ID: 1197234509

View in Genome Browser
Species Human (GRCh38)
Location X:124044453-124044475
Sequence CTGAATTACCTTACATCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197234509 Original CRISPR CTGAATTACCTTACATCTCT AGG Intronic
902349664 1:15845024-15845046 CTGAATTAGCTGAAACCTCTTGG - Intergenic
905153138 1:35948773-35948795 CTTAATTACATTACATCTTTAGG + Intronic
906888078 1:49674288-49674310 CTCAATTACCTTGCATTTATTGG + Intronic
907116843 1:51976547-51976569 CTGAATTGCTTAACTTCTCTGGG - Intronic
910046538 1:82924622-82924644 CTGAACCAGCTTACTTCTCTAGG + Intergenic
910820842 1:91344230-91344252 CTGAACTATCTTATATCTCCTGG - Intronic
911449195 1:98044104-98044126 ATGAATTACCTTTTTTCTCTAGG - Intergenic
911597175 1:99810953-99810975 CTGAATTACAATACATTTGTGGG + Intergenic
911863386 1:102984691-102984713 CTGAATTTCTTTGCATATCTAGG - Intronic
913647873 1:120878066-120878088 TTGAATTTTCTTACATATCTTGG - Intergenic
914078755 1:144384782-144384804 TTGAATTTTCTTACATATCTTGG + Intergenic
914100424 1:144581720-144581742 TTGAATTTTCTTACATATCTTGG - Intergenic
914173662 1:145253326-145253348 TTGAATTTTCTTACATATCTTGG + Intergenic
914298569 1:146355962-146355984 TTGAATTTTCTTACATATCTTGG + Intergenic
914528324 1:148494512-148494534 TTGAATTTTCTTACATATCTTGG + Intergenic
914638069 1:149572592-149572614 TTGAATTTTCTTACATATCTTGG - Intergenic
915558704 1:156674439-156674461 CTCACTGACCTTCCATCTCTGGG + Intronic
919003438 1:191864528-191864550 TTGAACAACCTTGCATCTCTGGG - Intergenic
919208472 1:194449754-194449776 ATGAATTACCTGTCATCTTTTGG + Intergenic
921024545 1:211264979-211265001 ATGAACTACCTGACTTCTCTAGG + Intronic
924149760 1:241116999-241117021 CTGTGTAACCTTACATCTATCGG - Intronic
924640388 1:245827804-245827826 ATGAGTGACCTCACATCTCTGGG - Intronic
1065545608 10:26817292-26817314 CTGAATTAAAATAAATCTCTTGG - Intronic
1065794606 10:29294291-29294313 CTTAATTAACTGACCTCTCTTGG - Intronic
1067937023 10:50622157-50622179 CTGAATCACCAAACATCCCTGGG + Intronic
1068087918 10:52398121-52398143 CTGAATTACCTAAGAACTCCAGG - Intergenic
1068762374 10:60727032-60727054 ATGTCTTACCTCACATCTCTAGG - Intronic
1070320560 10:75351853-75351875 GTGAATTGCTTTACCTCTCTGGG + Intergenic
1070837512 10:79459284-79459306 CTTATTTACCCTACATGTCTTGG + Intergenic
1070950791 10:80429425-80429447 CTGAGTTATTTTAAATCTCTAGG - Intronic
1074834292 10:117274467-117274489 CCTAATTGCCTTCCATCTCTTGG - Intronic
1076935450 10:133565648-133565670 GAGAATTACCTCACATCTCCAGG - Intronic
1077808081 11:5609539-5609561 CTGAACTGCATAACATCTCTAGG + Intronic
1079079309 11:17402846-17402868 GTGAATGGCCTTACCTCTCTAGG + Intronic
1080840367 11:35978152-35978174 CTGGCTTACCTTGCATCACTTGG - Intronic
1081407762 11:42717346-42717368 ATGAATTACCTTACCTTTCATGG - Intergenic
1084229188 11:67738531-67738553 CTGGCTTTCCTTACAGCTCTCGG - Intergenic
1084520384 11:69659073-69659095 CTCAGTTACTTTACCTCTCTGGG - Intronic
1084973380 11:72783309-72783331 GTGAATGACCTTAGATCTCCAGG + Intronic
1086055601 11:82642674-82642696 CTGAACTGCCTTGCTTCTCTAGG - Intergenic
1087563210 11:99817735-99817757 TTTCATTACCTTACACCTCTAGG + Intronic
1090427994 11:126623363-126623385 CTGAATTCTCCCACATCTCTGGG + Intronic
1091626655 12:2126092-2126114 CTGGAATACTTTTCATCTCTTGG - Intronic
1093893876 12:24555253-24555275 CTTCATTTCCTTACCTCTCTAGG - Intergenic
1095197451 12:39337497-39337519 TCGAATTACTTTACCTCTCTAGG + Intronic
1097836700 12:64280740-64280762 CTAAATTTCCTTACAGCTGTGGG - Intronic
1099572403 12:84340155-84340177 CTGAATTAGTTTCTATCTCTTGG - Intergenic
1101073121 12:101097144-101097166 ATGAATTCCCTTACATCTGGAGG + Intronic
1101745152 12:107535112-107535134 CTGAATTTCCTTGCATTTCTAGG - Intronic
1103871661 12:124096670-124096692 CTGAATTCCCCTAAATCTTTTGG + Intronic
1110772198 13:79362538-79362560 CTGACTTATCCTACATCTCTAGG + Intronic
1111706482 13:91755714-91755736 CTGAAATATCTTACATGTCTGGG + Intronic
1111847353 13:93528119-93528141 CTGAACTAGTTTACAGCTCTTGG + Intronic
1118169124 14:63368819-63368841 CTTAATTACATTAAATTTCTGGG - Intergenic
1124824659 15:33081917-33081939 CTGAATTAGCTTAATTGTCTGGG - Intronic
1127166586 15:56249924-56249946 CTGGATTCCCTTGCCTCTCTTGG + Intronic
1130623899 15:85493636-85493658 CTGAATTATCTTAGTTCTTTTGG + Intronic
1130675891 15:85951676-85951698 CTGAAATAACTTAGATCTCTAGG + Intergenic
1130835707 15:87647567-87647589 CTGGATTCACTTACATATCTGGG - Intergenic
1131396406 15:92090281-92090303 CAGCAATACCTGACATCTCTTGG - Intronic
1132261657 15:100430439-100430461 CAGCATTTCCTTACACCTCTGGG + Intronic
1132447206 15:101934976-101934998 CTGCATCACCTCAAATCTCTGGG - Intergenic
1134784586 16:16930225-16930247 GTGAGTTACCTTACATCTCTGGG - Intergenic
1135358330 16:21789537-21789559 CTAAATTTCCATACATCTTTTGG + Intergenic
1135456833 16:22605662-22605684 CTAAATTTCCATACATCTTTTGG + Intergenic
1136394174 16:29983908-29983930 CTGACTTAACTGACATCTCCTGG + Intronic
1137956717 16:52839029-52839051 CAGAATTACCTTGAATCTTTGGG - Intergenic
1141532736 16:84658008-84658030 TTGACTTTCCTTACCTCTCTGGG + Intronic
1144122549 17:12169116-12169138 CTGAAATAACTTACATTCCTGGG + Intergenic
1145353176 17:22107768-22107790 CTTAATTAGCATACATCTATTGG + Intergenic
1148666158 17:49376598-49376620 ATCCATTACCTTACAGCTCTGGG - Intronic
1152986183 18:323272-323294 CTGAATTCTCTTTCATCACTAGG - Intronic
1155922019 18:31612968-31612990 GTGAATGACCTAACATTTCTAGG + Intergenic
1156360373 18:36379414-36379436 CTTGGTTACCTTTCATCTCTAGG + Intronic
1159512080 18:69408050-69408072 CTGATTTGCCTTACTTCTTTTGG - Intronic
1159603443 18:70450798-70450820 CAAAATTACCCTAAATCTCTGGG - Intergenic
1167525288 19:49979741-49979763 CTGAATTACTTTAAATCCCTGGG - Intronic
926219335 2:10924716-10924738 CAGACTTTCCTTACACCTCTTGG + Intergenic
926421066 2:12700021-12700043 CTCAATTACACTAGATCTCTGGG + Intergenic
927658087 2:24968767-24968789 TTGAATTTCCTTACGTATCTGGG + Intronic
928133590 2:28671452-28671474 CAGACTTACCTTCCATCTCAAGG - Intergenic
928345540 2:30490580-30490602 CTAAATTACTTTACTTCTCTGGG + Intronic
928817613 2:35318556-35318578 CTGAAATTACTTACATATCTGGG - Intergenic
929225036 2:39503779-39503801 CTGAATTACCTTTTCTTTCTTGG - Intergenic
930407231 2:50974293-50974315 CACAATTAACTTACATCTATAGG + Intronic
930677763 2:54222577-54222599 CTGATTTACCTAACATTTGTTGG + Intronic
932734138 2:74242522-74242544 ATGAATTACATAACCTCTCTGGG - Intronic
932844645 2:75122860-75122882 CTAGATGACCTTCCATCTCTGGG + Intronic
933584527 2:84166343-84166365 CTGGGTTGCCTTACTTCTCTGGG - Intergenic
934474103 2:94581288-94581310 CTGAATTAACCCACCTCTCTGGG + Intergenic
935694355 2:105758250-105758272 TTGAATCACATTACTTCTCTTGG + Intronic
939906550 2:147923224-147923246 CTGAATTCTCTACCATCTCTTGG - Intronic
940393659 2:153162814-153162836 CTGAATTACCTAACATCCCTAGG - Intergenic
942370861 2:175283012-175283034 TTGAATATCCTTACAACTCTGGG + Intergenic
942796884 2:179831690-179831712 CTGACTTTCCTTTCTTCTCTTGG - Intronic
944371432 2:198987891-198987913 ATGTATTATCTTACAGCTCTTGG - Intergenic
944443610 2:199767416-199767438 TTGAATTAACTTTCATCTATTGG + Intronic
944477583 2:200123571-200123593 CTGAATTATTTTCCATCTCGTGG - Intergenic
945871634 2:215232887-215232909 CTGAATTATATTGAATCTCTCGG - Intergenic
947005982 2:225511877-225511899 CTGAATAAACTTACATGTCTGGG + Intronic
947360057 2:229337564-229337586 CTGAACTACCTTTCCTCACTTGG - Intergenic
947394668 2:229674847-229674869 CTGTATGACCTTACGTCTCAGGG - Intronic
1170906534 20:20520116-20520138 CTCAAATACCTTTCATCTCAGGG + Intronic
1173710083 20:45147478-45147500 CTGACTTATCTAACATTTCTTGG - Intergenic
1174335177 20:49854574-49854596 CTGAATTTGCCTTCATCTCTGGG + Intronic
1175027556 20:55918707-55918729 GTGAATTACTTAACCTCTCTAGG - Intergenic
1176938599 21:14896969-14896991 TAGAATTACCTCTCATCTCTAGG - Intergenic
1177173925 21:17683393-17683415 CTGAATTTCCTGAGAACTCTGGG + Intergenic
1178631119 21:34262229-34262251 CTGAATGAACTTCTATCTCTGGG - Intergenic
1182180321 22:28340182-28340204 CTCAATTACTTTCCTTCTCTGGG + Intronic
1182570654 22:31235221-31235243 CTGACTTACATCATATCTCTTGG - Intronic
1184530128 22:45050195-45050217 CTGATTTACCTTACATGGCTTGG - Intergenic
951049900 3:18082609-18082631 CTGAATGACCTCAGATCTTTGGG - Intronic
952645496 3:35652899-35652921 CTGAATTACCTTGTTTCTCCAGG + Intronic
956123947 3:65993889-65993911 GGGAATTACCTTTCTTCTCTGGG - Intronic
958455773 3:94328864-94328886 CTGAATAACCTTGTATCTCAAGG + Intergenic
961959044 3:130834587-130834609 CTGAACTACCTTACAGCCCCTGG - Intergenic
966426659 3:179787320-179787342 CTGAATCACTGTACCTCTCTGGG + Exonic
967258162 3:187614251-187614273 CAGAATTAACTTAGCTCTCTTGG + Intergenic
969537713 4:7766904-7766926 CTGAAATACCTTCCAACTCTCGG - Intronic
971009860 4:22421980-22422002 CTGAATTCCTTTAAAACTCTAGG - Intronic
972481558 4:39501641-39501663 CTGCATTACCTAAACTCTCTAGG + Intronic
978928046 4:114274187-114274209 CTGAATTCTCTGACAGCTCTAGG + Intergenic
980186101 4:129463051-129463073 ATGAATTACCTTGCATTTCTAGG + Intergenic
980450815 4:132968927-132968949 CTGAAGTACCTGAAATCTCATGG - Intergenic
981244255 4:142515547-142515569 CTGAATTCCCTTACACCCTTGGG - Intronic
982074788 4:151727698-151727720 ACAAATTACCTTACCTCTCTAGG + Intronic
982212098 4:153046167-153046189 CTGAATTTTCTTTCCTCTCTTGG + Intergenic
982266239 4:153540991-153541013 TTGCATTACCTTTCAGCTCTAGG - Intronic
982593328 4:157345297-157345319 CTAATTTTCCTCACATCTCTTGG - Intronic
984191273 4:176608583-176608605 TTGAATTTCCTTACATCTCCAGG - Intergenic
987902746 5:24034400-24034422 CTGAAGTACTTTACATGACTTGG - Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989979135 5:50621467-50621489 TTGAATTTTCTTACATATCTTGG - Intergenic
990506084 5:56446920-56446942 GGGAGTTACCTTACCTCTCTGGG + Intergenic
991531378 5:67618932-67618954 CTGAACTACCTTTCAGCTCCAGG + Intergenic
993803959 5:92380835-92380857 CTGTATTACCTAACATTTTTGGG + Intergenic
995642262 5:114270483-114270505 CTGAATTATCTGGCATCTTTTGG + Intergenic
999954470 5:156685558-156685580 GTGAAATACCCTACATCCCTAGG - Intronic
1003129736 6:3385673-3385695 CTGAGTTCCCTTACAAGTCTGGG + Intronic
1003789411 6:9526543-9526565 CTAAATTAATTTACAACTCTGGG + Intergenic
1006324711 6:33345017-33345039 CTGAATTACGTTTTTTCTCTCGG - Intergenic
1008446836 6:51601536-51601558 TTGAATAAACTTAGATCTCTTGG - Intergenic
1009310314 6:62142378-62142400 CTGTACAACCTTCCATCTCTCGG + Intronic
1010498422 6:76565199-76565221 GCAAATTACCTAACATCTCTGGG - Intergenic
1010794965 6:80107660-80107682 CTGAATTCTTTCACATCTCTAGG - Intronic
1013021505 6:106225179-106225201 CTCGTTCACCTTACATCTCTGGG - Intronic
1014468093 6:121781048-121781070 GTGAAGCACCTTTCATCTCTTGG - Intergenic
1014628621 6:123761339-123761361 TTGAATTACTTTGCATGTCTAGG - Intergenic
1017122598 6:151038681-151038703 CTGAATTAACCCACCTCTCTGGG - Intronic
1017559541 6:155612293-155612315 CAGAATTACCTGACATGTTTAGG - Intergenic
1020433948 7:8142015-8142037 CTGAATTTGCTTTCATCTCGAGG + Intronic
1021648000 7:22805304-22805326 CAGAATTACCGGACATGTCTAGG + Intergenic
1021754471 7:23837982-23838004 CTGAACTTCCTTACTTTTCTTGG - Intergenic
1024563331 7:50662363-50662385 CTGAATAACCCTTCATTTCTTGG - Intronic
1027141325 7:75659817-75659839 CTGAGTTATTTTACATCCCTTGG - Intronic
1027363070 7:77429315-77429337 CTGACGTACCTTATATATCTGGG + Intergenic
1027533959 7:79372290-79372312 CTGAATAATCATACATCTCCTGG - Intronic
1028621272 7:92832418-92832440 CTGTTTTACTTTATATCTCTGGG - Intronic
1028674794 7:93446488-93446510 CTGAATTACCTTGAATATCTTGG - Intronic
1030745333 7:113159311-113159333 CTTAATTATCTTTAATCTCTAGG - Intergenic
1033468248 7:141617416-141617438 CTGGATTACCTAACAGCCCTGGG - Intronic
1034939233 7:155219624-155219646 CTGATTTAACTTTCATCTATGGG - Intergenic
1035968295 8:4219474-4219496 CTGAATTTCCTTCCGTCTCTTGG + Intronic
1036904778 8:12699063-12699085 CTGGCTTTCCTTACAGCTCTGGG - Intergenic
1038641269 8:29330933-29330955 CTGAATTACCTTATCTCTGATGG + Intergenic
1039720166 8:40155422-40155444 GTGAATTACCTCACATCTGCTGG + Intergenic
1040422101 8:47250508-47250530 TTGTATTCCCTTGCATCTCTTGG + Intergenic
1043773596 8:84236253-84236275 CTGAGTTACTTTATATCACTGGG - Intronic
1044080640 8:87878491-87878513 ATGAATTACCTTTCTTCTTTTGG - Intergenic
1044147452 8:88734864-88734886 CGGATTTACCTTACATCCCTGGG - Intergenic
1045712121 8:104996900-104996922 CTGGCTTAAATTACATCTCTGGG - Intronic
1046273298 8:111923916-111923938 CTGAATCATTTTACATCTTTGGG + Intergenic
1047059076 8:121202800-121202822 ATGAATTTCCTTGCATTTCTAGG - Intergenic
1047861234 8:128969660-128969682 CTGACTTACCTTACACATTTTGG - Intergenic
1054279746 9:63120109-63120131 CTGAATTAACCCACCTCTCTGGG + Intergenic
1054297070 9:63340308-63340330 CTGAATTAACCCACCTCTCTGGG - Intergenic
1054395089 9:64644815-64644837 CTGAATTAACCCACCTCTCTGGG - Intergenic
1054429736 9:65150015-65150037 CTGAATTAACCCACCTCTCTGGG - Intergenic
1054500646 9:65871516-65871538 CTGAATTAACCCACCTCTCTGGG + Intergenic
1055394440 9:75858911-75858933 CTGTCTTTCCTGACATCTCTTGG - Intergenic
1060360839 9:122955571-122955593 TTAAATGACCTTACTTCTCTTGG + Intronic
1060766261 9:126296747-126296769 CTGAAATTTCTTCCATCTCTGGG + Intergenic
1062714173 9:137996998-137997020 TTGAATTATCTTGCATTTCTAGG - Intronic
1189149965 X:38696509-38696531 CTGTATTACCACACATCTCTTGG + Intergenic
1195306418 X:103587249-103587271 CTGAATTCCCTTGGACCTCTAGG - Exonic
1197234509 X:124044453-124044475 CTGAATTACCTTACATCTCTAGG + Intronic
1201782849 Y:17742511-17742533 GTGAATTCCCATACATGTCTTGG - Intergenic
1201818704 Y:18163476-18163498 GTGAATTCCCATACATGTCTTGG + Intergenic