ID: 1197210000

View in Genome Browser
Species Human (GRCh38)
Location X:123820515-123820537
Sequence GTGGATTTGTCGGCCGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197210000_1197210009 18 Left 1197210000 X:123820515-123820537 CCTCACCCGGCCGACAAATCCAC No data
Right 1197210009 X:123820556-123820578 TTAATAGGAACTTATGGGCCGGG No data
1197210000_1197210007 13 Left 1197210000 X:123820515-123820537 CCTCACCCGGCCGACAAATCCAC No data
Right 1197210007 X:123820551-123820573 AACTTTTAATAGGAACTTATGGG No data
1197210000_1197210005 3 Left 1197210000 X:123820515-123820537 CCTCACCCGGCCGACAAATCCAC No data
Right 1197210005 X:123820541-123820563 CTTAGAAAGAAACTTTTAATAGG No data
1197210000_1197210008 17 Left 1197210000 X:123820515-123820537 CCTCACCCGGCCGACAAATCCAC No data
Right 1197210008 X:123820555-123820577 TTTAATAGGAACTTATGGGCCGG No data
1197210000_1197210010 26 Left 1197210000 X:123820515-123820537 CCTCACCCGGCCGACAAATCCAC No data
Right 1197210010 X:123820564-123820586 AACTTATGGGCCGGGTGCACTGG No data
1197210000_1197210006 12 Left 1197210000 X:123820515-123820537 CCTCACCCGGCCGACAAATCCAC No data
Right 1197210006 X:123820550-123820572 AAACTTTTAATAGGAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197210000 Original CRISPR GTGGATTTGTCGGCCGGGTG AGG (reversed) Intergenic
No off target data available for this crispr