ID: 1197231074

View in Genome Browser
Species Human (GRCh38)
Location X:124004248-124004270
Sequence TCTTCTCTGGACTATGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197231074_1197231079 -9 Left 1197231074 X:124004248-124004270 CCCCACTCATAGTCCAGAGAAGA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 1197231079 X:124004262-124004284 CAGAGAAGATAAAAAGTTCAGGG 0: 1
1: 0
2: 4
3: 54
4: 602
1197231074_1197231080 -3 Left 1197231074 X:124004248-124004270 CCCCACTCATAGTCCAGAGAAGA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 1197231080 X:124004268-124004290 AGATAAAAAGTTCAGGGACATGG 0: 1
1: 0
2: 2
3: 34
4: 346
1197231074_1197231078 -10 Left 1197231074 X:124004248-124004270 CCCCACTCATAGTCCAGAGAAGA 0: 1
1: 0
2: 0
3: 6
4: 156
Right 1197231078 X:124004261-124004283 CCAGAGAAGATAAAAAGTTCAGG 0: 1
1: 0
2: 3
3: 27
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197231074 Original CRISPR TCTTCTCTGGACTATGAGTG GGG (reversed) Intronic
900718623 1:4160887-4160909 AATTCTGTGGACTCTGAGTGAGG - Intergenic
900866878 1:5275235-5275257 TCTTCCCTGGCCTGCGAGTGAGG - Intergenic
901178142 1:7319717-7319739 TCTTCTCAGGACTTGGAATGCGG - Intronic
903679879 1:25089600-25089622 TGTGCTCTGGCCTGTGAGTGGGG - Intergenic
906614187 1:47223788-47223810 TCTTTGCAGGACTGTGAGTGTGG + Intronic
907803169 1:57791762-57791784 GCATCTCTGGACTGTCAGTGGGG - Intronic
908305140 1:62806608-62806630 TCTTTTCTGGAGTAGGATTGGGG + Intronic
908661176 1:66436930-66436952 TCCTCTAGGGACTATGAGGGTGG - Intergenic
909713619 1:78680340-78680362 TAGTCCCTGGACTGTGAGTGGGG - Intergenic
911053738 1:93693847-93693869 TCTGCTCTGGGCTCTCAGTGTGG + Intronic
911479836 1:98424259-98424281 TCTTCTCTTGAAGGTGAGTGAGG - Intergenic
911778872 1:101849947-101849969 TCTTTTCTGAACTCTAAGTGTGG - Intronic
913414996 1:118595408-118595430 TCTGATCTGGCCAATGAGTGAGG - Intergenic
915044738 1:153002826-153002848 TATTCTCTGGAAGATAAGTGGGG + Intronic
919535753 1:198785921-198785943 ACTTCTCGGGCCTATAAGTGTGG - Intergenic
922057694 1:222057130-222057152 TCTGCTCTGGATGAGGAGTGGGG + Intergenic
923470055 1:234282433-234282455 CCTGCTCTGGACTGTGAGTGGGG - Intronic
924083576 1:240424801-240424823 TCTTCTGTGGACTTTGAATATGG - Intronic
924478085 1:244398989-244399011 TCTTCTCTGGCCTTTGAATTTGG - Intergenic
1062839829 10:661611-661633 TCTTCTCTGGACTCTAAGCAGGG + Intronic
1063803083 10:9603704-9603726 TATTTTCTGGACTTTGAATGTGG + Intergenic
1068104756 10:52600641-52600663 TGTTCTCTGGACTGTGATTTTGG - Intergenic
1068237889 10:54262676-54262698 TCTTCTCTGCATTCTGACTGTGG - Intronic
1069297177 10:66860907-66860929 TCTTCCCTGGGCTATGAGGTGGG - Intronic
1070209873 10:74305597-74305619 TCTTCTCTTGTGTATGAGTGTGG + Intronic
1071243425 10:83736331-83736353 ATTTTTCTGGACTATGAGTTGGG + Intergenic
1074786765 10:116848890-116848912 CCTTCTCTGGGATATTAGTGGGG - Intergenic
1075482445 10:122793904-122793926 TCTTTTCTGGACAAGGAGTTGGG - Intergenic
1079280642 11:19083904-19083926 TCATCTCTGGACTTTGTGGGTGG + Intergenic
1082026963 11:47579356-47579378 TCTTCTCTGAACTATCGGCGGGG + Intronic
1082991547 11:59211304-59211326 GTTTCTCAGGACTATGAGTTGGG - Exonic
1083000663 11:59287927-59287949 GTTTCTCAGGACTATGAGTTGGG - Intergenic
1089689728 11:120179762-120179784 TCTTCTATGCAATATTAGTGGGG + Intronic
1091005781 11:131951865-131951887 TCTTCTGTGGCCTATGAGGTGGG - Intronic
1093902147 12:24647947-24647969 GTTTCTCTGGACTATTTGTGGGG + Intergenic
1094192425 12:27710972-27710994 TCTTCTCTGGGCTTTGGGGGAGG + Intronic
1097589131 12:61552128-61552150 ACTTCCCTGGACCATGAGTCTGG - Intergenic
1098974847 12:76891785-76891807 TTTCCTCTTGACTATGAATGTGG + Intergenic
1103894698 12:124265195-124265217 TCCGCTCTGGGCTCTGAGTGGGG + Intronic
1104953960 12:132454803-132454825 TCTTCTCTGTGGTAAGAGTGAGG + Intergenic
1105636154 13:22217056-22217078 TCTTCTCTAGTCTTTGTGTGGGG + Intergenic
1107400849 13:40067510-40067532 CCTTACCTGGCCTATGAGTGAGG - Intergenic
1110318883 13:74137534-74137556 TCTTTTCTGGACAATGTGTTAGG - Intergenic
1110581703 13:77137062-77137084 TTTTCACTGGAATGTGAGTGCGG - Intronic
1110797183 13:79652951-79652973 TCTTCTGTGAACTGTGAATGAGG + Intergenic
1117030686 14:51666522-51666544 TCTGATCTGGTCTAGGAGTGGGG + Intronic
1117457219 14:55910652-55910674 ACTTCTCTGGAATTTGAGGGGGG - Intergenic
1118481957 14:66176012-66176034 CCTTCTCTGTGCTAGGAGTGAGG + Intergenic
1118664082 14:68047694-68047716 TCTTCTCAGCACTATGAGGGTGG + Intronic
1118902347 14:69997166-69997188 TCCTGCCTGGACTATGAGAGGGG - Intronic
1125579837 15:40777216-40777238 ACTTCTCTGGACTAAGAGAAGGG - Intronic
1127505662 15:59595629-59595651 TCATCTCTGGACTTTGATTCAGG - Intronic
1129058522 15:72840093-72840115 TCTTCTGTGGGCCAGGAGTGTGG + Intergenic
1129761281 15:78130719-78130741 TCCTGTCTGGTCTAGGAGTGGGG - Intronic
1131292221 15:91116568-91116590 CCTTCTCTGAACTTTGAGTAGGG - Intronic
1133643486 16:7740672-7740694 CCCTCTCTGGACCTTGAGTGAGG - Intergenic
1138217020 16:55213286-55213308 TCTTCCCTGGACAAGGACTGTGG + Intergenic
1139912855 16:70408823-70408845 TCTTCTCTGGACAAAGATCGAGG + Intronic
1142144396 16:88486897-88486919 ACTTCTCTGGTCTGTGAATGGGG - Intronic
1143102212 17:4510635-4510657 CCTCCTCTGGACTATGGATGGGG + Intronic
1147198865 17:38786060-38786082 TCTCCTCTGGACTAACAGTCTGG + Intronic
1149663078 17:58346069-58346091 TCTTCTTTGGACTACAGGTGGGG - Exonic
1156516086 18:37681806-37681828 TCTCCCCTTGACTTTGAGTGTGG - Intergenic
1158022252 18:52856949-52856971 TTTTCTCTAGGCTATGAGTGTGG + Intronic
1158653794 18:59310272-59310294 TCCTCTCTGGAGAATGATTGTGG - Intronic
1162544962 19:11323702-11323724 TCTTCCCTGGGGTATGTGTGAGG - Exonic
1165466351 19:35977276-35977298 TCAAGTCTGGACAATGAGTGGGG - Intergenic
1165591572 19:36973611-36973633 TCTTGTCTGGACTAAAAGTCCGG + Intronic
1167107859 19:47441136-47441158 TCACCTCTGGGCTCTGAGTGGGG - Intronic
1168550506 19:57289625-57289647 TCTCATCTTGACTGTGAGTGGGG + Intronic
926399018 2:12476327-12476349 TCTACTCTGGAGAATGAGTCAGG - Intergenic
928466167 2:31524773-31524795 TCTTCTCAGGCCTATGTTTGCGG - Exonic
930210624 2:48633487-48633509 TCCTCTGTGGTCTATGAGTATGG + Intronic
934094875 2:88591950-88591972 TCTACTTTGGACTATGAATAGGG - Intronic
934771428 2:96910073-96910095 TCCTCTCTGGAGTATGATTCTGG + Intronic
937718615 2:125064139-125064161 TCTTCTCTGCTCTATGATTCAGG + Intergenic
942223882 2:173798088-173798110 TCTTCTATGGAATCTCAGTGGGG + Intergenic
942279801 2:174348745-174348767 TCTTCTCTGGGCTATGTTTATGG + Exonic
943498328 2:188652823-188652845 TATTCTCTGGAATTTGGGTGTGG - Intergenic
945924780 2:215792040-215792062 ACTTCTGTGCCCTATGAGTGAGG - Intergenic
945987839 2:216369902-216369924 TCTTCTGTGGAAGATGACTGGGG - Exonic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1168738272 20:163630-163652 GCTTCTCTGGTCTTTGACTGTGG - Intergenic
1173108700 20:40164078-40164100 ACATCTCTGGAATATGTGTGTGG - Intergenic
1178232218 21:30799100-30799122 GCTTCTCTGGAGACTGAGTGAGG + Intergenic
1178449219 21:32678398-32678420 TCTTCTATAGATTATGATTGAGG - Intronic
1180186347 21:46141645-46141667 TCGTCTTTGGACTTTGCGTGTGG - Intronic
1181566749 22:23743347-23743369 ACTGCTTTGGACTGTGAGTGTGG + Exonic
1185302085 22:50087100-50087122 TGTTCTCCTGACAATGAGTGAGG + Intergenic
953812927 3:46129977-46129999 TCCTCTCTGGATTCTGAGTCTGG - Intergenic
955485792 3:59433346-59433368 GCATCTCTGTGCTATGAGTGGGG - Intergenic
956664517 3:71630112-71630134 CCTTCTCTTGACTTTGAGTTTGG + Intergenic
956952886 3:74302551-74302573 TATTCTGTGGTCTATGAGGGGGG + Intronic
959257284 3:104031373-104031395 TCTTCTCTGTGCTCTGAGTATGG - Intergenic
961033330 3:123625137-123625159 TCTTCTCTGTATTCTGACTGAGG + Intronic
962271179 3:133979050-133979072 TCCTCTCTAGACTATGTATGGGG + Intronic
968545723 4:1196832-1196854 CCTTCTCTGGATAATGAGTATGG - Intronic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
969534348 4:7746815-7746837 GCTTCCCTGGACTATGAGACAGG - Intergenic
971093365 4:23370976-23370998 CCCTCTCAGGACCATGAGTGGGG - Intergenic
971470528 4:27021183-27021205 TCTTCTCTGCACTAGAAGAGTGG - Intronic
975146286 4:70971069-70971091 TCTTCTGTGGACTTTGTATGGGG + Intronic
975954986 4:79826479-79826501 CCATGTCTGGACTGTGAGTGTGG - Intergenic
978267945 4:106849721-106849743 TCTTTTATGGACTCAGAGTGGGG - Intergenic
978884472 4:113750536-113750558 TATTTCCTGGCCTATGAGTGTGG - Intronic
978963563 4:114713819-114713841 TTTTCTCTGGGCTATGATTATGG + Intergenic
979863782 4:125727390-125727412 ATTTCTCTGGACTGTGAATGAGG + Intergenic
983208853 4:164938437-164938459 ATTTTTCTGGACTATGAGTTGGG - Intergenic
986450910 5:7863959-7863981 GCTACTCTGGACTCTGAGTTAGG - Intronic
993283423 5:85958381-85958403 TCTTCTCAGGAAGCTGAGTGGGG + Intergenic
994069117 5:95578444-95578466 TCTTTTCTGGACTTGGTGTGGGG - Intronic
995793048 5:115914479-115914501 TCTTCCATGAACTGTGAGTGAGG + Intergenic
997128829 5:131256372-131256394 TCTTCTCTAGACTATCTTTGAGG - Intronic
998753864 5:145353975-145353997 TCTTCTCTTGACCAAGAGTTAGG + Intergenic
998756482 5:145386407-145386429 TGTTCTCAGGATAATGAGTGAGG + Intergenic
1002053562 5:176585678-176585700 TCTTCTCTGGCCTGTGTGGGTGG - Intronic
1002187053 5:177459353-177459375 TCCTCTCTGGAATCTGGGTGGGG + Intronic
1002908569 6:1470800-1470822 TCCTCCCTGGGGTATGAGTGGGG - Intergenic
1003258556 6:4495265-4495287 TCTACTCTGGACCATGAGCAAGG + Intergenic
1004871556 6:19909865-19909887 TCTTCTATGGAAAATGAGGGAGG + Intergenic
1007419342 6:41710334-41710356 CCTTCTCTGGAATAGGAGTTGGG - Intronic
1008768395 6:54948347-54948369 TCTTCACTGGACTCAGAGTTTGG + Intergenic
1010329327 6:74604311-74604333 TCTTATCTGGAAAATGTGTGTGG + Intergenic
1011521332 6:88209859-88209881 TTTTCTCAGGACTCTGGGTGAGG + Intergenic
1012531336 6:100241284-100241306 CCTGCTTTGGACTTTGAGTGAGG - Intergenic
1013988147 6:116221529-116221551 TCATCTTTGGACGATGATTGAGG + Intronic
1015284240 6:131466762-131466784 TTTTCTCTTGAATATGATTGGGG - Intergenic
1015292155 6:131549500-131549522 TCATGTCTGGAAAATGAGTGGGG + Intergenic
1015844512 6:137505888-137505910 TCTGCTCTACACTATAAGTGGGG - Intergenic
1017996418 6:159535192-159535214 TCTTCACTGGACTTTGCATGTGG + Intergenic
1018964305 6:168472556-168472578 TCATCTTTGAATTATGAGTGTGG + Intronic
1022271189 7:28809510-28809532 TCCTCTGTGGACTAAGTGTGTGG - Intronic
1022498119 7:30865856-30865878 TCTTCCCTGGACTGTGGGAGGGG + Intronic
1023681369 7:42691043-42691065 TCTACTCTGGACTTGGAGTTTGG - Intergenic
1024107272 7:46105408-46105430 TATCGTCTGGACTATCAGTGGGG + Intergenic
1027367487 7:77473556-77473578 TCTTCTCTGTACTGTGAGAATGG - Intergenic
1027828398 7:83146710-83146732 GCTACTCTGGAGTCTGAGTGAGG - Intronic
1032165813 7:129543851-129543873 CCTGCCCTGGACTTTGAGTGAGG - Intergenic
1032664501 7:134022157-134022179 TTTTCTCTGTTCTATGTGTGTGG + Intronic
1036679298 8:10859224-10859246 TCTTCTCTGGAGCCTGAGTCAGG + Intergenic
1037385501 8:18335953-18335975 TCCTCTCTGGCCTTTTAGTGAGG - Intergenic
1040619969 8:49081076-49081098 TCAACTCAGGACTATGGGTGCGG - Intergenic
1042186238 8:66139007-66139029 TCTTTTCAGGAATATGAGTGTGG - Intronic
1042206919 8:66338751-66338773 TCTGCTCTGGAGTTTGACTGGGG + Intergenic
1042415909 8:68518545-68518567 TCTACCTTGGACTATGAGTTTGG - Intronic
1045245223 8:100436581-100436603 CCTTCTCTGGTCTCTGAGAGAGG + Intergenic
1045511569 8:102815867-102815889 TCTTGTCTGGAGTGTGACTGGGG - Intergenic
1048206313 8:132418024-132418046 TCTCCTCTGGAAGATGAGGGGGG - Intronic
1048656480 8:136543382-136543404 TCTTCTATGGATCATGAGTTTGG + Intergenic
1050310283 9:4345675-4345697 TCTACTCTGGAAAATGAGTTTGG - Intronic
1056935091 9:90910451-90910473 TCCTCTCTGAGCTAGGAGTGAGG - Intergenic
1059491116 9:114668055-114668077 TGTGCTCTGGAATATGACTGGGG + Intergenic
1060048001 9:120355970-120355992 TCCTCTGTGGACTCTTAGTGAGG + Intergenic
1060795912 9:126513263-126513285 CCTTCCCTGGAAGATGAGTGAGG + Intergenic
1060808124 9:126591326-126591348 TCATTCCTGGACTCTGAGTGGGG - Intergenic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1192247898 X:69388547-69388569 TTTTCCCTGGCCTCTGAGTGGGG - Intergenic
1194582460 X:95693010-95693032 TCTTCTCTGGACTAGTATAGAGG - Intergenic
1194606518 X:95985570-95985592 GCCTCTCTGGACACTGAGTGAGG - Intergenic
1195573262 X:106420609-106420631 TCTTCAGGGGACTATGTGTGTGG + Intergenic
1197231074 X:124004248-124004270 TCTTCTCTGGACTATGAGTGGGG - Intronic
1197750117 X:129958078-129958100 TGTTCTCTGCACTAGGAATGGGG - Intergenic
1199270760 X:145880196-145880218 TTTTCTCTGGTTTGTGAGTGGGG - Intergenic