ID: 1197210382

View in Genome Browser
Species Human (GRCh38)
Location X:123823512-123823534
Sequence ATGTTATCTCAGAGGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197210382_1197210389 22 Left 1197210382 X:123823512-123823534 CCCTGTACCCTCTGAGATAACAT No data
Right 1197210389 X:123823557-123823579 GTCTGGCTCCTCTTTTAAGCAGG No data
1197210382_1197210387 5 Left 1197210382 X:123823512-123823534 CCCTGTACCCTCTGAGATAACAT No data
Right 1197210387 X:123823540-123823562 GTACCAACTGGTCACTTGTCTGG No data
1197210382_1197210386 -7 Left 1197210382 X:123823512-123823534 CCCTGTACCCTCTGAGATAACAT No data
Right 1197210386 X:123823528-123823550 ATAACATTGTCTGTACCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197210382 Original CRISPR ATGTTATCTCAGAGGGTACA GGG (reversed) Intergenic
No off target data available for this crispr