ID: 1197231893

View in Genome Browser
Species Human (GRCh38)
Location X:124014335-124014357
Sequence ACATATATATAAAGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 454}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197231893_1197231896 26 Left 1197231893 X:124014335-124014357 CCTTCCATCCTTTATATATATGT 0: 1
1: 0
2: 7
3: 53
4: 454
Right 1197231896 X:124014384-124014406 ACAGTCTTGCTCTGTTGCCCAGG 0: 907
1: 9586
2: 39367
3: 94481
4: 164721
1197231893_1197231897 30 Left 1197231893 X:124014335-124014357 CCTTCCATCCTTTATATATATGT 0: 1
1: 0
2: 7
3: 53
4: 454
Right 1197231897 X:124014388-124014410 TCTTGCTCTGTTGCCCAGGCTGG 0: 19870
1: 65461
2: 149698
3: 191149
4: 205218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197231893 Original CRISPR ACATATATATAAAGGATGGA AGG (reversed) Intronic
900931086 1:5738132-5738154 ACAGATGGATAATGGATGGATGG + Intergenic
901159864 1:7167546-7167568 ACATATATATAGTGGTAGGAGGG - Intronic
901598688 1:10405424-10405446 ACATATATATAAATAATTGTGGG + Intronic
902366634 1:15979384-15979406 ACAAAAATATAAAGGGGGGAGGG - Intergenic
904049264 1:27628698-27628720 ACATATCTATATCAGATGGAGGG + Intronic
906455459 1:45993051-45993073 ACAACTATATAAAGGCTGGAAGG - Intronic
906863311 1:49386238-49386260 ACATATATTTTTTGGATGGATGG + Intronic
906923149 1:50086465-50086487 ATATATATATAAAAGCTGAATGG - Intronic
907076144 1:51580881-51580903 ATATATATATAATGGCTAGAAGG - Intronic
907625822 1:56028312-56028334 ACATATATGTACAGGTGGGATGG + Intergenic
908043288 1:60139748-60139770 ACATTGATATAAAGGAAGGATGG - Intergenic
909065218 1:70928112-70928134 AAATATATATATATGATGAATGG - Intronic
909091503 1:71231839-71231861 CCTGATATATAAATGATGGAAGG + Intergenic
909135232 1:71790517-71790539 ACATAAATATAAAAAATGCAAGG + Intronic
909217466 1:72908697-72908719 AAATATATTTAAAAAATGGATGG + Intergenic
909699372 1:78504684-78504706 ACATAAATACAAATGATGAATGG - Intronic
909954304 1:81758907-81758929 ATATACATATAAAGGAAGCATGG - Intronic
909982736 1:82123320-82123342 ATATATAAATAAAAGATGAAAGG + Intergenic
910553218 1:88499836-88499858 ACATATTTCTAGAGGATGGAAGG - Intergenic
911045732 1:93625776-93625798 TCATTCACATAAAGGATGGATGG + Intronic
911287511 1:96014454-96014476 ATATATATATACAGCATGCATGG - Intergenic
911287512 1:96014484-96014506 ATATATATATACAGCATGCATGG - Intergenic
911604495 1:99887611-99887633 ACACATAAATAAATGAAGGAAGG + Intronic
912985642 1:114426906-114426928 ATATAAATTTAAAAGATGGAGGG + Intronic
914925656 1:151884101-151884123 ATAAATAAATAAAGGAAGGAAGG + Intronic
915426271 1:155829779-155829801 GCATATCTATAAAGGAAGGTGGG + Intronic
916424009 1:164663353-164663375 ATCTCTAAATAAAGGATGGAAGG - Intronic
916836530 1:168551384-168551406 AGAAAAAAATAAAGGATGGAGGG - Intergenic
918576989 1:186073343-186073365 ACATATCAAGAAATGATGGAAGG + Intronic
918607690 1:186448595-186448617 TCATTTATAAAAAGGAAGGAAGG - Intronic
918776278 1:188635481-188635503 CTATATATATATAGGATAGAAGG + Intergenic
919009255 1:191938501-191938523 ATATATATATATAGGATTGCTGG + Intergenic
919059940 1:192619679-192619701 ACATACAAATATAGGATGGAGGG - Intergenic
919460058 1:197866180-197866202 AAATATATTTAGAGGATAGATGG + Intergenic
920755545 1:208727628-208727650 AGATAGATAGAATGGATGGATGG + Intergenic
921475316 1:215600074-215600096 AAAGATGTCTAAAGGATGGAGGG - Intronic
921659222 1:217779002-217779024 ACATATATAGAAATAATGTATGG + Intronic
921990689 1:221362861-221362883 TCATATACAAAAAGGATGAAGGG - Intergenic
922140430 1:222879610-222879632 ACATAAATAAAAAAGATGTAAGG + Intronic
922737155 1:227993038-227993060 ACATATATACAAATGTTGGCTGG + Intergenic
922922704 1:229320150-229320172 ACACATCTATAAAATATGGACGG - Intergenic
923103239 1:230834228-230834250 ATATATATATATATGCTGGAGGG + Intergenic
923370189 1:233302637-233302659 ATATATATATATATGATGGAAGG - Intergenic
923525977 1:234773167-234773189 ATATATATATAAAGAGTGGCGGG + Intergenic
923663942 1:235982247-235982269 ACATAGGTATAAAGGAAGGCTGG + Intronic
1063809560 10:9689072-9689094 ACATATATTTAAAGGAAAAAAGG + Intergenic
1064024993 10:11840978-11841000 ATATATATATATATGATGGTGGG + Intronic
1066229323 10:33416861-33416883 ATAGATGGATAAAGGATGGATGG + Intergenic
1067022298 10:42811872-42811894 ACATATTTATAAATAATGCATGG - Intronic
1067499779 10:46792884-46792906 ACATATATATAAAGGTCTGCAGG - Intergenic
1067594852 10:47547442-47547464 ACATATATATAAAGGTCTGCAGG + Intronic
1067641960 10:48055539-48055561 ACATATATATAAAGGTCTGCAGG + Intergenic
1068216591 10:53990598-53990620 ACATATATATAAAAGAAAGTTGG + Intronic
1068849773 10:61723819-61723841 ACATATAAATTGAGGCTGGAGGG + Intronic
1069649983 10:70039611-70039633 AGAAATAAATAAAGGAAGGAAGG - Intergenic
1070746138 10:78935147-78935169 ACAGATGAATAAATGATGGATGG - Intergenic
1071477146 10:86034798-86034820 ACAGATGTATGATGGATGGATGG + Intronic
1072407997 10:95172703-95172725 ACATATATATGCAATATGGAAGG + Intergenic
1073708452 10:106013428-106013450 ACATAAATATAAAAGAGGCAGGG - Intergenic
1074602260 10:114927018-114927040 ATATATATATATATGATGGGAGG + Intergenic
1074916437 10:117960370-117960392 GGATATATATGAAGGAGGGAAGG - Intergenic
1075906413 10:126085637-126085659 ACAGACAGACAAAGGATGGATGG - Intronic
1078024779 11:7684461-7684483 ATATATATATATAGGTTTGAGGG - Intergenic
1079590069 11:22172390-22172412 AAATATAAATGAAGGATTGACGG - Intergenic
1080790688 11:35520037-35520059 AAATATATATAAAGCATATACGG + Intronic
1082957424 11:58885419-58885441 CCATATATATGAAGGAGAGATGG - Intronic
1083014265 11:59436605-59436627 AAAGATATATAAAGAAAGGATGG - Intergenic
1083795768 11:65015777-65015799 CCATATATATATAGTATGTATGG - Intronic
1084852741 11:71956036-71956058 ACACATACATAAAGGATGCCTGG + Intronic
1085028328 11:73253524-73253546 ATATATATATATAGTAGGGATGG + Intergenic
1085211295 11:74781736-74781758 ACATATATATAAGGCATAGTGGG + Intronic
1085509274 11:77079077-77079099 AGATTTATATGAAGGATGCAAGG - Intronic
1086075493 11:82846657-82846679 GCATATATATAAAGCATAAAAGG + Intronic
1086467615 11:87071422-87071444 ACATTTAAATAGAGTATGGATGG + Intronic
1086480791 11:87236159-87236181 ACATATATAGACGGGATAGAAGG - Intronic
1087690130 11:101311255-101311277 ATATATATATATAAAATGGATGG - Intergenic
1090311049 11:125740455-125740477 AAATATATATAAACAATGCAAGG + Intergenic
1090910269 11:131112039-131112061 ACATATGTATAATGTATTGATGG - Intergenic
1090986005 11:131766693-131766715 ACATATATATAACCCAAGGAAGG - Intronic
1091131786 11:133152729-133152751 ATATATTTATAAAGGAATGAAGG - Intronic
1091468854 12:709189-709211 ATATATATATAAGAGATGGCTGG - Intergenic
1092321529 12:7481561-7481583 ACATATATAGTGAGAATGGAGGG - Intronic
1092688171 12:11074332-11074354 ACATTTTTATAAAGTAGGGAGGG + Intronic
1094459080 12:30673870-30673892 ACATATTTATAGAGGATGGAAGG - Intronic
1095266775 12:40169441-40169463 ACTTATGTACAAAGCATGGAAGG + Intergenic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1095676918 12:44931108-44931130 ACTTTTATACAAAGGAAGGAAGG + Intergenic
1095857407 12:46875181-46875203 AAATATAAACAAAGGAAGGAAGG + Intergenic
1097372218 12:58798214-58798236 ACAAATATATAATGCATGCAGGG - Intronic
1097704826 12:62857228-62857250 ACAAACAAATAAAGGAAGGAAGG + Intronic
1098130994 12:67349512-67349534 ATATATATAAAAAGGTTGTAGGG - Intergenic
1098194818 12:67988418-67988440 ACACACATATAAAAGAGGGAGGG + Intergenic
1098880102 12:75908361-75908383 AGATTTATATAAAGGAAGAAAGG - Intergenic
1099374227 12:81877346-81877368 GCATATATATAAATCATGTATGG - Intergenic
1099906643 12:88779159-88779181 AAATAAATAAAAAGGAAGGAAGG + Intergenic
1100372904 12:93985176-93985198 ACATATGTATACATGATGGCAGG + Intergenic
1100906250 12:99303393-99303415 AGATATACATAAATGATTGATGG - Intronic
1102226478 12:111232217-111232239 ATATATATATACAGGAGGGTTGG + Intronic
1102660936 12:114527712-114527734 AGATATAAGTAAAGGAAGGAAGG - Intergenic
1102840341 12:116113664-116113686 AAATAAATAAAAAGGAGGGAGGG + Intronic
1102981366 12:117243924-117243946 AAATATATAGGATGGATGGATGG - Intronic
1105299848 13:19123364-19123386 ACAAATAAATACAGGAAGGAAGG - Intergenic
1106510972 13:30412313-30412335 ACATATATAGAAAGAAAGGCAGG + Intergenic
1106764377 13:32899214-32899236 ACATATATATCAAGAAAGGCAGG + Intergenic
1106839068 13:33666909-33666931 ACATATATTTAAAAAGTGGATGG + Intergenic
1107772627 13:43805575-43805597 ACAAATATCTAATGCATGGAAGG - Intergenic
1108094445 13:46886374-46886396 AAATATAAATATAAGATGGAAGG + Intronic
1108560608 13:51640498-51640520 ACATATCTATAAAGGATAACTGG + Intronic
1108826025 13:54413607-54413629 ATATATATATATATGAAGGATGG + Intergenic
1108877709 13:55068106-55068128 ACATATAAATAAATGGTGGAGGG - Intergenic
1109227555 13:59714670-59714692 ACTGATATAGACAGGATGGATGG - Intronic
1109307076 13:60652626-60652648 ACATATATATATATGATTGATGG - Intergenic
1109382562 13:61583802-61583824 GCAAATATATAAAGGATACAGGG + Intergenic
1109587554 13:64426507-64426529 ACAAATATATGAGAGATGGATGG - Intergenic
1109619377 13:64881015-64881037 ACATATATATAAAGCATACATGG - Intergenic
1109738267 13:66516512-66516534 ACATGTTTGTAAAGGATGAACGG + Intronic
1110484714 13:76024886-76024908 ACATATGTATAAAGAATGGATGG + Intergenic
1110807125 13:79768831-79768853 GAGCATATATAAAGGATGGATGG + Intergenic
1111565389 13:90007682-90007704 ACAAACAAACAAAGGATGGAAGG + Intergenic
1111565706 13:90012550-90012572 CCTTTTATATAAAGGATGGCAGG + Intergenic
1112591913 13:100771367-100771389 AAAAATATATAAAGGAAGGAAGG - Intergenic
1112706248 13:102072374-102072396 ATAAATAAATAAAGGATGGAGGG + Intronic
1113798325 13:113073076-113073098 ACATACATTTAAAGAATGGATGG - Intronic
1113901142 13:113798815-113798837 AGATAGATGTAGAGGATGGAAGG + Intronic
1114852920 14:26402071-26402093 ACATATACAGAAGGAATGGAAGG - Intergenic
1115789215 14:36859995-36860017 ATATATATATCAATGAAGGAAGG + Intronic
1117585747 14:57201586-57201608 ATATATATATAAAGGATGGCTGG + Exonic
1118581883 14:67308779-67308801 ACATATATATACAATATGGGAGG - Intronic
1119468744 14:74880503-74880525 ACACAGATATAAAGGATGATGGG + Intergenic
1121581642 14:95036537-95036559 ATAAATAAATAAAGGATGTATGG - Intergenic
1122890617 14:104730614-104730636 ACATATATAAAATGCCTGGAGGG + Intronic
1124886292 15:33689402-33689424 ACATATATATATAGTATCCATGG - Intronic
1125379992 15:39077455-39077477 ACATAAATATAAAGCAAGGAAGG + Intergenic
1125905988 15:43393172-43393194 AAATATTTATCAAGGATGAATGG - Intronic
1126080936 15:44960911-44960933 ATATAGATATAAATGAAGGATGG - Intronic
1126935227 15:53699709-53699731 ATAAATATATAAAGAATGAAAGG + Intronic
1128360436 15:66957899-66957921 ATAAAAATATAAAGGAAGGAAGG - Intergenic
1128530625 15:68443555-68443577 ACAGATATAGAAAGGTTGAAAGG - Intergenic
1130283215 15:82535099-82535121 ATATATATATAAAGAATATATGG + Intergenic
1131814579 15:96208991-96209013 ACATATATATATATGAGAGATGG + Intergenic
1132100486 15:99019535-99019557 ACACATATATGAAGGAAGGAAGG + Intergenic
1133390036 16:5402838-5402860 ATATATCTATATTGGATGGACGG - Intergenic
1133490178 16:6260563-6260585 AGATATATATAAAGAAGGCATGG + Intronic
1134781941 16:16906115-16906137 ACAAATATATGTGGGATGGATGG + Intergenic
1135066622 16:19315180-19315202 ACAGATAAATGATGGATGGATGG + Intronic
1137577571 16:49612301-49612323 ATATATATATCAAGGATGCAAGG + Intronic
1138228132 16:55316475-55316497 ACATATAAATAAAGGAAAGGCGG - Intergenic
1138281774 16:55777686-55777708 ACATATTTAGCATGGATGGATGG - Intergenic
1138287096 16:55818729-55818751 ACATATTTAGCATGGATGGATGG + Intronic
1138889972 16:61129627-61129649 AGATCTATATAAAGAAAGGAAGG - Intergenic
1139094483 16:63688513-63688535 ACAGAAATATAAAGGATCGTAGG + Intergenic
1140774343 16:78236316-78236338 ACATACTTACAAAGGATGGTGGG + Intronic
1141026590 16:80554519-80554541 ACCTATATCTAAAAGATGGCTGG + Intergenic
1141052033 16:80776548-80776570 ATATATAAATAAAAGATGGATGG - Intronic
1141406777 16:83801492-83801514 ACAGATATATAGATGATAGAAGG + Intergenic
1143413503 17:6727437-6727459 ATATATATATAAAACATGGACGG - Intergenic
1144030887 17:11322161-11322183 ACCAATAGACAAAGGATGGAAGG - Intronic
1144255940 17:13467175-13467197 ATATATATATATAGGAAGGAAGG - Intergenic
1144256029 17:13469494-13469516 GTATATATATATAGGAAGGAAGG + Intergenic
1146396016 17:32467539-32467561 ACATACATATAAAGGAGGCCGGG - Intronic
1148710857 17:49679579-49679601 ATAAATAAATAAAGGAAGGAAGG + Intergenic
1149618841 17:58025680-58025702 ACATATGTATAAAAGATAGATGG - Intergenic
1149853685 17:60059078-60059100 ACACATAGGTAGAGGATGGATGG - Intronic
1149864556 17:60143563-60143585 GCATATAGATAAAGGCTGCAGGG + Intergenic
1150386863 17:64768171-64768193 ACATGTATATAAATAAGGGAGGG + Intergenic
1150510897 17:65752058-65752080 ACATATAGACAGATGATGGATGG - Intronic
1150749598 17:67847932-67847954 ACATATATATAAACCATGAATGG - Intronic
1151353379 17:73544607-73544629 ACAGATGGATAATGGATGGATGG + Intronic
1152476023 17:80518739-80518761 ACACATATATGGAGGATGGATGG - Intergenic
1153186500 18:2492022-2492044 ACATATATATAAATGCTCAAAGG + Intergenic
1153944240 18:10004703-10004725 ATATATATATAAAGGATGAAAGG - Intergenic
1154352197 18:13593597-13593619 AGATATATAAATAGGATGGATGG - Intronic
1155027112 18:21951367-21951389 AGATATACATAAAGGCTTGATGG - Intergenic
1155133044 18:22957953-22957975 ATATATATATTAAGGTTGAAAGG - Intronic
1156052734 18:32956950-32956972 AAATATTTCTAAAGGAAGGAAGG + Intronic
1156433337 18:37099770-37099792 GCATATATATTTAGGATGGTTGG + Intronic
1156434675 18:37113955-37113977 GCATATATATTTAGGATGGTTGG - Intronic
1157130475 18:45002560-45002582 ATATAAATATAAAAGATCGAGGG - Intronic
1157946299 18:51984453-51984475 TCCTGTATATAAAGAATGGAAGG + Intergenic
1158239880 18:55365277-55365299 ACACATATATATATGATGGCTGG + Intronic
1158254587 18:55531517-55531539 ACATACATATAAATCATGCATGG + Intronic
1158340460 18:56460457-56460479 ACATATGCATACTGGATGGAGGG - Intergenic
1158378502 18:56901481-56901503 ACAGATAAATAAATGATGGTTGG + Intronic
1158438162 18:57449120-57449142 ACATCTATATACAGGAAGCATGG - Intronic
1158780420 18:60642830-60642852 TCACATAGACAAAGGATGGAAGG - Intergenic
1158989384 18:62853182-62853204 AAATATACATAAGGGAAGGAGGG - Intronic
1159782889 18:72679757-72679779 ATATATATATATAGGAATGAGGG + Intergenic
1159816891 18:73085476-73085498 ACAAATTTATAAAGAATGGAGGG - Intergenic
1160087708 18:75793849-75793871 ACATATTTATAAATAATGCATGG + Intergenic
1160226965 18:77019072-77019094 ACTCATAAATAATGGATGGATGG - Intronic
1163417681 19:17196266-17196288 AGATATAGATGATGGATGGATGG + Intronic
1163462552 19:17447947-17447969 ACAAATATAGAATGGAGGGAGGG + Intronic
1166612363 19:44210257-44210279 ACACATAAATTATGGATGGAAGG - Intronic
1167634244 19:50644789-50644811 AGAATTAGATAAAGGATGGATGG + Intronic
925041732 2:736308-736330 CCATATAGATAAATGATAGATGG - Intergenic
925198215 2:1944972-1944994 ACAGATATGTAAAGGATGTCTGG + Intronic
925480950 2:4273193-4273215 ACAAAAATATTAAGGATGGCTGG - Intergenic
927166618 2:20329493-20329515 GCATATATATACAGACTGGACGG + Intronic
927253689 2:21020924-21020946 ACAAACATATAAAGGAAGAAGGG - Intronic
927793278 2:26027650-26027672 ATAAATAAATAAAGGAGGGAGGG - Intergenic
928292309 2:30050211-30050233 ACATATATGCAAAGCATGGGTGG + Intergenic
928323967 2:30305331-30305353 AGATATATATAAAAGATGTCTGG - Intronic
929360271 2:41080198-41080220 ACATTTATTTAAAGTATGCATGG + Intergenic
929611328 2:43272946-43272968 AGACACATATAAATGATGGATGG + Intronic
930737823 2:54797463-54797485 ACAGGTATATATCGGATGGAGGG + Intronic
931113709 2:59141517-59141539 ACATATATAAAAAAGATGTATGG - Intergenic
931549077 2:63422873-63422895 ACAGAAAAAGAAAGGATGGATGG + Intronic
932846313 2:75139020-75139042 TTAAATACATAAAGGATGGATGG + Intronic
933039868 2:77450820-77450842 ACATATATATATAAAATAGATGG - Intronic
933056594 2:77677823-77677845 ACACATATAAAAATGATTGATGG - Intergenic
933203783 2:79481603-79481625 ACAAAAACCTAAAGGATGGAAGG + Intronic
933681015 2:85100798-85100820 AGATTTATCTCAAGGATGGAAGG + Intergenic
933757930 2:85654918-85654940 ATTTATATATACAGGCTGGAGGG - Intergenic
933926670 2:87098627-87098649 ACACATATAAAAATGATTGATGG - Intergenic
934488008 2:94735979-94736001 AAACATATATAAATGATTGATGG - Intergenic
935003509 2:99046019-99046041 ACATATATATTTAGGATAGTTGG - Intronic
935073994 2:99722744-99722766 AAATTTATATACAGAATGGAGGG + Intronic
935204371 2:100884927-100884949 ATATATATATAAAGGATCTTAGG - Intronic
935989890 2:108709761-108709783 CCAGATATATAAAGCAAGGAGGG + Intergenic
936018405 2:108976630-108976652 ACAAATAAATAATGGACGGATGG - Intronic
936789406 2:116133325-116133347 ACATATTTATAAAGCATTGATGG + Intergenic
937534703 2:122871658-122871680 ACACATATACACAGTATGGAGGG - Intergenic
939399025 2:141667850-141667872 ATATTTATAGAAAGAATGGATGG + Intronic
939993084 2:148894710-148894732 ATATATATATATAGGGTGGGAGG + Intronic
940018691 2:149133990-149134012 ACAAATAAATGAAGGAAGGAAGG + Intronic
941554215 2:166955442-166955464 AAATAAATATGAAGGATTGAGGG + Intronic
942041721 2:172071852-172071874 CCATTTGTCTAAAGGATGGAAGG + Intronic
943138419 2:183945826-183945848 ATATATATATAAAAGCAGGAGGG + Intergenic
943744726 2:191449857-191449879 TTATGTATATAAAGGATGGTGGG - Intergenic
944434916 2:199677679-199677701 ATACATATATAAAGCAAGGAAGG + Intergenic
945002478 2:205366104-205366126 AAATATGGATAATGGATGGATGG - Intronic
945404757 2:209431817-209431839 ACATGGATATAAAAGAGGGAGGG + Intronic
946260381 2:218485301-218485323 ATATATATTTAAAGGAAGGAAGG - Intronic
946408104 2:219502937-219502959 ATAAATAAATAAAGGAGGGAGGG - Intronic
947088743 2:226485838-226485860 ATATATATATAAAGGTGAGATGG + Intergenic
947176021 2:227368324-227368346 ATATATATATAAATAATAGATGG - Intronic
948137884 2:235650475-235650497 ACTAACATATAATGGATGGATGG - Intronic
1169096483 20:2903772-2903794 AAATATTTTTAAAGGAAGGAAGG + Intronic
1169538694 20:6576554-6576576 ACATTTTTTTAAATGATGGAAGG + Intergenic
1170223751 20:13967848-13967870 GCATATATATGAGGGATAGAAGG + Intronic
1170248888 20:14257309-14257331 ACATCTATATAAAGAATTAATGG - Intronic
1170269423 20:14507677-14507699 ACATATATTTAAAGAATTAAAGG + Intronic
1171837501 20:30170526-30170548 ACATATATATAGAAAAGGGAAGG - Intergenic
1172143038 20:32737206-32737228 ACATATATATAAAGTTTAGCTGG + Intronic
1173086824 20:39928193-39928215 AATTATATTTAAAGGATGAATGG + Intergenic
1173538652 20:43834886-43834908 ACAGATAGATGAATGATGGATGG + Intergenic
1173939382 20:46896547-46896569 AAAGATATGTAAAGGATGAAGGG - Intronic
1175037959 20:56018094-56018116 TCAAATATAAAAAGGATGTATGG - Intergenic
1175666363 20:60863661-60863683 ACAGATAAATAAAGGAAGGAAGG + Intergenic
1175705423 20:61173018-61173040 ACATATATATATGGGGTGGGTGG + Intergenic
1176982670 21:15401150-15401172 ACACATATAGAAAGGATGAGGGG - Intergenic
1177342481 21:19823251-19823273 ACATATAGATCAAGGAGAGAAGG + Intergenic
1179831665 21:44000776-44000798 ACATTTATTTAAAGGATGCAGGG + Intergenic
1181737163 22:24891359-24891381 AAAAAAATATAAAGGATGGAGGG + Intronic
1183932417 22:41243350-41243372 TCATATATTTATAGAATGGAAGG - Intergenic
949634670 3:5969525-5969547 ATAAATAAATAAAGGAAGGAAGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951050521 3:18088510-18088532 ATAGATAAATAATGGATGGATGG - Intronic
951263076 3:20534825-20534847 ATGTATATATGAAGGATGAAGGG - Intergenic
951273783 3:20659855-20659877 CCATATATATGAAAGAAGGAAGG - Intergenic
952169469 3:30791024-30791046 ATGTATATACAAAGTATGGAAGG + Intronic
952650431 3:35720154-35720176 AAATATTAATAGAGGATGGAGGG + Intronic
954931957 3:54291078-54291100 ACCTACATACACAGGATGGATGG + Intronic
955068281 3:55551192-55551214 ACACATATATATATTATGGAGGG + Intronic
955810079 3:62778795-62778817 ATATTTTTATAAAGGATGAAAGG + Intronic
956487170 3:69735205-69735227 AAATACATATAAAGTATGTATGG - Intergenic
956555214 3:70513921-70513943 AAATATTTATTAAGGAAGGAAGG + Intergenic
956851605 3:73233129-73233151 ACATAAATATATAGGGTGGGTGG + Intergenic
956896135 3:73662103-73662125 ACATATCTCCAAATGATGGAAGG - Intergenic
957170058 3:76726781-76726803 ACAAATATATAAAAGAGTGAAGG + Intronic
957188367 3:76973189-76973211 AAATATAAATAAAGGAGGAAAGG - Intronic
957364738 3:79208300-79208322 ACAAGAATAAAAAGGATGGAAGG - Intronic
957650354 3:82994406-82994428 ATATATATATATATGATGTATGG - Intergenic
957935840 3:86941106-86941128 ACATATATTTAAAGGGAAGATGG - Exonic
959180001 3:102966882-102966904 ACAAATATACAAAGATTGGAAGG - Intergenic
959209252 3:103355824-103355846 ACATAATTTTAAAGGAAGGATGG - Intergenic
959770423 3:110088916-110088938 ACATAAGTATAAAGCATAGAGGG - Intergenic
960640934 3:119822232-119822254 ATATATATATAAAGGACTGTGGG - Intronic
960741130 3:120835219-120835241 ACATATAAAGAAAGGATGGAAGG - Intergenic
960741131 3:120835223-120835245 ACAGACATATAAAGAAAGGATGG - Intergenic
961143671 3:124576355-124576377 ATATTTATAGAAAGGAGGGACGG + Intronic
962490408 3:135888192-135888214 ACATATATTACAGGGATGGAAGG + Intergenic
962641185 3:137388323-137388345 ACATATGTATATATAATGGATGG - Intergenic
962719314 3:138158012-138158034 ACAAATATAGAAAGGAAGGAAGG - Intergenic
963029578 3:140955230-140955252 ACATATATATAAAGGAAAGCAGG - Intronic
963206485 3:142641413-142641435 ACATATATATAAATGATAATAGG - Intronic
963296743 3:143554846-143554868 ACAGATATCTGAAGGAGGGAAGG - Intronic
963337161 3:143988390-143988412 ACATATATACACAGGCTGGGCGG - Intronic
963682520 3:148397224-148397246 ACATATATAAGGTGGATGGAGGG + Intergenic
963980893 3:151535666-151535688 ACATATATATAAAGTATGGTAGG + Intergenic
965377475 3:167943299-167943321 ACACAAATACAAAGGCTGGAAGG + Intergenic
965431315 3:168592703-168592725 ATATATGTATAAGGGATAGATGG + Intergenic
967077321 3:186015171-186015193 ACATTGACATAAATGATGGAAGG - Intergenic
967210924 3:187167917-187167939 AAATATATCTTAAGGATGGCCGG - Intronic
967401923 3:189072781-189072803 ACAGATAAATGATGGATGGATGG - Intronic
967599309 3:191365828-191365850 TTAAATATATAAGGGATGGAGGG - Intronic
968684086 4:1944730-1944752 GCAGATATATAAAGGCTTGATGG - Intronic
968695124 4:2020902-2020924 AAAAATAAATAAAGGAAGGAAGG - Intronic
969385616 4:6844877-6844899 AAATATATGTAAAGGATACAGGG + Intronic
970042679 4:11813549-11813571 AAATAGAGAAAAAGGATGGAAGG - Intergenic
970865057 4:20748549-20748571 ATATATATATAAAATTTGGAAGG - Intronic
971828603 4:31660691-31660713 AGATAAATATAAAGGATCAAAGG - Intergenic
972065126 4:34933405-34933427 ACATATATCTAATGCATGCAGGG - Intergenic
972855469 4:43100681-43100703 ATATATATATAAAGTGTGGCAGG + Intergenic
972987424 4:44781085-44781107 ACATATCTATAAGGGAAGGAAGG - Intergenic
973113429 4:46424279-46424301 ACCAAAATATAAGGGATGGAGGG + Intronic
974684777 4:65213341-65213363 ATATATATTTATAGGAAGGAAGG - Intergenic
975361017 4:73472264-73472286 ATATATATATTTAGGATGGTTGG + Intergenic
975539925 4:75498386-75498408 ACATTTAAAGAAAGGAAGGAAGG + Intronic
975551926 4:75621979-75622001 ACATATATCTGATGGGTGGAGGG + Intronic
976870038 4:89780588-89780610 ATATATATATAAAGCATAGGGGG + Intronic
977831837 4:101603359-101603381 ACATATATAAAATAGTTGGAGGG + Intronic
978590211 4:110316499-110316521 ACAAAAATATAAAGGATGTAAGG + Intergenic
978913389 4:114093378-114093400 ACATATATATTGAAGATGAATGG - Intergenic
979069814 4:116187618-116187640 ACATAAAAAAGAAGGATGGAAGG - Intergenic
979210580 4:118096567-118096589 TGATATATATAAAAGATAGACGG + Intronic
979556764 4:122056520-122056542 AGATCAATATAATGGATGGAAGG - Intergenic
979821895 4:125184946-125184968 ACATATATATACAATATGTATGG + Intergenic
980530237 4:134043885-134043907 ACATATATATACAGCATATATGG - Intergenic
980936704 4:139232672-139232694 ACAAATTTATATAGGATGGGAGG + Intergenic
981499397 4:145433515-145433537 ACAGATATTCAAAGGATGGTAGG - Intergenic
981904209 4:149902301-149902323 AAAGATATATAAAGAATGGAGGG + Intergenic
982421275 4:155201122-155201144 ACGTATATACAATGGAGGGAAGG - Intergenic
982818506 4:159917345-159917367 ACCAATATTTAAAAGATGGAAGG - Intergenic
983012490 4:162564676-162564698 ACAAATATCTAATGCATGGAGGG + Intergenic
983029501 4:162781944-162781966 CCATATCTATTAAGGATAGATGG - Intergenic
983335794 4:166390552-166390574 ATATATATCTAAAGGTGGGATGG - Intergenic
983821585 4:172200377-172200399 AAATATATATAAATGATTCAAGG - Intronic
983933280 4:173476370-173476392 ATATATATATAATGAATTGAAGG + Intergenic
984730972 4:183067798-183067820 TCATATATTTAAAGGACTGAAGG + Intergenic
984815768 4:183834560-183834582 GCATTTATATAAGGGAAGGAAGG + Intergenic
985044492 4:185926469-185926491 ACTCATATATAAATGATGGGAGG + Intronic
986313200 5:6570017-6570039 ATATATATATAAAGGAAACAGGG + Intergenic
986487700 5:8255978-8256000 ATATATATATATAGGAAAGATGG + Intergenic
986815290 5:11403160-11403182 ACATATATCTAATGCATGCAGGG - Intronic
986937610 5:12909592-12909614 ACATATATATAAACCATCAATGG - Intergenic
987125930 5:14812694-14812716 ACATAGACATCAAGGGTGGAAGG - Intronic
987580863 5:19790338-19790360 TTAAATATATAAAGGAAGGAAGG - Intronic
987891551 5:23885214-23885236 ACAAACATTTAAATGATGGATGG + Intergenic
988438065 5:31199286-31199308 ACATATATATAGTGGACAGAAGG + Intronic
988438070 5:31199595-31199617 ATATATATATCATGGATAGAAGG + Intronic
988940656 5:36142409-36142431 ACATAAATATAAAGTCTGGATGG + Intronic
989548271 5:42699927-42699949 AGATATTCAGAAAGGATGGATGG + Exonic
989606906 5:43253141-43253163 ATATATATATAAAGGAATGAAGG - Intronic
994311755 5:98280711-98280733 AGATAGATAGATAGGATGGATGG + Intergenic
994320431 5:98388051-98388073 ACATATATATGAAACATTGATGG - Intergenic
995784955 5:115817734-115817756 ACATGTATATACACGAGGGAGGG - Intergenic
995898631 5:117044178-117044200 ATATATATAGGATGGATGGATGG - Intergenic
995898632 5:117044182-117044204 CAATATATATATAGGATGGATGG - Intergenic
995956252 5:117780019-117780041 ACATATTTATAATGAATGAAGGG + Intergenic
996041145 5:118813227-118813249 AAATAAATATAAAGGATTGCAGG + Intergenic
996341952 5:122448544-122448566 ATATATATAAAAAATATGGAAGG - Intronic
996341954 5:122448571-122448593 AAATATATATAAAATATGGAAGG - Intronic
996409793 5:123145230-123145252 ACAAATATCCAAAGGTTGGATGG + Intronic
996586491 5:125093430-125093452 ACATATACATAAAAGATGCGAGG - Intergenic
997918904 5:137958354-137958376 ACCTATATAAAAAGGAGGGTGGG + Intronic
998570459 5:143252221-143252243 ACATATATACTAAGAATGGTTGG + Intergenic
999562113 5:152815291-152815313 ACATATATAAAAAGGAGACATGG - Intergenic
999681725 5:154066620-154066642 ATATATATAGAAAGGAAGGAAGG - Intronic
999711015 5:154318451-154318473 ATATATATATAAAAGACAGATGG + Intronic
999906540 5:156146998-156147020 ACAAATATATAATGAATGTACGG + Intronic
1000092904 5:157945808-157945830 AAATATATAAAAAAGAAGGAAGG - Intergenic
1000599098 5:163250704-163250726 ACATGTAAAAAAAAGATGGAGGG + Intergenic
1001404291 5:171464775-171464797 ACAGAGATATAAAGCAAGGAAGG - Intergenic
1002471165 5:179437033-179437055 GCATTTTTATTAAGGATGGAAGG - Intergenic
1004195874 6:13504972-13504994 ACATATGTCTCAAGAATGGATGG + Intergenic
1004377302 6:15101989-15102011 ACAAATAAAGAAAGGAAGGAAGG - Intergenic
1004463337 6:15859754-15859776 AAATATACATAAAAGATGAAAGG + Intergenic
1005188740 6:23193536-23193558 ACAAATAAATAAAGGATGGGTGG - Intergenic
1005646904 6:27848005-27848027 ATATAGATATAAGGGATGGAAGG - Intronic
1006279261 6:33035337-33035359 AAATATATTCAAAGAATGGAAGG - Intergenic
1006658173 6:35614826-35614848 ACATATACATACAGGCTGGCCGG + Intronic
1007419221 6:41709445-41709467 GCATGTATATAATGGATGGATGG + Intronic
1007632660 6:43281486-43281508 GCAGATGTAAAAAGGATGGACGG + Intronic
1008193564 6:48490611-48490633 ACATACAGAGAAAGGATAGAGGG - Intergenic
1008403272 6:51089479-51089501 ACTTATATTGTAAGGATGGAAGG - Intergenic
1008640033 6:53453061-53453083 ACATATTTTTAAAGGATTGGTGG + Intergenic
1009349529 6:62656993-62657015 ATGTATATATAAATGATGTAAGG + Intergenic
1009467454 6:63989827-63989849 ATATATATATAAAATATAGAAGG - Intronic
1009520512 6:64676589-64676611 ACATATATATACAAAATGTATGG - Intronic
1009676593 6:66831771-66831793 ACATATAGATAGATGATAGATGG + Intergenic
1009739554 6:67726320-67726342 ACTTAAATATAAACCATGGACGG - Intergenic
1009910580 6:69920843-69920865 ACATGTATAAAATGGAGGGAAGG + Intronic
1011959262 6:93067375-93067397 ACATCTGTACAAAGGAAGGAAGG + Intergenic
1012013022 6:93815702-93815724 ACATATATATAACTGTTGAATGG + Intergenic
1012071301 6:94620699-94620721 ACATATATATATACGATAGCTGG - Intergenic
1012169197 6:95997757-95997779 ATATATATATATAGTATTGATGG + Intergenic
1014273352 6:119359105-119359127 ATAATTATTTAAAGGATGGAGGG - Intergenic
1015060766 6:128962084-128962106 ACAAATTAATATAGGATGGAAGG - Intronic
1015247635 6:131092448-131092470 ATATATAAAAAAAAGATGGAAGG + Intergenic
1015387924 6:132647419-132647441 ACATATATATAAAGAGAAGAGGG + Intergenic
1016098193 6:140064159-140064181 ACATATATATAAAATATATATGG - Intergenic
1016554587 6:145322041-145322063 AGATATATATTAATGATGAAAGG + Intergenic
1017885028 6:158591843-158591865 ACATAGATACAAAAGATGGAAGG - Intronic
1018638012 6:165881832-165881854 AAATATATATGTATGATGGAGGG - Intronic
1019567272 7:1690535-1690557 ACAGATATATGGATGATGGATGG + Intronic
1019971548 7:4545022-4545044 ACACATATAAAAATAATGGATGG + Intergenic
1020473380 7:8565501-8565523 ACATAAATATAAAGGAGAGAGGG + Intronic
1020476568 7:8601991-8602013 ACATATATATAAGAGATTGGAGG - Intronic
1021546358 7:21817327-21817349 ACATATAAAAAGAGGATGGAAGG - Intronic
1022175949 7:27871879-27871901 ACACACATGTCAAGGATGGAAGG + Intronic
1022513284 7:30957056-30957078 AAATATATATCAAGGATTCAAGG - Intronic
1023065398 7:36372806-36372828 ACATATGTAAAAATGATGGCTGG + Intronic
1023199400 7:37678370-37678392 ACATATATATAAATTATAGCTGG - Intergenic
1023284473 7:38604939-38604961 TCATTTTTATGAAGGATGGAGGG - Intronic
1026299867 7:69088340-69088362 ATAGATAGATAAATGATGGATGG + Intergenic
1026696943 7:72603313-72603335 ACAGATAGATGATGGATGGATGG + Intronic
1027063263 7:75102979-75103001 ACATATATATAAAATAAGGCTGG + Intronic
1027346589 7:77266540-77266562 TCATATGTATAAAGGAAGGAAGG - Intronic
1027694334 7:81390177-81390199 ACAAATATATAAAAGATGGGTGG - Intergenic
1027748421 7:82108504-82108526 ACATATAAATTGGGGATGGAGGG + Intronic
1028245826 7:88475910-88475932 AGAGATATATGATGGATGGATGG - Intergenic
1028804834 7:95012967-95012989 ACATATACAAAAAAAATGGAAGG - Intronic
1028999037 7:97133553-97133575 ACCTAAAAATAAAGGATTGAGGG - Intronic
1029804736 7:102984378-102984400 ATATATATCTAATGGATGGATGG - Intronic
1031518520 7:122733145-122733167 AGATATATATGAAGCATGGTTGG - Intronic
1031762073 7:125725818-125725840 ACATATTAATAAAGGATAGTAGG - Intergenic
1032144773 7:129369044-129369066 ATATATATATAAAGGATAGCTGG - Intronic
1032918394 7:136517969-136517991 ATATATAAAGAAAGGAGGGAAGG - Intergenic
1033514039 7:142088549-142088571 ATAGATAGATAGAGGATGGATGG - Intronic
1033766199 7:144493053-144493075 ATAAATATATAAAGAATGGTAGG + Intronic
1033995321 7:147338818-147338840 AGATATATAAAAAGTTTGGAAGG + Intronic
1034160967 7:148994061-148994083 AAATAAAAATAAAGGCTGGAGGG - Intergenic
1034220853 7:149445045-149445067 AAATAAAAATAAAGGATGGAAGG - Intronic
1034438822 7:151076442-151076464 ACTTAAATAAAAAGGAGGGAGGG - Exonic
1035306001 7:157931926-157931948 ACATATTTTTAAAGGGGGGAGGG - Intronic
1035920755 8:3673641-3673663 ACTTATATATAAAGCATTTACGG + Intronic
1036928170 8:12927857-12927879 ACAGATTTAAAAAGGAAGGAAGG + Intergenic
1038469522 8:27802303-27802325 AAAAATATATATAGGCTGGACGG + Intronic
1038821959 8:30960195-30960217 ACATATATATATAGTAGAGAGGG - Intergenic
1038926126 8:32141620-32141642 ATATATATATGAATGATGCATGG + Intronic
1039622000 8:39006251-39006273 ACAGAAATATAAGGGATTGATGG + Intronic
1040349545 8:46550526-46550548 ACATATATATAAATTTTGAATGG + Intergenic
1040447363 8:47508931-47508953 ATATATATATATAAAATGGAAGG - Intronic
1040625918 8:49149914-49149936 ACATAGATATGAATTATGGATGG - Intergenic
1042750638 8:72154059-72154081 ACATATTTACAAGGCATGGATGG + Intergenic
1042812654 8:72843631-72843653 ACATATATATTTAGGATAGTTGG + Intronic
1043023888 8:75042548-75042570 ACATACATATATATGAAGGAGGG - Intergenic
1043061754 8:75514092-75514114 AGAAATATATAAAGGAAGAATGG - Intronic
1043460884 8:80458913-80458935 ACATATCTATCAAGAATGAATGG + Intergenic
1043729560 8:83657702-83657724 ACATATACATGAAAGATTGAGGG - Intergenic
1044205601 8:89489371-89489393 ACACAAAAATAAAGGAAGGAAGG + Intergenic
1044351870 8:91176107-91176129 ATATATATATATATGAGGGATGG - Intronic
1045066425 8:98450734-98450756 ACATGTAGAAAAAGGATGCAGGG - Intronic
1045358991 8:101414584-101414606 AAATATATGTAAGGCATGGAAGG + Intergenic
1045639192 8:104228630-104228652 GTATAAATATAATGGATGGATGG - Intronic
1045761537 8:105613846-105613868 ACATTTATAAAAAGAATGGAAGG + Intronic
1046032819 8:108804100-108804122 ACATTTATATAAAGGATCCATGG - Intergenic
1046254369 8:111676879-111676901 ACATATAGAAAATGGATGTAAGG - Intergenic
1047306893 8:123659701-123659723 ACAGATGGATAAATGATGGATGG - Intergenic
1048180658 8:132191526-132191548 ATATATATATAATATATGGATGG + Intronic
1050006621 9:1138796-1138818 TCAGATATATAAAACATGGAGGG - Intergenic
1050550707 9:6746235-6746257 ATATATATATAATGGCTGGCTGG - Intronic
1050853664 9:10322558-10322580 ACTTATATATTAAGGTTTGAGGG - Intronic
1051037622 9:12767460-12767482 AAATATATATATATAATGGAAGG + Intergenic
1051043268 9:12841424-12841446 ACAGAGAGATAAAGGATTGATGG - Intergenic
1052295257 9:26890647-26890669 ACATATACATAAAAGTTGGCCGG + Intronic
1052614992 9:30826868-30826890 TCAGATATATAAAGGATGATGGG - Intergenic
1052909126 9:33864367-33864389 ACATATATATAACTCATGAATGG - Intronic
1053050082 9:34954164-34954186 ACACACACACAAAGGATGGAAGG + Intergenic
1053074611 9:35122293-35122315 AAATATATTTAAAGAATGGCCGG - Intergenic
1053336050 9:37272575-37272597 ACATATATATGAAAGAGGGGAGG - Intronic
1055003457 9:71479838-71479860 TCATATATATGAAGGATGGATGG - Intergenic
1055271943 9:74570585-74570607 ACATAAATATTAAGCATGGCTGG + Intronic
1055435235 9:76286315-76286337 ACACATATTCAAAGGATTGATGG - Intronic
1055742785 9:79408048-79408070 ACAAAGATAGAAGGGATGGAAGG + Intergenic
1055831927 9:80389982-80390004 ACATATATATATATGGAGGATGG + Intergenic
1055949430 9:81716903-81716925 ACATATATATAAAGGCTCGCTGG + Intergenic
1056572902 9:87831726-87831748 ACATACATAGACAGGAGGGAGGG + Intergenic
1058219890 9:102285540-102285562 ATAAATATATAAAGTATGCAGGG + Intergenic
1060686356 9:125616989-125617011 ACATATAGATAAATGATATATGG - Intronic
1061552658 9:131346887-131346909 ATATTTATAAAATGGATGGATGG + Intergenic
1185481886 X:452577-452599 ACAAATACATACAGGATAGATGG - Intergenic
1185622344 X:1458999-1459021 ACATAGATAAACAGAATGGATGG - Intergenic
1185622393 X:1460303-1460325 ACATAGATAAACAGAATGGATGG - Intergenic
1185629966 X:1508693-1508715 AGATAGATAGAATGGATGGATGG - Intronic
1185753910 X:2637430-2637452 GGATATATATACAGGATGGGTGG + Intergenic
1185808595 X:3083202-3083224 AGATACAAATAAATGATGGATGG - Intronic
1185809409 X:3092013-3092035 ACAGATATATAGATGATAGATGG + Intronic
1185831500 X:3307383-3307405 ATAGATAGATAAATGATGGATGG - Intergenic
1186178646 X:6951232-6951254 AGATAGATATGATGGATGGATGG - Intergenic
1186308077 X:8286695-8286717 ACAAATATAAGATGGATGGATGG - Intergenic
1186699365 X:12072908-12072930 ATATATATATAAATAATAGAAGG - Intergenic
1187035567 X:15535728-15535750 ATATATAGAAAAAGGAAGGAGGG + Intronic
1187607646 X:20904205-20904227 AAATATATATTAAGGATAGCTGG - Intergenic
1187747416 X:22424550-22424572 ACATATGTATACAAGGTGGAAGG + Intergenic
1187935935 X:24335907-24335929 GTATATATATATAGGAGGGAGGG - Intergenic
1188142736 X:26572166-26572188 ACATATATATGTAAGAAGGATGG - Intergenic
1189701009 X:43716298-43716320 GGGTAGATATAAAGGATGGATGG + Intronic
1189829129 X:44952722-44952744 ACACACACAAAAAGGATGGAGGG - Intronic
1190166097 X:48074081-48074103 ATATATATATAAAACAGGGAAGG - Intergenic
1192751261 X:73994411-73994433 ACATTTTTATAAAACATGGAAGG - Intergenic
1193337783 X:80311368-80311390 ACATTTACAAAAACGATGGAAGG + Intergenic
1193654371 X:84181875-84181897 AGATATATGAAAAGGGTGGAGGG - Intronic
1193948866 X:87773544-87773566 ACATAAAAAGAAAAGATGGAAGG - Intergenic
1193995248 X:88358811-88358833 ACAGATATATAAAGGAAGTGTGG + Intergenic
1194009256 X:88538047-88538069 ACACATATATATAGGATAGTTGG + Intergenic
1194027111 X:88765813-88765835 AAATATATTTAAAGGCTGAATGG + Intergenic
1194222658 X:91214799-91214821 GCAGAAATATGAAGGATGGAAGG + Intergenic
1195130605 X:101847262-101847284 ACATACATGGAAAGGAAGGAAGG - Intronic
1195458796 X:105100392-105100414 ATAAATAAATAATGGATGGAGGG + Intronic
1197231893 X:124014335-124014357 ACATATATATAAAGGATGGAAGG - Intronic
1198409851 X:136355537-136355559 ATATATATATATAACATGGACGG + Intronic
1198421344 X:136472982-136473004 ACATAAAAATAAGGGAAGGAAGG + Intergenic
1198945919 X:142013710-142013732 AAATATATATTGAAGATGGATGG + Intergenic
1199354574 X:146846913-146846935 AGATATTTAGAAAAGATGGAAGG - Intergenic
1200559189 Y:4678564-4678586 GCAGAAATATGAAGGATGGAAGG + Intergenic
1201245090 Y:11995603-11995625 ATAGATAGATAAATGATGGATGG + Intergenic
1201245096 Y:11995660-11995682 ACAGATAAATAAATGATGGATGG + Intergenic
1201535272 Y:15040829-15040851 TCATATATATTAAGTATGAATGG - Intergenic
1201584355 Y:15544684-15544706 ACATAATTACAAAGGCTGGATGG - Intergenic
1201731420 Y:17208145-17208167 ACATATGTATACAAGGTGGAAGG + Intergenic
1201755237 Y:17480052-17480074 ATATATATATTAAAGGTGGATGG - Intergenic
1201846315 Y:18425933-18425955 ATATATATATTAAAGGTGGATGG + Intergenic
1201917402 Y:19196852-19196874 ATAGATATATAATGGGTGGATGG + Intergenic