ID: 1197199085

View in Genome Browser
Species Human (GRCh38)
Location X:123733165-123733187
Sequence CGTCGTTGGCTGCCTTGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199085_1197199090 4 Left 1197199085 X:123733165-123733187 CCGAGGCAAGGCAGCCAACGACG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1197199090 X:123733192-123733214 GACTCGCGGGCCCCTTTGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 29
1197199085_1197199095 16 Left 1197199085 X:123733165-123733187 CCGAGGCAAGGCAGCCAACGACG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1197199095 X:123733204-123733226 CCTTTGCGAGGTTACTACACGGG 0: 1
1: 0
2: 0
3: 1
4: 28
1197199085_1197199093 15 Left 1197199085 X:123733165-123733187 CCGAGGCAAGGCAGCCAACGACG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1197199093 X:123733203-123733225 CCCTTTGCGAGGTTACTACACGG 0: 1
1: 0
2: 0
3: 4
4: 37
1197199085_1197199087 -10 Left 1197199085 X:123733165-123733187 CCGAGGCAAGGCAGCCAACGACG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1197199087 X:123733178-123733200 GCCAACGACGTGGAGACTCGCGG 0: 1
1: 0
2: 0
3: 1
4: 38
1197199085_1197199089 -9 Left 1197199085 X:123733165-123733187 CCGAGGCAAGGCAGCCAACGACG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199085 Original CRISPR CGTCGTTGGCTGCCTTGCCT CGG (reversed) Intergenic
900392292 1:2438929-2438951 CGGCGTGGGCTGCCCTGCCCAGG + Intronic
921095025 1:211878994-211879016 CATCTTTTGCTTCCTTGCCTGGG - Intergenic
1062861730 10:815619-815641 CGTCCTTTGCTTCCTGGCCTTGG - Intronic
1067237946 10:44467386-44467408 TGTCAGTGGCTGCCTTCCCTTGG - Intergenic
1078358299 11:10649068-10649090 CTTCCTTGGCTGCCTGGCCTCGG + Intronic
1083433324 11:62626295-62626317 CTTCCTTGGCTGCCTTTGCTGGG - Intronic
1090982608 11:131736654-131736676 TGTCCTTGGCTGCCTTGCCAAGG - Intronic
1094218150 12:27967100-27967122 CGTCATTGGCTGATTTGCTTAGG - Intronic
1097488564 12:60235876-60235898 GGTTCTTGGCTGCCTTGCATTGG - Intergenic
1100617677 12:96243614-96243636 CCTCGTGATCTGCCTTGCCTCGG - Intronic
1101776242 12:107796795-107796817 TTTCCTTGGCTGCCTTGCCAGGG - Intergenic
1102826243 12:115950050-115950072 CCTCGTTGGGTTCCCTGCCTAGG + Intergenic
1107810081 13:44192026-44192048 CATCCTTGGCTGTGTTGCCTGGG - Intergenic
1107870085 13:44738483-44738505 CAGCTGTGGCTGCCTTGCCTTGG - Intergenic
1112489627 13:99849831-99849853 CCTCCTTGGCTGCCTTGCCCTGG - Intronic
1114050478 14:18916670-18916692 GTTTGGTGGCTGCCTTGCCTGGG - Intergenic
1114112079 14:19485262-19485284 GTTTGGTGGCTGCCTTGCCTGGG + Intergenic
1115940193 14:38600717-38600739 GGTTGTTAGCTTCCTTGCCTTGG + Intergenic
1116918363 14:50547509-50547531 CTTCGTTGCCTGCCTGGGCTAGG - Intronic
1120439093 14:84513053-84513075 CGGCCTTAGCTGCCTTCCCTTGG - Intergenic
1123995677 15:25716359-25716381 CTTCCTTCGCTGCCTGGCCTGGG - Intronic
1124084337 15:26532583-26532605 CGTCCTTAGCTTCCTTGCATTGG - Intergenic
1129853239 15:78807120-78807142 CATCTTTAGCTGCCTTGGCTGGG - Intronic
1135960797 16:26993171-26993193 GGCAGTTGCCTGCCTTGCCTCGG + Intergenic
1136855215 16:33649988-33650010 CGTTCTTAGCTTCCTTGCCTTGG - Intergenic
1141861220 16:86717886-86717908 TGTCGCCGCCTGCCTTGCCTGGG + Intergenic
1151716662 17:75834617-75834639 CCATGTTGGCTGCCTGGCCTTGG + Exonic
1152327619 17:79650780-79650802 CGTCGATGGCAGTCTTCCCTCGG - Intergenic
1160394354 18:78560848-78560870 CATGGTTAGCTGCTTTGCCTTGG - Intergenic
1161590404 19:5126828-5126850 CGTGCTTGGCTTCCATGCCTGGG - Intronic
1162024887 19:7888348-7888370 CGTCTTAGGCTGCTTTGCCCTGG - Intergenic
1164160522 19:22623215-22623237 GGTCGTGGGCGGCCTCGCCTTGG + Intergenic
1166268406 19:41699319-41699341 CATCGCAGGCAGCCTTGCCTGGG - Intronic
926279924 2:11437765-11437787 CTTCCTTGGCTGCCTTGGCAGGG + Intergenic
928919345 2:36510568-36510590 CATCCTTAGCTGCCATGCCTAGG + Intronic
937023315 2:118678086-118678108 CCTGGTGGGCTGCCTTTCCTGGG + Intergenic
940173078 2:150849746-150849768 GGTTGTGGGCAGCCTTGCCTGGG - Intergenic
941819146 2:169827582-169827604 CGGCGGTGGCCGCCTTGTCTAGG - Exonic
942849744 2:180470378-180470400 CTTTGTTGGTTGCCTTGCATAGG + Intergenic
948002413 2:234579369-234579391 CGTCTGTGGCTCCCTTTCCTGGG - Intergenic
1173800474 20:45891640-45891662 GGTCGGGGGCTGCCTCGCCTCGG - Exonic
1175731797 20:61359241-61359263 TGTCGTTGGCTCACTTCCCTAGG + Intronic
1176130389 20:63494386-63494408 CCTCCTTGGCTGCCTCCCCTGGG - Intronic
1179932393 21:44579222-44579244 GGTCATTGGCTGCCGTGCCCTGG - Intronic
1180468954 22:15639044-15639066 GTTTGGTGGCTGCCTTGCCTGGG - Intergenic
1181141163 22:20806014-20806036 TGTTGCTGGCTGCCTTGGCTGGG - Intronic
1184602728 22:45553063-45553085 CGTCGATGGCCCCCCTGCCTTGG + Intronic
1184922262 22:47614009-47614031 CGGAATTGGCTGCCATGCCTAGG + Intergenic
950724554 3:14907876-14907898 AGTCCTAGGCTGCCTTCCCTGGG + Intronic
956998463 3:74855350-74855372 AGTAGTTGGCTGATTTGCCTTGG - Intergenic
972517106 4:39818939-39818961 CTTCGCGGGCTGCCTTGCTTTGG + Intergenic
975486032 4:74934636-74934658 CGGCTTTGGCTGCCCAGCCTCGG + Intronic
984677751 4:182569729-182569751 CATCACTGGCTGCCTTGCCTGGG - Intronic
984770584 4:183433362-183433384 GGGCCTTGGCTGCCTTCCCTCGG + Intergenic
990539449 5:56757606-56757628 CAAAGTTGGCTGCCTTGGCTGGG + Intergenic
990745713 5:58957998-58958020 CGTTCTTGGCTTCCTTGCATTGG + Intergenic
991150309 5:63360281-63360303 GGTCCTTAGCTTCCTTGCCTTGG + Intergenic
994947755 5:106417424-106417446 AGTCGGAGGCTGCCTTGCCGTGG - Intergenic
998629285 5:143880585-143880607 CGTCATAGGCTGCATTTCCTGGG - Intergenic
1009402683 6:63275125-63275147 TGGCCTTAGCTGCCTTGCCTCGG - Intergenic
1011444020 6:87418305-87418327 GGTCGTTGGCTGCCTTCTCAAGG - Exonic
1018812002 6:167305113-167305135 CTAAGTTGGCAGCCTTGCCTGGG - Intronic
1025023198 7:55495965-55495987 CGTCGTGTGCTGCCTCGCCAAGG + Intronic
1029472743 7:100764940-100764962 CCTCGTTGCCTCCCCTGCCTAGG - Intronic
1030759971 7:113338296-113338318 CCTGGTTGGCTGCCTTGCTTGGG + Intergenic
1035999258 8:4583045-4583067 CGGCGTTAGCTGCCTTCCCGCGG + Intronic
1040855306 8:51942888-51942910 CCTCGTAGGACGCCTTGCCTGGG + Intergenic
1042663117 8:71177738-71177760 CCTTGTTGGCTCCCTTGCCTTGG + Intergenic
1048655405 8:136530596-136530618 CGTCCTTAGCTGCCTTCCCGCGG - Intergenic
1049674292 8:143882903-143882925 CGTCCTGGGCGGCCTGGCCTGGG + Intergenic
1053538195 9:38946872-38946894 CCTCGTGATCTGCCTTGCCTTGG + Intergenic
1054627939 9:67417047-67417069 CCTCGTGATCTGCCTTGCCTTGG - Intergenic
1059719949 9:116950235-116950257 CAATGTTGGTTGCCTTGCCTGGG - Intronic
1186188705 X:7047057-7047079 AGTCGTTGCCTCCCTTTCCTTGG - Intergenic
1191198030 X:57745350-57745372 CGTCCTTAGCTTCCTTGCATTGG - Intergenic
1197199085 X:123733165-123733187 CGTCGTTGGCTGCCTTGCCTCGG - Intergenic
1199698950 X:150362824-150362846 CGGCGTCAGCTGGCTTGCCTAGG - Intronic
1202137082 Y:21676807-21676829 CGGCCTTAGCTGCCTTGCCGCGG - Intergenic