGCGG + Intergenic
1086080744 11:82900511-82900533 GGCTTTGGGTTTCCCCTGGGAGG - Intronic
1089262380 11:117232050-117232072 AGCCGCGAGTTTCCGCAGGGAGG - Exonic
1089792830 11:120956865-120956887 AGCCTCTGGTTTCCGGTCGGGGG + Exonic
1090044042 11:123315400-123315422 TGCCTGGGGTTTGCTCTGTGTGG + Intergenic
1092183428 12:6461698-6461720 TCCCTCGGGTGACTGCTGGGAGG + Intronic
1096114325 12:49046483-49046505 TGGCTTGGGTTTCCGGTGAGGGG - Intronic
1100246342 12:92761247-92761269 TGCCTCTAGATTCCTCTGGGTGG - Intronic
1106827731 13:33542618-33542640 CGCCCCGGGTTTCCGCTCCGGGG + Intergenic
1112712114 13:102140973-102140995 TGCCTCTGGTTTCTGTTGTGAGG - Intronic
1113489884 13:110682989-110683011 TGCCTCGGGTCTCAGCTCTGGGG - Intronic
1116666369 14:47780973-47780995 TGACTGGGGTATCCACTGGGAGG - Intergenic
1121002986 14:90465397-90465419 TGCCTGGGCTTTCCAATGGGAGG - Intergenic
1122076368 14:99237616-99237638 TGCCACGGGTTTTGGCTTGGGGG + Intronic
1122781071 14:104143794-104143816 CGCCTCGGGGATCCGCAGGGTGG + Intronic
1123121554 14:105919188-105919210 TGCCTGGGGTTGATGCTGGGAGG + Intronic
1124634892 15:31358977-31358999 TGCTTCTGGCTTCCCCTGGGAGG + Intronic
1127264079 15:57347056-57347078 GGCCTGGAGTTTCCGCTGGCAGG - Intergenic
1127949371 15:63789547-63789569 TGCCTCGGCTTTCCGAAGTGCGG - Intronic
1130654861 15:85785578-85785600 TGCCTGGAGTTTCCTCTAGGTGG - Intronic
1131825800 15:96321985-96322007 TGCATCGGGTCGCGGCTGGGAGG + Intergenic
1132090429 15:98943765-98943787 TGTCTTGGCTTTCCTCTGGGGGG + Intronic
1134119168 16:11571599-11571621 TGCCTGGGGGTTCAGGTGGGAGG - Intronic
1134530132 16:14976012-14976034 TACCTCTGGTTTCCCCTTGGGGG + Intronic
1137756515 16:50906492-50906514 TGCCTGTGGTTTCCGTTTGGGGG + Intergenic
1138385319 16:56632442-56632464 TGGCTCGGGTTTGCGCGGGAGGG - Exonic
1139866214 16:70064942-70064964 TACCTCTGGTTTCCCCTTGGGGG - Intergenic
1141576790 16:84969233-84969255 TGCCTCGTGTAGCTGCTGGGAGG - Intergenic
1144728819 17:17515140-17515162 TGGCTCGGGTCTCCGCAGGAGGG - Intronic
1144729169 17:17516875-17516897 TGCCTGGGGTAGCCACTGGGCGG - Intronic
1148695878 17:49557713-49557735 CCCCTCGGGTGTCCACTGGGTGG + Intergenic
1150388629 17:64778708-64778730 CGCCTCGGGGCTCCGCTGGGGGG + Intergenic
1152146677 17:78572663-78572685 TGCTTCCGGCTGCCGCTGGGTGG - Intronic
1155519514 18:26655675-26655697 TGCTTCGGGGTTCGGCTGGGCGG - Intronic
1159284972 18:66336999-66337021 TGCCTCAGGACTCCGCTTGGTGG + Intergenic
1161105847 19:2443588-2443610 TGCCTCGGATTTCCTCAGGCTGG - Intronic
1168132761 19:54331806-54331828 TGGCTCTGGTTTTCCCTGGGTGG + Intergenic
926190096 2:10721743-10721765 TGCCTCGGGTCCCCGCTCCGCGG - Intronic
926415551 2:12646159-12646181 TACCTTGAGTTTCCTCTGGGTGG - Intergenic
928025867 2:27738075-27738097 TGCTTCAAGTTTCCGCTGGGGGG + Intergenic
937104754 2:119300014-119300036 TACCTCAGGTCTCCACTGGGAGG + Intergenic
938115621 2:128601468-128601490 TGCCTCTGGTTTCCCCCAGGGGG - Intergenic
947542753 2:230990275-230990297 GGGCTCGGGCTTCCGTTGGGAGG - Intergenic
1171173268 20:23034113-23034135 GGTCTCAGCTTTCCGCTGGGTGG - Intergenic
1171780387 20:29411549-29411571 GTCCTCGGGCTTCCGCGGGGAGG + Intergenic
1172331675 20:34079991-34080013 TTCCTCTGGTACCCGCTGGGGGG - Exonic
1175418566 20:58817268-58817290 GGTCTGGGGCTTCCGCTGGGGGG - Intergenic
1181761596 22:25062464-25062486 TGCCAGGGGCTTCCGCTGGATGG - Intronic
1183700149 22:39446444-39446466 TGCCTGGGGTTTCCGAAAGGCGG + Intergenic
950772170 3:15320923-15320945 TGCCATGGGTTTCAGCTGAGGGG + Intronic
951505700 3:23442822-23442844 TGCCTGGGGTTTCCCCTCAGAGG + Intronic
952530181 3:34255214-34255236 TGTCTTGGGTTTCCTCTGAGCGG - Intergenic
957084701 3:75668960-75668982 GTCCTCGGGCTTCCGCGGGGAGG - Intergenic
957112283 3:75979042-75979064 TGCATCGGTTTTCAGCTGGTGGG - Intronic
961356305 3:126342052-126342074 TGCCTGGGGTCTTCGCTGTGTGG - Intergenic
966975828 3:185082454-185082476 TGCCTCGGCTTACTTCTGGGAGG - Exonic
979559121 4:122082202-122082224 TGCCTTTGGTTTACCCTGGGTGG - Intergenic
990984258 5:61626597-61626619 TGCCTCAAGTTGCCCCTGGGTGG - Intergenic
1000132940 5:158317621-158317643 TGCCTCGGGTGCCCCATGGGAGG - Intergenic
1001688284 5:173612518-173612540 TGCCTGGGGTTACGGATGGGAGG - Intronic
1002896206 6:1381989-1382011 TTCCTCCGGCTTCCGCGGGGTGG - Intergenic
1006646651 6:35519618-35519640 TTCCCCAGGTTTCTGCTGGGTGG + Intergenic
1011643021 6:89433069-89433091 TGCCCCGGCTCGCCGCTGGGAGG + Intergenic
1018869059 6:167767712-167767734 TGCCTCGGGTTTCTTCTTGAGGG + Intergenic
1022139456 7:27480686-27480708 TGCCTCTGGCCTCAGCTGGGAGG + Intergenic
1022832220 7:34079283-34079305 TGCCTTGGGTTTTTGCTCGGAGG - Intronic
1025968192 7:66295367-66295389 TGCCTCTGGTTTCAGCTGCTTGG + Intronic
1029074921 7:97927970-97927992 TGCCCCGGGTTAAAGCTGGGAGG - Intergenic
1030672904 7:112356057-112356079 TGCCTCTGGTTCCCACTAGGAGG - Intergenic
1034401827 7:150866930-150866952 TGTCTGGGGCTTCAGCTGGGAGG + Intergenic
1035568059 8:654863-654885 CGCCTCAGGTTCCTGCTGGGGGG - Intronic
1037674122 8:21039663-21039685 TGTCTTGGGTTTCTGCTGGAGGG - Intergenic
1040042700 8:42932466-42932488 TGGCTCGGATTTCCTCTGGGTGG - Intronic
1040747641 8:50664631-50664653 GGCCTTGGGTATCCTCTGGGAGG - Intronic
1045058836 8:98393751-98393773 TGCCTGGGGTCTCTGTTGGGAGG - Intergenic
1049261369 8:141640925-141640947 TGCCTGGGACTGCCGCTGGGGGG - Intergenic
1049720537 8:144113549-144113571 TGCCTCGAGCTTTCTCTGGGAGG - Intronic
1062057133 9:134474575-134474597 TGCCTCCGGGTTCCGCTGTCAGG - Intergenic
1203738766 Un_GL000216v2:161210-161232 GGCCCCGGGCTTCCACTGGGAGG - Intergenic
1185531348 X:821423-821445 TGCCTTTGGTTTTCTCTGGGTGG - Intergenic
1190430709 X:50375629-50375651 TGCCTCGGTTTTCCTCTTGAGGG - Intronic
1197199080 X:123733150-123733172 TGCCTCGGGTTTCCGCTGGGTGG - Intergenic
1199312137 X:146332823-146332845 TGCGTCTGGTTTCCGCTGGCTGG + Intergenic