ID: 1197199081

View in Genome Browser
Species Human (GRCh38)
Location X:123733153-123733175
Sequence CCTTGCCTCGGGTTTCCGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199081_1197199093 27 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199093 X:123733203-123733225 CCCTTTGCGAGGTTACTACACGG 0: 1
1: 0
2: 0
3: 4
4: 37
1197199081_1197199087 2 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1197199081_1197199089 3 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199081_1197199095 28 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199095 X:123733204-123733226 CCTTTGCGAGGTTACTACACGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1197199081_1197199086 -8 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199081_1197199090 16 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199090 X:123733192-123733214 GACTCGCGGGCCCCTTTGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199081 Original CRISPR CCTTGCCTCGGGTTTCCGCT GGG (reversed) Intergenic
900018300 1:169799-169821 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
900048557 1:528395-528417 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
900070787 1:770247-770269 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
900288628 1:1914426-1914448 CCTGGCCTCAGCTTTCCCCTGGG - Intergenic
900379157 1:2375312-2375334 CGCTGCCTCGGGGTTCCCCTGGG - Intronic
902109555 1:14066906-14066928 CCTTGCCTCAGTTTCCCTCTTGG + Intergenic
917429277 1:174948770-174948792 CCCTGCCTCAGGCTTCTGCTGGG - Intronic
919730050 1:200907998-200908020 CCAGGCTTAGGGTTTCCGCTTGG + Intronic
919771666 1:201164695-201164717 TCTTGGCTCGGCTTTCCTCTGGG + Intronic
922106146 1:222515663-222515685 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
922559514 1:226558972-226558994 CATTGCCTCCGCTTTCCCCTAGG - Intronic
924348326 1:243093230-243093252 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
1065151428 10:22826712-22826734 ACTTGCCCCGGGTATCTGCTAGG - Intergenic
1067053330 10:43037631-43037653 CCTTGCCTCAGGTTTCCCTCTGG - Intergenic
1067937505 10:50624088-50624110 CCTTGGTTCGGGGTCCCGCTCGG - Intronic
1070895187 10:79977323-79977345 TCTGGCCTCAGGTTTCAGCTGGG - Intronic
1072503736 10:96043895-96043917 CCTGGCCGCGGGTCTCCGCATGG - Intronic
1073261292 10:102192525-102192547 CCATGTCTCGGGTTTCAGGTGGG - Intergenic
1076974902 11:164995-165017 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
1087172881 11:95067996-95068018 CCTTGACTTGGATTTCCTCTTGG - Exonic
1088696746 11:112372765-112372787 CATTGCCTCGGTTTTCTTCTAGG + Intergenic
1090524181 11:127512183-127512205 CCTTGCCTAGATTTTCCTCTAGG + Intergenic
1092261248 12:6954306-6954328 CTTTGCCTCTGGTCTCTGCTGGG + Intronic
1098350072 12:69549821-69549843 CCTTGCCTCAGTCTTCCCCTAGG + Intronic
1102951905 12:117036772-117036794 CCCTGCCTAGGGTTCCCGCTGGG + Intergenic
1106602757 13:31200853-31200875 TCCTGTCTCGGGTCTCCGCTGGG + Intronic
1119265394 14:73261027-73261049 CCTGGCCTCTGGTCTCCCCTGGG + Intronic
1122760986 14:104026215-104026237 CCCTGCCTCGGCTTACAGCTAGG + Intronic
1123080457 14:105691393-105691415 CCCTGCCTCGGGGGTCCCCTCGG + Intergenic
1123892420 15:24794726-24794748 CCTTGCATTGGGTTTCTTCTGGG - Intergenic
1124959945 15:34386562-34386584 CCTGGGCTCCGGTTTCCTCTTGG - Intronic
1124976574 15:34532783-34532805 CCTGGGCTCCGGTTTCCCCTTGG - Intronic
1130941384 15:88512286-88512308 CCTTCCCTCGGGTTTTTGCTTGG - Intronic
1132068955 15:98758587-98758609 CCTTCCCTCTGGTTTCACCTGGG + Intronic
1132847065 16:2005574-2005596 CCCTGGCACGGGTTTCCTCTGGG - Intronic
1133938492 16:10287822-10287844 CATTGCCTAGGTTTTCCTCTAGG + Intergenic
1137756512 16:50906489-50906511 CCTTGCCTGTGGTTTCCGTTTGG + Intergenic
1139260127 16:65583878-65583900 CCTTGCATCTGGTTTCCTCTGGG + Intergenic
1139300409 16:65940946-65940968 CCTTGCCTGGTGTTTCAGCTTGG - Intergenic
1141147272 16:81540133-81540155 CCTTGCTTCGTCTTTCCGTTTGG - Intronic
1142445360 16:90132662-90132684 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
1142462151 17:102808-102830 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
1143652770 17:8274189-8274211 CCTTCCTTTGGGTTTCAGCTGGG + Intergenic
1143986123 17:10915950-10915972 CCTTACCTGGGGTATCCACTTGG - Intergenic
1144297255 17:13887901-13887923 CCTTGCCACTGGCTTCTGCTAGG + Intergenic
1145396319 17:22498048-22498070 CATTGCCTAGGTTTTCCTCTAGG + Intergenic
1146151063 17:30472701-30472723 TCTTGCCTCTGGTTTCTGCCCGG - Intergenic
1150388624 17:64778705-64778727 CCCCGCCTCGGGGCTCCGCTGGG + Intergenic
1154331469 18:13432558-13432580 CCATGCCTTTGGTTTCCTCTTGG + Intronic
1160525358 18:79532394-79532416 CCCCGCCTTGGGTTTCCGCCAGG + Intergenic
1160651854 19:235175-235197 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
1164010128 19:21194857-21194879 CCTTGCCTCTTGTTTCTGGTGGG - Exonic
1164514368 19:28921632-28921654 CCTTGCGGCAGGTTTCCGCCTGG - Intergenic
926896249 2:17692602-17692624 GTTTGCCTAGGGTTTCCTCTAGG - Intronic
928025864 2:27738072-27738094 GCTTGCTTCAAGTTTCCGCTGGG + Intergenic
929950946 2:46409075-46409097 CCTTGCCTCTGGACTCCTCTTGG - Intergenic
933798962 2:85944540-85944562 CCTTGCCTGGGGTCTCAGTTAGG - Intergenic
934493365 2:94777751-94777773 CTCTGCCTCAGGTTTCTGCTTGG - Intergenic
939656657 2:144834880-144834902 CTTTGCTTCGGGTTTCAGCGTGG - Intergenic
941467994 2:165853753-165853775 CCTGGCCTCGGGTTCCCAGTTGG + Intergenic
947795539 2:232891787-232891809 CCTTGCCACAGTTTCCCGCTGGG - Intronic
1169354480 20:4895961-4895983 CCTTGCCTCAGGTTTCCTGTGGG - Intronic
1180081193 21:45488524-45488546 CCTTGCCTCGGGTTTTCTGATGG + Intronic
1183700147 22:39446441-39446463 CCCTGCCTGGGGTTTCCGAAAGG + Intergenic
950753297 3:15149018-15149040 CCATGCCTGGGGTCTCAGCTGGG - Intergenic
954082781 3:48222244-48222266 CCTGGCCTCGGGTTTCCCTGGGG - Intergenic
957025628 3:75178405-75178427 CCTTTCCTCTGGCTTCCTCTTGG - Intergenic
959016394 3:101138981-101139003 CCTTTTCTCAGGTTTCCGGTAGG + Intergenic
962738286 3:138345009-138345031 CCTTGCCTGGGTTTTTGGCTAGG + Intergenic
968365976 3:198184792-198184814 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
968655652 4:1777445-1777467 CCCTTCCTAGGGTTTCTGCTTGG + Intergenic
978926445 4:114251640-114251662 TCTTCCCTCGGTTTTCCACTTGG - Intergenic
979255014 4:118599951-118599973 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
979299333 4:119068587-119068609 CCTTGCCTCGGGCTGCCTGTTGG - Intergenic
979333947 4:119446062-119446084 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
986126655 5:4888667-4888689 TATTGCCTCGGGTTTCTTCTAGG + Intergenic
991054613 5:62306900-62306922 CCCTGCCTCGCGCTTCCCCTTGG + Intronic
997163566 5:131634956-131634978 CCTCACCTCGGGAGTCCGCTCGG + Exonic
1000654008 5:163854007-163854029 CCTTGCCTAGGTTTTCTTCTAGG - Intergenic
1001953047 5:175829513-175829535 CCTTCCCTCGGACTTCTGCTGGG + Intronic
1002602669 5:180362912-180362934 ACTTGCCTGGGGTTCCCGCCTGG + Intergenic
1002676364 5:180916995-180917017 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002676371 5:180917064-180917086 CCTTGTCTTTGGTTTCCGCTAGG - Intronic
1002676378 5:180917133-180917155 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002676385 5:180917202-180917224 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002676392 5:180917271-180917293 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002676399 5:180917340-180917362 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002676406 5:180917409-180917431 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002676413 5:180917478-180917500 CCTTGTCTTTGGTTTCTGCTAGG - Intronic
1002725202 5:181290017-181290039 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
1004746050 6:18510307-18510329 GCTTTCCTGGGGTTTCTGCTGGG - Intergenic
1010314980 6:74437504-74437526 CATTGCCTAGGTTTTCCTCTAGG + Intergenic
1017487139 6:154913824-154913846 CCTTGCCCTTGGTTTCCACTTGG + Intronic
1024070112 7:45777640-45777662 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
1024816558 7:53277758-53277780 CCTTTACTCTGGTTTCCCCTAGG - Intergenic
1025099321 7:56122331-56122353 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
1025990187 7:66491710-66491732 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
1026038537 7:66846783-66846805 CCTTACCTTGGGTTTCTCCTGGG + Intergenic
1027212856 7:76164769-76164791 CCTTCCCTTGGGTTTCTCCTGGG - Intergenic
1029544173 7:101201765-101201787 CCTGGCCTCGCCTGTCCGCTGGG - Intergenic
1031012800 7:116541249-116541271 CCTTACCCTGGGTTTCCTCTTGG - Intronic
1032047503 7:128621923-128621945 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
1033431745 7:141295651-141295673 CCTTGCCTTTGGTTTCTGCAGGG + Intronic
1038278575 8:26142259-26142281 CCTTGCCTCTGGCTTCTGCTTGG - Intergenic
1038562165 8:28589979-28590001 CCTTTCCTTGGGTGTCAGCTGGG - Intergenic
1042560227 8:70068387-70068409 TCCTGCCTCGGCTTTCCCCTAGG - Exonic
1048222974 8:132560483-132560505 GCTTTCCTCTGGTTTCCTCTGGG - Intergenic
1048223792 8:132566150-132566172 CCTTGCCTCTGGCTTCCAGTGGG + Intergenic
1049720538 8:144113552-144113574 CCTTGCCTCGAGCTTTCTCTGGG - Intronic
1050327275 9:4509632-4509654 CCTTGCCTCTGGTTTTGGCTGGG - Intronic
1053010092 9:34628059-34628081 CCTTTCCTCGGGGTCCCGCCTGG - Exonic
1057533572 9:95876062-95876084 CTTTGCCTGAGGTTTCCGCGCGG - Exonic
1057580934 9:96287227-96287249 CTTGGCCTCTGGTTTCAGCTGGG - Intronic
1062750345 9:138247659-138247681 CCTTCCCTTGGGTTTCTCCTGGG + Intergenic
1189593203 X:42537249-42537271 CCTTGCCTCTGGCTTCTGTTTGG - Intergenic
1192018980 X:67364042-67364064 TCTTGCCTAGGTTTTCCTCTAGG - Intergenic
1197199081 X:123733153-123733175 CCTTGCCTCGGGTTTCCGCTGGG - Intergenic
1198479944 X:137031851-137031873 CCCTACCCCGGGTTTCCGCACGG + Intergenic