ID: 1197232951

View in Genome Browser
Species Human (GRCh38)
Location X:124026070-124026092
Sequence TACCTGGTCTAGAAGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197232951 Original CRISPR TACCTGGTCTAGAAGACAAA AGG (reversed) Intronic
902994291 1:20211734-20211756 TCCCTAGGCTAGAAGAGAAAAGG + Intergenic
907059107 1:51402894-51402916 GACTTGGTCTTGAAAACAAAAGG + Intronic
908165664 1:61455288-61455310 TACCAGGACTGGAAGACAAAAGG - Exonic
915365508 1:155313275-155313297 GAACTGGTATAGAAGACAAGGGG - Intronic
917411298 1:174762509-174762531 TAGATGTCCTAGAAGACAAAGGG - Intronic
922228194 1:223663949-223663971 ATCATGGTTTAGAAGACAAAAGG + Intronic
923854446 1:237830515-237830537 CATTTGGTCTAGAAAACAAAGGG - Exonic
1063382545 10:5595061-5595083 TACCTGGTCGGTAACACAAAGGG - Intergenic
1064641649 10:17421184-17421206 TACCTGGGGTAGAACACAACTGG + Intronic
1065349382 10:24782036-24782058 TACCTGGTCTAAGAGACATGTGG - Intergenic
1065720529 10:28624614-28624636 TTCCTGTTCTAGAAGTCAGAAGG - Intergenic
1068363093 10:56006435-56006457 TATCTTGTCTGGCAGACAAATGG - Intergenic
1068844969 10:61661858-61661880 TATTTGGTCTAAAAGACAATGGG + Intergenic
1072636935 10:97184613-97184635 TACTGGGTCTAGAAAAGAAAAGG + Intronic
1075009887 10:118858535-118858557 TACCTGCTGAAGAAGACACATGG + Intergenic
1075261035 10:120963962-120963984 CACCTGTCCAAGAAGACAAAGGG + Intergenic
1081851759 11:46278889-46278911 GACCTAGTCAAGAAGACATAGGG - Intronic
1087483441 11:98731567-98731589 TACTTGCTCTTGAAGAAAAAGGG - Intergenic
1088675542 11:112189020-112189042 AACATGGTCAAGAAGAAAAAAGG + Intronic
1089811740 11:121137822-121137844 CAGCTGGTCTGGAAGTCAAAGGG - Exonic
1090334737 11:125954806-125954828 TTTCTGGTGCAGAAGACAAAAGG - Intergenic
1093838827 12:23870676-23870698 TACCTGGTCTACAAAGCTAAAGG - Intronic
1093888301 12:24488994-24489016 TTGCTTGCCTAGAAGACAAATGG - Intergenic
1093924530 12:24896276-24896298 TACCTAGTCCAGAGGACAACGGG - Intronic
1097838359 12:64296546-64296568 TACCTGATTTAGATGACAATTGG + Intronic
1099623326 12:85032454-85032476 TACATGGTATAGAAGTCAAAAGG + Intronic
1104729502 12:131097248-131097270 TTCCTGGTCTGGAAAACAAGAGG + Intronic
1106286723 13:28324448-28324470 AACCTAGTCTAAAAGCCAAAAGG + Intronic
1108334927 13:49430434-49430456 TATCTATTTTAGAAGACAAATGG + Intronic
1110835195 13:80074799-80074821 TACCTGGTCGCAAAGACAGATGG - Intergenic
1112243329 13:97703832-97703854 AACCTGATAAAGAAGACAAAGGG - Intergenic
1118982964 14:70730862-70730884 TTCCTGGTCAAAAAGACAAAAGG + Exonic
1119974034 14:79005167-79005189 TTTCTAGTCTAGAATACAAATGG + Intronic
1127305617 15:57702970-57702992 TTTCTAGTCTAGATGACAAAAGG - Intronic
1130086999 15:80785956-80785978 TTACTAGTCTAGAAGACTAAAGG - Intronic
1131027303 15:89155275-89155297 TCACTGGTCTAGAAAACAAGGGG - Intronic
1138064559 16:53927160-53927182 TACATGGTCCAGAAGAGAGATGG + Intronic
1138864734 16:60803038-60803060 TAACAGGATTAGAAGACAAAAGG - Intergenic
1139262711 16:65610273-65610295 GACCTGGTCTACAAGGCATATGG - Intergenic
1139392438 16:66613323-66613345 TGACTGGTCCAGAAGACAGAGGG + Exonic
1140706496 16:77635319-77635341 TACTTGGTAAAGAAGAGAAAGGG - Intergenic
1141497125 16:84418109-84418131 TACCATGTCTAAAAGAAAAAGGG + Intronic
1143163126 17:4884399-4884421 GACCTGGTAAAGAACACAAAAGG + Exonic
1145888665 17:28399631-28399653 TGCCTGGACCAGAAGACAGAGGG - Exonic
1146735274 17:35233229-35233251 TACAAGGTCGAGAAGCCAAAGGG - Intergenic
1147545001 17:41394271-41394293 GACCTGGCCTAGAACAGAAAAGG + Intronic
1148659673 17:49319199-49319221 TACCCTGTCTAGTTGACAAAAGG + Intronic
1153775616 18:8450953-8450975 TAACTGGTAAATAAGACAAATGG + Intergenic
1155346446 18:24862052-24862074 TACATGGTCTATAAAGCAAAGGG + Intergenic
1157105387 18:44769877-44769899 TACATGGTCTAGATGGCACATGG - Intronic
1157932603 18:51839907-51839929 TACAGTGTCCAGAAGACAAAAGG + Intergenic
1158218103 18:55121592-55121614 TGTCTGGTCTAAAAGAAAAAAGG + Intergenic
1160306096 18:77738459-77738481 TACCTGGGGATGAAGACAAATGG + Intergenic
1164553492 19:29232315-29232337 TTCGTGTTCTAGAAGACAATGGG - Intergenic
926422265 2:12711697-12711719 TAGCTGGTCTAGCATTCAAAAGG + Intergenic
927286333 2:21360701-21360723 TGGCTGGTGTAGAAGACAGATGG + Intergenic
928346213 2:30499045-30499067 TACCTCATCTAGAATAGAAAGGG + Intronic
929337910 2:40773430-40773452 TACTTGGTGGAGAGGACAAAGGG - Intergenic
930337229 2:50064100-50064122 TAAATGGTCAAGAAGAAAAAAGG - Intronic
930717507 2:54606661-54606683 TAGCTGATCCAGGAGACAAAAGG + Intronic
930982517 2:57544921-57544943 TCACTTGTCTAGAAGAGAAAGGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933294581 2:80474487-80474509 TTCCTGGTTTAGAAGGCAAGAGG + Intronic
936819590 2:116503355-116503377 ATCCTGGTCTGGAAGACTAATGG + Intergenic
939828271 2:147041954-147041976 TTCCTGTCCAAGAAGACAAAGGG - Intergenic
940915104 2:159245782-159245804 TAAATTGTCTAGAAGAAAAAAGG + Intronic
942058761 2:172208549-172208571 TACCTGGTGAAGAAAACAGATGG - Intergenic
942290602 2:174466620-174466642 GACCAGATCTTGAAGACAAAAGG + Exonic
945058988 2:205892126-205892148 TACCTGGTCGATAAGATACAAGG - Intergenic
945244702 2:207707517-207707539 TACATGGTGTAGAAGAGAGAAGG + Intergenic
945743379 2:213690638-213690660 TACCTGCACTGGCAGACAAATGG - Intronic
945799952 2:214416085-214416107 TATCTAGACTAGAATACAAAAGG + Intronic
945805770 2:214488295-214488317 AACCTGGTCAAGAAGTCACAAGG + Intronic
947019389 2:225657755-225657777 TCCCTGGTCTATAGGACAAGGGG - Intergenic
948324694 2:237104753-237104775 TACCAGTACTAGAAGAAAAATGG + Intergenic
1171363057 20:24603828-24603850 TACCTGCTCCTGCAGACAAATGG + Intronic
1172235175 20:33367710-33367732 TACCTAGTCCAAAAGAAAAAAGG + Intronic
1173009822 20:39171893-39171915 CACCTGGACTAAAAGAGAAAGGG - Intergenic
1176890438 21:14311515-14311537 GACCTGATCTTGAACACAAAAGG - Intergenic
1178045353 21:28687348-28687370 TTCCTCGTCTAGAAAATAAATGG + Intergenic
1181347443 22:22230238-22230260 TTCCTGGTATAGAAGGCAAGAGG + Intergenic
1182040575 22:27236177-27236199 TACCTGGTCTAGAGTAATAATGG + Intergenic
1182776586 22:32835764-32835786 TACCTTGGCTTGCAGACAAAGGG - Intronic
1182785632 22:32905412-32905434 TGCATGGTCAGGAAGACAAAGGG + Intronic
949934766 3:9108141-9108163 TATGTGGTCTAGAAGATAAGGGG - Intronic
956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG + Intronic
958139893 3:89548799-89548821 AACCTGGTCTAGGAGACTTACGG - Intergenic
960484247 3:118231933-118231955 TACCTGGAGTAGAAGCCGAAGGG - Intergenic
962927716 3:140010896-140010918 TACCAGATCTAGAATATAAAAGG - Intronic
964108158 3:153060963-153060985 TCCTTGGTCTAGGAGACACATGG - Intergenic
964123262 3:153208683-153208705 TGCCTGGTTTGGATGACAAATGG - Intergenic
965401772 3:168220864-168220886 TCCCAGGGCCAGAAGACAAATGG - Intergenic
965675790 3:171194577-171194599 GACCTGATCAAGAACACAAAAGG - Exonic
969524476 4:7697178-7697200 TACCTGGTCCAAAAGAAAAGGGG - Exonic
970725669 4:19041587-19041609 CACCTGGTCTAGGAGGCAGAGGG - Intergenic
972734267 4:41825264-41825286 TGTCTGGTGTAGAAGAGAAAGGG + Intergenic
975939466 4:79624842-79624864 TACATGGTCTCTAAGACAGAAGG + Intergenic
981813419 4:148801446-148801468 TACCTGGCCAAGAAGACTAGGGG - Intergenic
981871517 4:149492686-149492708 TACATGGTCTATATGACAATGGG + Intergenic
983115000 4:163803999-163804021 TAACTTGTCTAGAAAAGAAAGGG - Intronic
983449810 4:167895573-167895595 TCCCTGGTATATAAGACAAAGGG + Intergenic
986044450 5:4023675-4023697 TACGATGACTAGAAGACAAATGG + Intergenic
987609754 5:20187399-20187421 TTCCTTTTGTAGAAGACAAATGG + Intronic
988674879 5:33422324-33422346 AACCTGTTCTCGAAGACACAAGG + Intergenic
990873116 5:60455447-60455469 TTCCTGATCTTGAAGACTAATGG + Intronic
994604691 5:101953007-101953029 TTCCTGGTTTGGAAGACATATGG - Intergenic
994633533 5:102315853-102315875 TTCCTTGTCTCTAAGACAAAAGG - Intergenic
997090307 5:130848898-130848920 CACTTGGTTTAGAAGACACAAGG + Intergenic
1000277361 5:159750247-159750269 AAACTGGCCTAAAAGACAAAAGG + Intergenic
1002155334 5:177273805-177273827 GACCTTCTCTAGAAGAGAAATGG + Intronic
1003905481 6:10695263-10695285 TGCCTTTTCTAGTAGACAAAAGG + Intronic
1004789281 6:19006174-19006196 TAGCATGTCTAGAATACAAAAGG + Intergenic
1006333278 6:33406941-33406963 TCCCTGCCCTAGAAGACAAAAGG - Intronic
1008273795 6:49520107-49520129 TAACTTGTAAAGAAGACAAAAGG + Intronic
1012863095 6:104585160-104585182 CACCTAATCTAGAACACAAAAGG - Intergenic
1015006712 6:128291230-128291252 TCGCTGGTCTTGAAGACAGAAGG + Intronic
1016756690 6:147695059-147695081 TACCTGAGATAGAAGACAGATGG - Intronic
1019426279 7:978508-978530 GACCTTGTCTACAAGAAAAAAGG + Intergenic
1026358078 7:69577254-69577276 TATGTGTTCTAGAAAACAAAAGG - Intergenic
1029865937 7:103628960-103628982 TACCTGGTCTCCAGGACAACTGG + Intronic
1030309191 7:108052485-108052507 TACCAGGTCTAGTAGAATAAAGG + Intronic
1033301541 7:140190501-140190523 TTCCTGGGCAAGAAGACACAAGG + Intergenic
1034331320 7:150285275-150285297 AACCTGGTCTAGAAGATGCAGGG + Intronic
1034666723 7:152824578-152824600 AACCTGGTCTAGAAGATGCAGGG - Intronic
1037622903 8:20582257-20582279 TACATGAACTAGAAGACAATTGG + Intergenic
1039668200 8:39560733-39560755 TACCTTTTCTAGACCACAAAAGG - Intergenic
1040657238 8:49525528-49525550 GACCTGGCCTAGCAGAGAAAAGG + Intergenic
1044216323 8:89615245-89615267 AACCAGGTTTAGAAGAGAAAAGG - Intergenic
1045430787 8:102113103-102113125 TAAGTGGTCTAGGAGAGAAAAGG + Intronic
1046951121 8:120020575-120020597 AACATGGGCTGGAAGACAAAGGG - Intronic
1047641165 8:126823199-126823221 TATGTGGGCTAGAAGACACAGGG - Intergenic
1049026299 8:139991694-139991716 TGCCTGGCTTAGAAGACACAAGG + Intronic
1051316931 9:15847438-15847460 TACCTGGTTTAAAATAAAAAAGG - Intronic
1053604460 9:39642783-39642805 TCTCTGGTGAAGAAGACAAAAGG + Intergenic
1053862277 9:42398824-42398846 TCTCTGGTGAAGAAGACAAAAGG + Intergenic
1054249081 9:62699631-62699653 TCTCTGGTGAAGAAGACAAAAGG - Intergenic
1054563195 9:66734164-66734186 TCTCTGGTGAAGAAGACAAAAGG - Intergenic
1059314069 9:113409579-113409601 TATGTGGTTTAGAAGACAAGAGG + Intronic
1059476848 9:114554197-114554219 AACCCCCTCTAGAAGACAAATGG - Intergenic
1059812677 9:117873298-117873320 TACCAGGTGTTGAAGGCAAAGGG - Intergenic
1185625256 X:1476655-1476677 TGCCAGGTCTAGAAGAACAAGGG + Intronic
1188874506 X:35413471-35413493 AACATGCTCTGGAAGACAAATGG - Intergenic
1191198839 X:57755361-57755383 AATCTGGACTAGAGGACAAATGG + Intergenic
1193730542 X:85097307-85097329 TACATTGTCTAAAAGACAAATGG + Intronic
1195464294 X:105163027-105163049 TAGCTGATCTAGAAGTTAAAGGG - Intronic
1197232951 X:124026070-124026092 TACCTGGTCTAGAAGACAAAAGG - Intronic