ID: 1197226778

View in Genome Browser
Species Human (GRCh38)
Location X:123961943-123961965
Sequence CCGCCCATGCCAGGCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 250}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197226778_1197226797 16 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226797 X:123961982-123962004 AGTGGAAGGCTGTTTGTTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 214
1197226778_1197226799 23 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226799 X:123961989-123962011 GGCTGTTTGTTGGGGGGTTTTGG 0: 1
1: 0
2: 1
3: 25
4: 265
1197226778_1197226794 13 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226794 X:123961979-123962001 GGGAGTGGAAGGCTGTTTGTTGG 0: 1
1: 0
2: 3
3: 226
4: 7344
1197226778_1197226798 17 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226798 X:123961983-123962005 GTGGAAGGCTGTTTGTTGGGGGG 0: 1
1: 0
2: 2
3: 28
4: 216
1197226778_1197226796 15 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226796 X:123961981-123962003 GAGTGGAAGGCTGTTTGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 223
1197226778_1197226793 2 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226793 X:123961968-123961990 GGGGGAAGGGCGGGAGTGGAAGG 0: 1
1: 1
2: 24
3: 203
4: 2079
1197226778_1197226792 -2 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226792 X:123961964-123961986 GGAGGGGGGAAGGGCGGGAGTGG 0: 1
1: 7
2: 88
3: 879
4: 5253
1197226778_1197226795 14 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226795 X:123961980-123962002 GGAGTGGAAGGCTGTTTGTTGGG 0: 1
1: 1
2: 1
3: 17
4: 201
1197226778_1197226791 -7 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226791 X:123961959-123961981 TGGGCGGAGGGGGGAAGGGCGGG 0: 1
1: 0
2: 10
3: 161
4: 1726
1197226778_1197226790 -8 Left 1197226778 X:123961943-123961965 CCCTGCCTGCCTGGCATGGGCGG 0: 1
1: 0
2: 2
3: 28
4: 250
Right 1197226790 X:123961958-123961980 ATGGGCGGAGGGGGGAAGGGCGG 0: 1
1: 0
2: 15
3: 236
4: 3139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197226778 Original CRISPR CCGCCCATGCCAGGCAGGCA GGG (reversed) Intronic
900251066 1:1669983-1670005 CCACCCAAGCCAGACAGGAAGGG + Intronic
900297698 1:1960205-1960227 CCGCCAGTACCTGGCAGGCAGGG + Intronic
900357100 1:2270279-2270301 ACTCCCATGCCAGGCCCGCAGGG - Intronic
900507777 1:3038344-3038366 CTGCCTGTGCCAGGCAGCCAAGG + Intergenic
901451482 1:9339101-9339123 CAGCCCAGGCAAGGCAGGCCTGG + Intronic
903667407 1:25016553-25016575 GTTCCCATGCCAGACAGGCATGG + Intergenic
904697105 1:32336745-32336767 CTGGCCATGGCAGGCAGGCAGGG - Intergenic
904832077 1:33311825-33311847 CCGCCCAACACAGGCAGCCAGGG - Intronic
906529826 1:46517321-46517343 CAGCCCCTCCCAGGGAGGCAGGG - Intergenic
907338876 1:53719343-53719365 CCCCCCATGCCAGGTGGGCAGGG - Intronic
908950699 1:69559454-69559476 CTGCTCTTGCAAGGCAGGCATGG + Intergenic
909755851 1:79224492-79224514 CTGCTTTTGCCAGGCAGGCATGG - Intergenic
912940213 1:114038185-114038207 GCCCCCAGGACAGGCAGGCATGG + Intergenic
914089349 1:144483353-144483375 CCGGCCAAGCCTGGCAGACATGG - Intergenic
914309262 1:146450862-146450884 CCGGCCAAGCCTGGCAGACATGG + Intergenic
914592849 1:149122275-149122297 CCGGCCAAGCCTGGCAGACATGG - Intergenic
915119182 1:153617807-153617829 CCCCTCAAGCCAGGAAGGCAAGG + Intergenic
915339094 1:155166711-155166733 GCGCCCAGGGCAGGCAGGGAGGG - Intergenic
917793287 1:178513501-178513523 CGGCCCATGCCAGGCCTGCCAGG + Intronic
919778337 1:201208067-201208089 CTCTGCATGCCAGGCAGGCATGG + Exonic
1062988372 10:1791042-1791064 CTGCCCCTCTCAGGCAGGCAGGG - Intergenic
1063377128 10:5561166-5561188 TGGCCCATGCCAGGCATGCAGGG + Intergenic
1064008411 10:11715771-11715793 TGGCACCTGCCAGGCAGGCACGG - Intergenic
1067914255 10:50379737-50379759 CCACCAAGGCCAGGCAGTCATGG + Intronic
1069630900 10:69896522-69896544 CCACCCCTGCCAGGCAGGTCCGG + Intronic
1069831639 10:71285476-71285498 CTGCAGAAGCCAGGCAGGCATGG + Intronic
1071519352 10:86319488-86319510 CATCCCATGCCAGGCAGAAAAGG - Intronic
1072209866 10:93236573-93236595 CTGCCTGTGCCAGGCTGGCAGGG + Intergenic
1072232651 10:93426070-93426092 CCTCCCATGCCTGGCACGCTGGG + Exonic
1072633191 10:97161013-97161035 CCACACATACCAGCCAGGCACGG - Intronic
1073076434 10:100827871-100827893 CCGCGCAGTCCAGGCAGGCGGGG - Exonic
1075729761 10:124629168-124629190 CAGCACATGCCAGGCAGGCTGGG - Intronic
1076203799 10:128578961-128578983 GCCCCTAGGCCAGGCAGGCAGGG + Intergenic
1076340851 10:129743959-129743981 CATCCCATCCCAGCCAGGCATGG - Intronic
1076346360 10:129781370-129781392 CTGCACATGCCAGGAAGCCAAGG - Intergenic
1076499946 10:130929483-130929505 TCAGCCATGCCAGGCAGCCATGG + Intergenic
1076786818 10:132754068-132754090 GCCCCCATGCCAGCCATGCAGGG + Intronic
1076920080 10:133446595-133446617 CCCCCCACGCCGGGCTGGCAGGG + Intergenic
1077162971 11:1121966-1121988 CCTTCCATGCCAGGCTGCCAGGG - Intergenic
1077297950 11:1834824-1834846 CAGCCCCAGCCAAGCAGGCAGGG - Intronic
1077371268 11:2182677-2182699 CCCCCCTTGCCAGGCAGGGCTGG + Intergenic
1077464417 11:2726821-2726843 GCGCCCATGCCAGTGGGGCACGG - Intronic
1077998742 11:7476066-7476088 CCACCCATGCCAGCCAGCCCTGG + Intergenic
1080282197 11:30570068-30570090 CAGCCCAAGGCAGGTAGGCAGGG - Intronic
1080388402 11:31823669-31823691 GGGCCCTTTCCAGGCAGGCAGGG + Intronic
1080791591 11:35526354-35526376 GCGCACACGCCAGGCAGGGATGG + Intronic
1082625172 11:55476121-55476143 CCATCAATGACAGGCAGGCAAGG - Intergenic
1083027756 11:59564877-59564899 GCCCCCATGCCAGACAAGCATGG + Intergenic
1083263638 11:61536209-61536231 CCGCCTTTCCCAGGAAGGCAGGG + Intronic
1084708616 11:70830289-70830311 CCCTCCCAGCCAGGCAGGCAGGG - Intronic
1085382045 11:76128583-76128605 CCTCCCATGCCTGGCACCCAAGG - Intronic
1086429305 11:86720027-86720049 CCTCCCATGACTGGCAGGGAAGG - Intergenic
1086508414 11:87529227-87529249 CCACCTAAGCCAGGGAGGCATGG - Intergenic
1089782652 11:120884463-120884485 CGGCCCATGCCAGCCAGGCGGGG + Intronic
1089939231 11:122398022-122398044 CTGCCCATGTCAGGCTGGAAAGG - Intergenic
1091815218 12:3432547-3432569 CTGCCCAGCCCAGGCAGGAAGGG + Intronic
1092246185 12:6865740-6865762 CCACCCATTCCAGGGAGGCAGGG - Intronic
1093646822 12:21595536-21595558 CTGGCTATGCCAGGCAGGAATGG - Intronic
1094840839 12:34342131-34342153 CCGCACATGCATGGCAGGGATGG - Intergenic
1095431054 12:42135029-42135051 CCTCCCTTATCAGGCAGGCAAGG - Intronic
1100455012 12:94743208-94743230 CCTCCCCTGTGAGGCAGGCAGGG + Intergenic
1101435137 12:104658031-104658053 CCGCCGAGGCCAGCCAGCCAAGG + Intronic
1102213429 12:111143769-111143791 TGGCCCATGCCAGGCATGCAGGG - Intronic
1102641433 12:114370593-114370615 CCTCACATGCCAGGCAGGGAGGG + Intronic
1104031014 12:125065737-125065759 CCGCCCATCCCCCGCAGGCCCGG - Intronic
1104602491 12:130162816-130162838 CCGCCCATGCCCGCCCGGCCTGG - Exonic
1105431469 13:20340997-20341019 ACAGCCTTGCCAGGCAGGCAGGG + Intergenic
1108500434 13:51065403-51065425 CAGCCAATGCCTGGCAGGCACGG - Intergenic
1110031572 13:70620995-70621017 CTGCGCATGCCAGGGAAGCATGG - Intergenic
1112543174 13:100337229-100337251 CCCCTCATGGCAGCCAGGCAGGG + Intronic
1112652625 13:101416066-101416088 GCGCCCCGGCCAGGCCGGCAAGG + Intronic
1117066727 14:52018977-52018999 CTGCCCAGACCACGCAGGCACGG - Intronic
1117487422 14:56212459-56212481 CCCCCAATCCCAGGGAGGCAGGG - Intronic
1118837591 14:69487618-69487640 CTTCCCACCCCAGGCAGGCAGGG - Intronic
1120275388 14:82367067-82367089 TCTACTATGCCAGGCAGGCACGG + Intergenic
1121823891 14:96994812-96994834 CTGCACATGCCAGGGAGCCAAGG - Intergenic
1122032508 14:98923243-98923265 CCGCTCATTTCAGCCAGGCACGG - Intergenic
1122284312 14:100641818-100641840 GCCCCCATGCCCAGCAGGCAGGG - Intergenic
1122338351 14:101008241-101008263 CCACCCATGTCAGGGAAGCAGGG - Intergenic
1122951367 14:105047015-105047037 CCGCATAGGCCAGGGAGGCAGGG - Intergenic
1122986022 14:105211965-105211987 CTGGCCATGCCAGGCAAGTATGG + Intronic
1123042758 14:105497082-105497104 CAGCTCTTGCCTGGCAGGCAGGG + Intronic
1123775571 15:23575752-23575774 CCACCCATGCCAGAAAGGGAAGG - Intronic
1123925386 15:25104500-25104522 CTGGCTATGCCAGGCAGCCATGG + Intergenic
1123999156 15:25740474-25740496 CAGCACCTGCCAGCCAGGCAGGG + Intronic
1124203761 15:27699920-27699942 CGGCTCCTGGCAGGCAGGCAGGG - Intergenic
1124212713 15:27776578-27776600 CTCCCCATGGCAGGCAGGGATGG + Intronic
1127795287 15:62432922-62432944 AAGCCCTTGCCAGGCAGGCATGG + Intronic
1129241916 15:74257015-74257037 GCCCCCATGCCCTGCAGGCAAGG + Intronic
1129692105 15:77719469-77719491 CCTCCCAGGTCAGGCTGGCATGG + Intronic
1130274364 15:82468862-82468884 CAGCCCCTGCCAGGCACACATGG + Intergenic
1130466710 15:84196236-84196258 CAGCCCCTGCCAGGCACACATGG + Intergenic
1130497554 15:84477300-84477322 CAGCCCCTGCCAGGCACACATGG - Intergenic
1130589006 15:85200829-85200851 CAGCCCCTGCCAGGCACACATGG + Intergenic
1130957419 15:88637513-88637535 CCGCACAGGCCAGGCAGGTGAGG + Intronic
1132205391 15:99982893-99982915 CCACCCTTCCCAGGCAGGGAGGG + Intronic
1132505927 16:308692-308714 TGGGCCATGCCTGGCAGGCAGGG + Intronic
1132610533 16:813743-813765 CCGCCCAGGGCAGGCAGGCAGGG - Exonic
1132742343 16:1421096-1421118 CAGCCCAGGGCAGGCGGGCAGGG - Intergenic
1132897411 16:2235633-2235655 TCTACCAGGCCAGGCAGGCATGG - Exonic
1133223043 16:4327532-4327554 CCGGCCAGGCCAGGTAGCCAAGG - Intronic
1134441812 16:14302999-14303021 CCGCCCATGCCAGCGGGGCTCGG - Intergenic
1136690679 16:32025924-32025946 CCGCCTCTGCAGGGCAGGCAGGG + Intergenic
1136791264 16:32969485-32969507 CCGCCTCTGCAGGGCAGGCAGGG + Intergenic
1136878550 16:33884447-33884469 CCGCCTCTGCAGGGCAGGCAGGG - Intergenic
1137605302 16:49783182-49783204 CCGCCCATCCCAGCCTGGCAGGG - Intronic
1138496709 16:57413342-57413364 GTGCCCATGCCCGGCAGCCAGGG + Intronic
1138496730 16:57413411-57413433 GGGCCCATGCCCGGCAGCCAGGG + Intronic
1138591952 16:58005016-58005038 CCTCAGCTGCCAGGCAGGCAAGG - Intronic
1138991097 16:62392114-62392136 CCTCCCATGGCATGCAGGCAAGG - Intergenic
1140091965 16:71846128-71846150 CCGCCGGGGCCAGGCAGGCCTGG + Intronic
1141403803 16:83773939-83773961 AAGACCATGCCAGGCAGGGAAGG - Intronic
1141760478 16:86025790-86025812 GAGCCCAGGCCAGGCTGGCAGGG + Intergenic
1141842321 16:86581004-86581026 CCAGCCCTGCCAGGCAGGCCTGG + Exonic
1142207059 16:88788559-88788581 CCAGGCATGCCAGGCAGGCATGG + Intergenic
1142380869 16:89731135-89731157 CCACCCAATCCAGGCAGGCAGGG + Intronic
1203093473 16_KI270728v1_random:1230947-1230969 CCGCCTCTGCAGGGCAGGCAGGG + Intergenic
1144325065 17:14171370-14171392 GTGCACATGCCAGCCAGGCATGG + Intronic
1144473939 17:15568249-15568271 GTGCACATGCCAGCCAGGCATGG + Intronic
1144833101 17:18142662-18142684 GCTCCCAGGCCAGGCTGGCAAGG + Intronic
1147153543 17:38532067-38532089 CCGCCTCTGCAGGGCAGGCAGGG + Exonic
1149575217 17:57707159-57707181 CTCCCCAGGGCAGGCAGGCAGGG - Intergenic
1152009237 17:77700720-77700742 CCTCCCCTGCCTGGTAGGCAAGG - Intergenic
1152234137 17:79129851-79129873 CAGCCCATGCCAGGGAGGGGAGG + Intronic
1152337599 17:79707248-79707270 CCGCCCAGGCCACGTGGGCAGGG - Intergenic
1152375903 17:79918956-79918978 CCCCCCAGGCCAGGCCTGCAGGG + Intergenic
1152570132 17:81118046-81118068 CCTCCGAGGCCAGGCAGGCAGGG + Exonic
1152791346 17:82282034-82282056 CAGCCCACGCCAGGAAGGAACGG + Intergenic
1152922493 17:83072994-83073016 CCGCCGAGTCCAGGCAGGCATGG + Intergenic
1153620737 18:6975249-6975271 AGGGCCATGCCAGGCACGCAGGG - Intronic
1153974923 18:10260788-10260810 CTGCACATGCTAGGCAGGAAGGG - Intergenic
1154305960 18:13231114-13231136 GCGCGCATTCCATGCAGGCAGGG - Intronic
1156350178 18:36296822-36296844 CCGCCCCTGCCAGGCGGGAGCGG - Intergenic
1159736158 18:72100476-72100498 CTCCCCATGCCAGACAGACAAGG - Intergenic
1160823735 19:1069737-1069759 CCGCCCAGGCCAGGCCTCCAAGG - Intronic
1160947599 19:1651044-1651066 CCGCTCATGGAGGGCAGGCAAGG - Intronic
1161314708 19:3612472-3612494 CCGCCCCTGCCAGAGAGGCTAGG - Intronic
1162394554 19:10409265-10409287 CAGCCCAGGCGAGGGAGGCAGGG - Intronic
1163411583 19:17158279-17158301 AAGCCCCTGCCAGCCAGGCACGG + Intronic
1164591734 19:29511206-29511228 CCCTCCACGCCAGGCAGGCTTGG - Intergenic
1164597491 19:29539811-29539833 CCGGCCAGGCCAGGAAGCCAGGG + Intronic
1166054048 19:40278048-40278070 CCCCACATCCCAAGCAGGCATGG + Intronic
1166437092 19:42776782-42776804 CCTTCCCTGCCTGGCAGGCAAGG + Intronic
1166453737 19:42922895-42922917 CCTCACCTGCCAGGCAGGGAAGG - Intronic
1166529485 19:43534047-43534069 CCGCCCATTCCAGGACTGCAGGG + Intronic
1167356857 19:49009894-49009916 GGGGCCATGCCAGGCAGCCAGGG + Intronic
1167748786 19:51367850-51367872 CCGCCCCAGGCGGGCAGGCAGGG - Intronic
1168264774 19:55216753-55216775 CTGCCAACGCCAGGCAGGCGGGG + Intergenic
1168289547 19:55350884-55350906 CAGCCTTTGGCAGGCAGGCAGGG + Intronic
926113049 2:10194847-10194869 CCCACCATGCCAAGGAGGCAGGG - Intronic
926671744 2:15583139-15583161 CCGCATATGCAAGCCAGGCAGGG - Intergenic
927649806 2:24905578-24905600 CCGCCCCAACCAGGGAGGCAAGG + Intronic
928437914 2:31267801-31267823 CCTCCCAGGACAGGCTGGCAAGG + Exonic
929484454 2:42341417-42341439 CCGCCCAGCCCAGGCAAGCTTGG - Intronic
931090814 2:58884021-58884043 CAGCTCCTGCCAGGCATGCAGGG - Intergenic
932239037 2:70142675-70142697 CCGCCCCTGCGAGCCACGCAGGG + Intergenic
933724321 2:85418167-85418189 CAGCCCAGGCCTGGCAGGCAAGG - Intronic
934500868 2:94858865-94858887 CCGCCTGTGCCAGGTGGGCAAGG + Intergenic
934566932 2:95346467-95346489 CCGCCCTTCCCGGGCAGGCGCGG + Intronic
934753101 2:96806927-96806949 CCGCCCCGGCCAGGCTGGCTGGG + Intronic
936163438 2:110101593-110101615 GCGCCCATCCCAGGGAGGCCGGG - Intronic
937218743 2:120329372-120329394 ACACCCATGCCAGGCAGTCAGGG + Intergenic
938460521 2:131493258-131493280 CTGCCCAGGCCGGGCAGGCTGGG + Intergenic
939554634 2:143659677-143659699 CTGCCCTTCCTAGGCAGGCATGG + Intronic
940286729 2:152039670-152039692 CTGTGCATGGCAGGCAGGCAAGG + Intronic
946183077 2:217960547-217960569 AGGTCCATGCCAGGCAGGCTGGG + Intronic
946378208 2:219327085-219327107 CCCCTCATGCCAGACAGGCCTGG - Intergenic
947993213 2:234503771-234503793 CCGCCCCTGACAGGCAGAGAAGG - Intergenic
948305484 2:236944200-236944222 CAGCCCACACCAAGCAGGCAGGG - Intergenic
948955931 2:241291332-241291354 CCTCCTGTGACAGGCAGGCAGGG + Intronic
1168973545 20:1947404-1947426 CCGCCCAGCCCAGGCAGTCGCGG + Intergenic
1169195047 20:3678389-3678411 CAGCCCAGGCCAGACAGACAGGG + Intronic
1171413761 20:24963777-24963799 CTGCCCCTGCCACGCAGGCCAGG - Exonic
1172190019 20:33056328-33056350 TCCCACATGCCAGGCAGGGAGGG + Intronic
1173365404 20:42380444-42380466 CCAACCAGGCCAGGCAGGCCTGG - Intronic
1174894022 20:54429592-54429614 CCGGCCATGCCAAGAATGCAAGG - Intergenic
1175995069 20:62808360-62808382 CCACCCCTGCCAGGCAAGGATGG - Intronic
1176007461 20:62874245-62874267 CCTCCCCTGCCTGGCAGCCAAGG - Intergenic
1176076592 20:63251132-63251154 CCTCGGCTGCCAGGCAGGCAAGG - Intronic
1176128254 20:63485477-63485499 CAGACCATGGCAGGCAGGCTGGG + Intergenic
1176270317 20:64232862-64232884 GCTCCCTTGCAAGGCAGGCAGGG - Intronic
1178480981 21:32979066-32979088 GCGCCCCTGACAGGCAGGCAGGG - Intergenic
1179072848 21:38089162-38089184 ACGTCCAAGCCAGGCAGGAACGG - Intronic
1179209804 21:39314677-39314699 ACGCGCATTCCAGGAAGGCAGGG - Intronic
1179296335 21:40066074-40066096 CCTCCCATGCCCAGTAGGCAGGG + Intronic
1179569913 21:42272719-42272741 GTGCTCATGCAAGGCAGGCACGG - Intronic
1180845074 22:18976377-18976399 CCGCCCGGGCCTGGGAGGCAGGG - Intergenic
1180947703 22:19705739-19705761 CCACCAGTGCCAGGCAGGCAGGG - Intergenic
1180947713 22:19705774-19705796 CCACCGGTGCCAGGCAGGCAGGG - Intergenic
1180947724 22:19705809-19705831 CTGCCAGTGCCAAGCAGGCAGGG - Intergenic
1180947733 22:19705845-19705867 CCACCAGTGCCAGGCAGACAGGG - Intergenic
1180981073 22:19878259-19878281 CCACCCATGCCTCCCAGGCAGGG - Intronic
1182316100 22:29448481-29448503 CCACCCAGGCCAGGGAGGCAGGG - Intergenic
1183371169 22:37433366-37433388 CAGCCCCAGCCAGGCAAGCAGGG - Intergenic
1183782732 22:40009129-40009151 CAGCCCTTGGGAGGCAGGCAGGG + Intronic
1183987378 22:41576967-41576989 TCGCCCAGGGCAGGCAGGCAGGG + Exonic
1184373648 22:44098262-44098284 CCACCCATCTCAGGCGGGCAAGG - Intronic
1184666503 22:45992145-45992167 TGGCACAGGCCAGGCAGGCATGG + Intergenic
1185380697 22:50506403-50506425 CCCCCCAGGGCAGGCAGGCAGGG - Exonic
954003665 3:47576981-47577003 CCGCCCAGGAGAGCCAGGCAGGG - Exonic
954198853 3:49012448-49012470 CTGCCCATGAGAGGCAGGCCTGG + Exonic
954440426 3:50518791-50518813 TCGCCCAGGTCAGGCAGACAGGG + Intergenic
956547263 3:70418503-70418525 CAGCCAATGCCAGGATGGCAGGG - Intergenic
962837797 3:139204205-139204227 CAGCCCTTGCCAAGCAGGAAAGG - Intronic
963796413 3:149634997-149635019 CCTCCCATGCAAGAAAGGCAGGG - Intronic
968706611 4:2081268-2081290 TCACCCCTGCCAGGCATGCATGG + Intronic
968874075 4:3256032-3256054 CCACTCAGGCCAGGCGGGCAAGG + Exonic
968889770 4:3362227-3362249 CTGCCCAAGCCAGGCAGGACTGG + Intronic
968912128 4:3481646-3481668 TGGCTCATGCCAGGTAGGCATGG - Intronic
969588006 4:8105664-8105686 CCGCAGAAGGCAGGCAGGCACGG + Intronic
969696597 4:8738547-8738569 CAGCCTCAGCCAGGCAGGCAAGG + Intergenic
970226715 4:13866417-13866439 GCTCAAATGCCAGGCAGGCACGG - Intergenic
974493412 4:62595842-62595864 CCTCCGCTGCCAGGCAGGGAAGG + Intergenic
976947881 4:90792749-90792771 CAGCTTGTGCCAGGCAGGCAAGG + Intronic
978424631 4:108569313-108569335 TGACCCATGCAAGGCAGGCAGGG - Intergenic
978546951 4:109880321-109880343 CCTCCCATGTCAGGCAGGTTTGG - Intergenic
982094744 4:151911668-151911690 GCTGCCATGTCAGGCAGGCAGGG + Intergenic
984701194 4:182819728-182819750 GCTCCCATGCCAGGCATTCAGGG + Intergenic
986046393 5:4042362-4042384 CTTTTCATGCCAGGCAGGCATGG - Intergenic
986417970 5:7547362-7547384 CCACCCATGCCACCCAGGCCTGG - Intronic
987085395 5:14462952-14462974 CTGCCCCTGCACGGCAGGCATGG - Intronic
988897843 5:35697371-35697393 CCACTCATGCCATGCAGACAGGG - Intronic
990352766 5:54935259-54935281 ACCCCCATGCCAGTCAGGCCTGG - Intergenic
993695317 5:91054634-91054656 CCTCCCTTGTCAGGAAGGCAAGG + Intronic
996747471 5:126857662-126857684 CAGCCAATGCCAGGGAGGCCAGG - Intergenic
998962895 5:147507955-147507977 CCGCCCGTTCCAGTCAGGAAGGG + Intronic
1001012351 5:168109815-168109837 CCTAGCTTGCCAGGCAGGCATGG + Intronic
1002302981 5:178268062-178268084 CAGCTCAGGCCAGGCAGGCAGGG - Intronic
1002430283 5:179199364-179199386 CCGCCCACGGCTGGCAGGAAAGG + Intronic
1003555802 6:7139104-7139126 CAGCCAGTACCAGGCAGGCAGGG - Intronic
1006359727 6:33580365-33580387 CCCCACCTCCCAGGCAGGCAGGG + Intergenic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1007595725 6:43050137-43050159 CCTCCAGCGCCAGGCAGGCAGGG + Exonic
1008027415 6:46653410-46653432 CCACCTCTGCCAGGCGGGCATGG - Intronic
1017525187 6:155236370-155236392 ACACCCATGACAGCCAGGCATGG + Intronic
1017890142 6:158631116-158631138 ACGTCCCTGCCAGGCAGGCCAGG + Intronic
1019049568 6:169172647-169172669 CAGCCCAGGCAAGGCAGGCGTGG + Intergenic
1019060472 6:169254051-169254073 CGGCCCCTGCCAGACAGGCCTGG + Intergenic
1019341343 7:510454-510476 CCGCCCCTACCAAGCAGCCAGGG - Intronic
1019341425 7:510669-510691 CCGCCCCTACCAAGCAGCCAGGG - Intronic
1019416756 7:931186-931208 CCACCCTGGCCAGGCAGCCAGGG - Intronic
1019422064 7:955068-955090 CCGTCCCTCCCAGGCAGGGATGG - Intronic
1019433854 7:1011924-1011946 CCCACCAGGCCAGGCACGCAGGG + Intronic
1019460234 7:1154308-1154330 CCGGCCAAGGCAGGCAGGCATGG + Intronic
1019600728 7:1882454-1882476 CCCTCCCTGACAGGCAGGCAAGG - Intronic
1021315855 7:19145907-19145929 CCCTTGATGCCAGGCAGGCAGGG - Intergenic
1024222416 7:47298989-47299011 CCGCCCATGCAAGGGACCCAGGG + Intronic
1026765593 7:73157495-73157517 TCGCCTCAGCCAGGCAGGCAGGG - Intergenic
1027042066 7:74967188-74967210 TCGCCTCAGCCAGGCAGGCAGGG - Intronic
1027081575 7:75235166-75235188 TCGCCTCAGCCAGGCAGGCAGGG + Intergenic
1027188679 7:75985906-75985928 CGGCCCCTGCCACGCAGGCAAGG + Exonic
1034678742 7:152911849-152911871 CCGCCCATTCCAGGCAACCCTGG - Intergenic
1035096531 7:156360476-156360498 GGGCCCAAGCCAGGCAGTCAGGG + Intergenic
1035243706 7:157548789-157548811 CCGCCCATGCAAGGCCGGCATGG + Intronic
1035308754 7:157951898-157951920 GCGCCCAGGCCAGACAGGCGGGG - Intronic
1035662096 8:1356008-1356030 CCGATCATGCAAGGCAGGGAGGG - Intergenic
1040592358 8:48805405-48805427 CCTCCCATTCCAGGGAGGAATGG - Intergenic
1041735926 8:61110191-61110213 CTGCACCTGCCAGGCAGTCAGGG - Intronic
1045498601 8:102728577-102728599 CCTCCCAGGCCAGGCAGGCGTGG + Intergenic
1053076520 9:35138954-35138976 CCGCCCCTTCCAGGTTGGCAGGG + Intergenic
1056436185 9:86577863-86577885 CCGGCCAGGCCAGGAGGGCAGGG - Intergenic
1060077875 9:120610360-120610382 CTGCCCATGACAGGCATGAAAGG - Intronic
1060192725 9:121603264-121603286 CAGCCCAGGCCAGGCAGCCTCGG - Intronic
1060790376 9:126481972-126481994 CTGCCCATGCCAGTCCAGCATGG + Intronic
1060827702 9:126696051-126696073 CCTGCCAGGCCAGGCAGGCCTGG + Intronic
1061039180 9:128129737-128129759 CCTCCGCTGCCAGGCAGGGAAGG - Intergenic
1061579613 9:131529086-131529108 CAGCCTCGGCCAGGCAGGCACGG + Intronic
1061579788 9:131529970-131529992 CTGACCATGCCAGCCAGCCAGGG + Intronic
1061582236 9:131545395-131545417 CCGTCCTACCCAGGCAGGCAGGG + Intergenic
1061590557 9:131594959-131594981 CCCCCTATGTCAGGCAGGGAGGG + Intronic
1061876475 9:133546587-133546609 ACACCCATGCCAGCCAGGCCAGG + Intronic
1061942019 9:133888973-133888995 GCGCCCCTGCCAGGGGGGCAGGG + Intronic
1061958420 9:133975648-133975670 TTGGCCATGCCAGGCAGGCTGGG - Intronic
1061978912 9:134088540-134088562 CGGCCCTTGCCAGGCAGCGAAGG + Intergenic
1062047606 9:134431699-134431721 CCGCCCCTGCCAGGCCTGCCTGG - Intronic
1062160130 9:135075407-135075429 CCGCCAATGCCAGGCGCGCGGGG + Intronic
1188596723 X:31910289-31910311 TCTCCCTTGCCAGGCAAGCAAGG + Intronic
1197226778 X:123961943-123961965 CCGCCCATGCCAGGCAGGCAGGG - Intronic
1200232402 X:154450519-154450541 GCGACCATGCCAGGCACGCTGGG + Exonic
1201313686 Y:12621681-12621703 CCGGTGATGGCAGGCAGGCACGG - Intergenic
1201974347 Y:19832097-19832119 CCTCAGCTGCCAGGCAGGCAAGG - Intergenic