ID: 1197199083

View in Genome Browser
Species Human (GRCh38)
Location X:123733154-123733176
Sequence GCCTTGCCTCGGGTTTCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199083_1197199086 -9 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199086 X:123733168-123733190 AGGCAAGGCAGCCAACGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1197199083_1197199095 27 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199095 X:123733204-123733226 CCTTTGCGAGGTTACTACACGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1197199083_1197199089 2 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199083_1197199090 15 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199090 X:123733192-123733214 GACTCGCGGGCCCCTTTGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1197199083_1197199093 26 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199093 X:123733203-123733225 CCCTTTGCGAGGTTACTACACGG 0: 1
1: 0
2: 0
3: 4
4: 37
1197199083_1197199087 1 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199083 Original CRISPR GCCTTGCCTCGGGTTTCCGC TGG (reversed) Intergenic
900018302 1:169800-169822 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
900048559 1:528396-528418 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
900070789 1:770248-770270 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
902386623 1:16079588-16079610 GCCCCGCCTGGGGTTTCCCCGGG + Intergenic
904563447 1:31413531-31413553 GTCCCGGCTCGGGTTTCCGCGGG + Intronic
904697121 1:32336787-32336809 GCCTTGCCTCGGGGTCACTCTGG + Intergenic
918511209 1:185316505-185316527 GCCTCGCCTCGGGTTTGCCTGGG - Intronic
921189967 1:212700061-212700083 CCCCTGCCGCGGCTTTCCGCCGG + Intergenic
922106148 1:222515664-222515686 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
924348328 1:243093231-243093253 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
1067556363 10:47276118-47276140 GCCTTGCCTCGGTTGACCACAGG + Intergenic
1070950294 10:80425743-80425765 GCCTTGCCTCTGCTTTCCACTGG + Intronic
1076974904 11:164996-165018 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
1085510105 11:77083887-77083909 GCCTTGCCTTGGTTTCCCTCAGG + Intronic
1086118936 11:83285861-83285883 GCCTTGCCTCACCTCTCCGCAGG + Exonic
1102951903 12:117036771-117036793 CCCCTGCCTAGGGTTCCCGCTGG + Intergenic
1112437099 13:99398345-99398367 GCCTTGACTCGGCTGTCAGCAGG + Intergenic
1123892422 15:24794727-24794749 GCCTTGCATTGGGTTTCTTCTGG - Intergenic
1129161257 15:73749212-73749234 GCCTTTTCTGGGGTTTCAGCAGG - Intronic
1132348559 15:101123008-101123030 GCCTTGCCATGGGCTGCCGCCGG - Intergenic
1133185148 16:4090616-4090638 GGCTTCCCTCTGGTTTCCGTGGG - Intronic
1133241244 16:4415932-4415954 CCCCTCCCTCGGGTTTCCGCCGG - Intronic
1134658990 16:15969714-15969736 GTCTTGCCTCGAATTTCCCCAGG - Intronic
1138385321 16:56632446-56632468 CCTTTGGCTCGGGTTTGCGCGGG - Exonic
1139260125 16:65583877-65583899 ACCTTGCATCTGGTTTCCTCTGG + Intergenic
1139654332 16:68378152-68378174 GCCAAGCCCCTGGTTTCCGCAGG + Intronic
1142019064 16:87768963-87768985 GCATTGCCTCAGGTTTACCCAGG - Intergenic
1142445358 16:90132661-90132683 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
1142462153 17:102809-102831 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
1144728822 17:17515144-17515166 GGCCTGGCTCGGGTCTCCGCAGG - Intronic
1145269747 17:21398426-21398448 GCCTGGCCTCGGGATGCTGCTGG - Intronic
1149863559 17:60138000-60138022 GCCTTGGCTCTGGGTTCCACAGG + Intergenic
1150388622 17:64778704-64778726 GCCCCGCCTCGGGGCTCCGCTGG + Intergenic
1160651856 19:235176-235198 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
1164010130 19:21194858-21194880 GCCTTGCCTCTTGTTTCTGGTGG - Exonic
926737516 2:16084573-16084595 GAATTGCCTTGGGTTTCCACAGG - Intergenic
946854236 2:223936939-223936961 GCCTTGTGTCTGGTTTCCTCTGG + Intronic
1169354482 20:4895962-4895984 GCCTTGCCTCAGGTTTCCTGTGG - Intronic
1172424260 20:34844800-34844822 GCCTTGCATCGGGGGTCCCCAGG - Exonic
1175253972 20:57627651-57627673 GCCTTGCCTGGAGTTTCTTCTGG - Intergenic
1175265344 20:57699774-57699796 GCTTTGCCCCGGGTTCCCCCAGG - Intronic
954082783 3:48222245-48222267 CCCTGGCCTCGGGTTTCCCTGGG - Intergenic
960056198 3:113278276-113278298 CCCTTGCTTAGGGTTTCCGTGGG + Intronic
968365974 3:198184791-198184813 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
968869870 4:3236398-3236420 GCCTTGGCTCAGGGTTCCACTGG + Intronic
969035988 4:4254380-4254402 GCTTTGCCTGGGGTTTTCTCTGG + Intergenic
974198245 4:58604540-58604562 GCCTCACCTCGAGTTTCTGCAGG - Intergenic
979255012 4:118599950-118599972 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
979333949 4:119446063-119446085 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
997643185 5:135463181-135463203 GCCTGGGCTCGGGTTCCTGCAGG + Intergenic
998406217 5:141876211-141876233 GCCTTGCCTTGGGTTCCTGGAGG - Intronic
999277047 5:150338478-150338500 GCCTTGCCTCAAGTTTCCTAAGG - Intronic
1002725200 5:181290016-181290038 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
1021315780 7:19145380-19145402 GCCTCTCATCGGTTTTCCGCAGG + Exonic
1021411072 7:20330722-20330744 GCCTCGCCTCGGCTGCCCGCAGG - Intronic
1022327387 7:29344535-29344557 GTCTTGCCTCTGGTTCCTGCAGG + Intronic
1024070110 7:45777639-45777661 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
1025990185 7:66491709-66491731 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
1026038535 7:66846782-66846804 GCCTTACCTTGGGTTTCTCCTGG + Intergenic
1027212858 7:76164770-76164792 GCCTTCCCTTGGGTTTCTCCTGG - Intergenic
1029544175 7:101201766-101201788 GCCTGGCCTCGCCTGTCCGCTGG - Intergenic
1032005504 7:128299227-128299249 GCCTTGCCTTGCCTTTCTGCTGG - Exonic
1032047501 7:128621922-128621944 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
1033431743 7:141295650-141295672 GCCTTGCCTTTGGTTTCTGCAGG + Intronic
1035257726 7:157642512-157642534 TCCTCGCCTCGGGTTTCTCCAGG + Intronic
1035372331 7:158387384-158387406 GCCTTCGCTGGGGTCTCCGCAGG + Intronic
1050327277 9:4509633-4509655 TCCTTGCCTCTGGTTTTGGCTGG - Intronic
1056807590 9:89740934-89740956 GCCTTTATTGGGGTTTCCGCAGG - Intergenic
1059784753 9:117569141-117569163 GCCTTGCCTCTGGCTGCCGTAGG - Intergenic
1061091605 9:128429512-128429534 GCCTAGCCTCTGGGTTCCTCGGG - Intronic
1062081010 9:134623410-134623432 GCCTGGCCCCGGGTTTCTACAGG - Intergenic
1062750343 9:138247658-138247680 GCCTTCCCTTGGGTTTCTCCTGG + Intergenic
1189435322 X:40987732-40987754 GCCTTTATTGGGGTTTCCGCAGG - Intergenic
1197199083 X:123733154-123733176 GCCTTGCCTCGGGTTTCCGCTGG - Intergenic
1201601895 Y:15738663-15738685 AACTTGCCTCGGGTTTTGGCGGG + Intergenic