ID: 1197199089

View in Genome Browser
Species Human (GRCh38)
Location X:123733179-123733201
Sequence CCAACGACGTGGAGACTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197199083_1197199089 2 Left 1197199083 X:123733154-123733176 CCAGCGGAAACCCGAGGCAAGGC 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199085_1197199089 -9 Left 1197199085 X:123733165-123733187 CCGAGGCAAGGCAGCCAACGACG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199073_1197199089 23 Left 1197199073 X:123733133-123733155 CCGCCCCACTTTCCTCTCCACCC 0: 1
1: 0
2: 11
3: 172
4: 1492
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199074_1197199089 20 Left 1197199074 X:123733136-123733158 CCCCACTTTCCTCTCCACCCAGC 0: 1
1: 1
2: 10
3: 102
4: 816
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199084_1197199089 -8 Left 1197199084 X:123733164-123733186 CCCGAGGCAAGGCAGCCAACGAC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199076_1197199089 18 Left 1197199076 X:123733138-123733160 CCACTTTCCTCTCCACCCAGCGG 0: 1
1: 0
2: 3
3: 35
4: 363
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199080_1197199089 6 Left 1197199080 X:123733150-123733172 CCACCCAGCGGAAACCCGAGGCA 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199075_1197199089 19 Left 1197199075 X:123733137-123733159 CCCACTTTCCTCTCCACCCAGCG 0: 1
1: 0
2: 0
3: 31
4: 350
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199078_1197199089 11 Left 1197199078 X:123733145-123733167 CCTCTCCACCCAGCGGAAACCCG 0: 1
1: 0
2: 0
3: 12
4: 249
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199072_1197199089 24 Left 1197199072 X:123733132-123733154 CCCGCCCCACTTTCCTCTCCACC 0: 2
1: 0
2: 12
3: 113
4: 1001
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1197199081_1197199089 3 Left 1197199081 X:123733153-123733175 CCCAGCGGAAACCCGAGGCAAGG 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197199089 Original CRISPR CCAACGACGTGGAGACTCGC GGG Intergenic
918647178 1:186918233-186918255 CCACTGAGGTGGAGGCTCGCTGG + Intronic
923201840 1:231720219-231720241 CCAAGGACTTGGTTACTCGCAGG + Intronic
1098748655 12:74269177-74269199 CCACTGAGGTGGAGGCTCGCTGG - Intergenic
1100610478 12:96187848-96187870 CCAAAGAGGTGGAGAATAGCTGG - Intergenic
1122809508 14:104281075-104281097 CCCAGGCCGTGGAGACGCGCGGG + Intergenic
1148899849 17:50867032-50867054 CCAAAGACGTGGAGCCGGGCTGG + Intronic
934098445 2:88628464-88628486 TCAACGAGGAGGAGACTGGCCGG + Intergenic
1174363849 20:50044392-50044414 CCAAGGATGTGGAGACTCTGAGG - Intergenic
1175685302 20:61024095-61024117 CCACCCACGTGGCCACTCGCAGG + Intergenic
1178447727 21:32660906-32660928 CCACTGAGGTGGAGGCTCGCTGG - Intronic
951165997 3:19485771-19485793 CCACTGAGGTGGAGGCTCGCTGG + Intronic
978328892 4:107590094-107590116 CCAAGGACTGGGAGACTCCCTGG + Intergenic
980780160 4:137483175-137483197 CCACTGAGGTGGAGGCTCGCTGG - Intergenic
992270074 5:75054385-75054407 GAAAGGACGTGGAGCCTCGCGGG - Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1015509187 6:134020847-134020869 CCAACGAGTTGGAGAATCTCAGG - Intronic
1019162298 6:170076691-170076713 ACAAGGACGTGGAGAGTCACAGG + Intergenic
1031999328 7:128254552-128254574 CCAACGACCTGGAGAACCTCCGG + Exonic
1034054081 7:148016169-148016191 CAAAGGACGTGGAGATTGGCAGG - Intronic
1049224489 8:141443326-141443348 GCAACGACGTTGAGACCAGCAGG - Intergenic
1061949060 9:133926077-133926099 CCAACGGGGTGGGGACTCACAGG + Intronic
1185618338 X:1436924-1436946 CCATCGTCGTGGAGACTGGAAGG + Intronic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic
1199425154 X:147692764-147692786 CCAATGACGTGGAGACACAAGGG - Intergenic
1200073769 X:153541374-153541396 CCAATGACCTGGAGAAGCGCAGG + Exonic