ID: 1197225175

View in Genome Browser
Species Human (GRCh38)
Location X:123949786-123949808
Sequence CTGTGTGGCTGGCTGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197225169_1197225175 -8 Left 1197225169 X:123949771-123949793 CCAGCCCATAGAATACTGTGTGG No data
Right 1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197225175 Original CRISPR CTGTGTGGCTGGCTGGCAGA AGG Intergenic
No off target data available for this crispr