ID: 1197235464

View in Genome Browser
Species Human (GRCh38)
Location X:124057776-124057798
Sequence CTGTTTCAATTTCATATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197235464 Original CRISPR CTGTTTCAATTTCATATCTA AGG (reversed) Intronic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
900303185 1:1988198-1988220 GTGTTTGTATTTTATATCTATGG - Intronic
902457832 1:16548531-16548553 CTGTTTCTATTTCATTTCCTGGG - Intergenic
902475279 1:16680872-16680894 CTGTTTCTATTTCATTTCCTGGG - Intergenic
902494327 1:16859382-16859404 CTGTTTCTATTTCATTTCCTGGG + Intronic
904392590 1:30195813-30195835 ATGTTTCAATTACATCTCGATGG - Intergenic
906512925 1:46421568-46421590 TTATTTCCATTTCATATATAAGG + Intergenic
906849344 1:49231168-49231190 TTGGTTCCATTTTATATCTAAGG + Intronic
908375009 1:63527693-63527715 TTGTATCAATTTCTTAGCTATGG + Intronic
908740184 1:67319320-67319342 CTGTTTCAAATTCAAACCCAAGG - Intronic
908957014 1:69644060-69644082 TTGTTTCAATGTCCTATATATGG + Intronic
909666210 1:78135841-78135863 CTGGTTTAATTTCATGTGTATGG + Exonic
912260291 1:108104564-108104586 CTGTTTCTATTCAATTTCTAAGG - Intergenic
912956941 1:114161042-114161064 GGGTTTCAATTTCATCTCAAAGG - Intergenic
913611631 1:120514703-120514725 CTGTTTCTATTTCATTTCCTGGG - Intergenic
913983162 1:143542104-143542126 CTGTTTCTATTTCATTTCCTGGG + Intergenic
914579561 1:149007536-149007558 CTGTTTCTATTTCATTTCCTGGG + Intronic
914898077 1:151694850-151694872 CTTTTTAAATTTCATATTGATGG + Exonic
916336394 1:163675760-163675782 CTGGTTCACTTTCATATTAAAGG + Intergenic
916669351 1:166999309-166999331 CTGTTTCACTTTCTTATCATTGG - Intronic
917121605 1:171649390-171649412 CTGTTTCAAGGCCAGATCTAGGG - Intronic
918578054 1:186088046-186088068 TTTTTTCATTTGCATATCTAGGG - Intronic
918690080 1:187468720-187468742 CTGATTTAATTTTATATTTAGGG + Intergenic
919229819 1:194759930-194759952 CTGTTTCAATTTTCTGTATATGG - Intergenic
919487849 1:198166168-198166190 CTGTTTCACTTTCTTATCATTGG + Intronic
919889777 1:201962701-201962723 TTGTTTTAAATTCATATCTGAGG + Intronic
921108508 1:212009151-212009173 CTCTTTCATTTCCATATCTTAGG + Intronic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
1064551452 10:16505204-16505226 CTTTTTGATTGTCATATCTAGGG + Intronic
1064595319 10:16938759-16938781 TATTTTCCATTTCATATCTAAGG - Intronic
1064845972 10:19653499-19653521 CTGTTTCACTTTTAAACCTATGG - Intronic
1066452103 10:35539157-35539179 CAATTTCAACTTCAAATCTATGG - Intronic
1066552177 10:36571175-36571197 CTGGTTCAATTTCTCATATAGGG + Intergenic
1068087834 10:52396858-52396880 ATGTTTGAATTTCATATATTTGG - Intergenic
1068167846 10:53354552-53354574 CGGTTTCATTTTTATATATATGG - Intergenic
1068220721 10:54042233-54042255 CTCTCTCCATTTCATAGCTAAGG + Intronic
1068441635 10:57062904-57062926 CTCTTTAAATTTTATTTCTAAGG + Intergenic
1069225889 10:65943665-65943687 ATGATTCAATTTCATCTTTAGGG + Intronic
1072450512 10:95535991-95536013 GTGATTTTATTTCATATCTAGGG - Intronic
1073995123 10:109306915-109306937 CTTGTTCAAATTCCTATCTAAGG - Intergenic
1074602760 10:114931869-114931891 CTGTATCAGTTTGATCTCTAGGG + Intergenic
1075835823 10:125451964-125451986 CTGATTTTATTTCATATTTATGG - Intergenic
1078290206 11:10002936-10002958 TCTTTTCAATTTCATCTCTAAGG + Intronic
1078502082 11:11889995-11890017 CAGTTTCAATTTCCTGCCTATGG - Intronic
1078871368 11:15348246-15348268 CTGTTTCTATTTCACCTCAAAGG + Intergenic
1079733631 11:23967617-23967639 ATGTTTAAAATACATATCTAAGG - Intergenic
1081066010 11:38539906-38539928 CTGTTTTTATTTAATATTTAAGG - Intergenic
1082696400 11:56370457-56370479 CTGTTCCAATATAATATTTATGG + Intergenic
1082938934 11:58683505-58683527 CAGTTTCAATTTTCTATATAAGG - Intronic
1083373082 11:62197066-62197088 CTGTTTATATTTCATTTCTTAGG + Intergenic
1084221806 11:67685972-67685994 CTGTTTCATTTTCCCATCTTTGG + Intergenic
1084575980 11:69988179-69988201 CTTTTTAAATTTCCTATTTACGG - Intergenic
1085160843 11:74342908-74342930 CTGTTTCAATGTTATATTCATGG + Exonic
1085690356 11:78659306-78659328 TTATTCCAATTTCATGTCTAAGG + Intronic
1088095269 11:106092523-106092545 CAGTTTCAACTTCAAATCCATGG - Intronic
1091105385 11:132914404-132914426 CTGTTCCAATATAATATTTATGG + Intronic
1091614491 12:2039034-2039056 CTTTTGCAATTTCCTACCTATGG - Intronic
1093145137 12:15556190-15556212 CTATGTCAATTTCCTATATATGG - Intronic
1093836318 12:23833635-23833657 GTATTTCAATTTTATATCTTGGG + Intronic
1095607095 12:44081302-44081324 CTGTATCATTTTCAAATTTATGG - Intronic
1097579889 12:61442347-61442369 CTGCTTCAATTTATTTTCTAGGG - Intergenic
1097902274 12:64885033-64885055 TGCTTCCAATTTCATATCTATGG + Intergenic
1099464408 12:82965470-82965492 TTGTTTCAATTTGGTTTCTATGG - Intronic
1099510164 12:83525077-83525099 CTGTCTCCATTTCATCTCTTAGG - Intergenic
1099947791 12:89264719-89264741 CAGTTTCAAGTCCTTATCTATGG - Intergenic
1100970083 12:100060354-100060376 CTGTTTCAATTTCTTTCCTAAGG + Intronic
1101012306 12:100463498-100463520 CTGTTTCAGACTCATTTCTAAGG + Intergenic
1101575334 12:105992110-105992132 TTGTTTCAGTTCCATTTCTATGG + Intergenic
1101842490 12:108338254-108338276 CTTTTTCCAATTGATATCTAAGG - Intronic
1102370496 12:112379079-112379101 CTGTTTCTTTTTCATATTTGAGG - Intronic
1105736685 13:23278762-23278784 CTGTTTCACTTTTGTATCCAAGG - Intronic
1106178279 13:27349661-27349683 CTGCTTGAAGTTCTTATCTAGGG + Intergenic
1107789060 13:43982415-43982437 CTGTTTCTAACTCAAATCTAGGG + Intergenic
1108629501 13:52268019-52268041 CAGTTTCAATTTTCTATATATGG + Intergenic
1108656555 13:52538469-52538491 CAGTTTCAATTTTCTATATATGG - Intergenic
1109331818 13:60940523-60940545 CTGTTTCAGTTTCAAAGTTAAGG - Intergenic
1109749175 13:66667005-66667027 TTATTTCTATTTCAAATCTAAGG - Intronic
1109995713 13:70122721-70122743 TTATTTCAATTTCTTATCTTTGG - Intergenic
1110397964 13:75054141-75054163 ATATATTAATTTCATATCTAGGG + Intergenic
1111047987 13:82840999-82841021 CTTTTTAAATTTCACATGTATGG - Intergenic
1111048117 13:82842922-82842944 CTGTGACAAATTCATTTCTATGG + Intergenic
1112575898 13:100636399-100636421 TTGTTTCAAATGCATATTTATGG - Intronic
1112577429 13:100648142-100648164 CTGTGGCAATTTCAGATCAAAGG + Intronic
1112703773 13:102042824-102042846 CTGTTTCACTCTCAAAACTATGG + Intronic
1115312325 14:31992016-31992038 CTTTTTCAATTTGGTATTTAAGG - Intergenic
1115916070 14:38315951-38315973 CTGTTTCAATTTCAGATTGTTGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118974716 14:70666722-70666744 CTGTTTCAATTTTATAGGTGAGG - Intronic
1119865223 14:77967516-77967538 CTGTTTCAATCTGCTGTCTAAGG + Intergenic
1120173783 14:81272416-81272438 CTGTTTCAGTTACATAATTAAGG - Intronic
1120174852 14:81282348-81282370 GCGTTTCAATTCCATACCTACGG + Intronic
1120210569 14:81629719-81629741 ATGTTTCAATCTCCTTTCTAAGG + Intergenic
1121258757 14:92551175-92551197 CTGTTTGAACTTCATATAGATGG + Intronic
1129363978 15:75043214-75043236 CTGTTTCACTTCCCTATCTGAGG - Intronic
1129634498 15:77300680-77300702 CTGTTTCAGGGTCCTATCTAGGG + Intronic
1129655522 15:77522334-77522356 CAATTTCAATTTAATACCTAAGG - Intergenic
1130720943 15:86385840-86385862 CTGTTTTATTTTCATATGTTAGG + Intronic
1131712603 15:95072503-95072525 CTATTTCCACTTCATGTCTAAGG + Intergenic
1134638409 16:15810001-15810023 CTTTTTCAATTTAATATTTACGG + Intronic
1135074081 16:19378317-19378339 CTGTTTCCATTTCTTAAATAAGG + Intergenic
1136586091 16:31185883-31185905 CTGTTTTAACATCAAATCTAAGG - Intronic
1138879433 16:60992945-60992967 CTGTAATAATTTCATAACTAAGG + Intergenic
1144376802 17:14650911-14650933 CTTTTTCAGTTTCATAGATAGGG + Intergenic
1144722575 17:17482013-17482035 CTGTTTCCATTTCATATCCATGG - Intronic
1146503532 17:33384843-33384865 TTGTTTACATTTCATATCCATGG + Intronic
1146556725 17:33831299-33831321 CTATTTCAATCTCATGTCTGGGG - Intronic
1148696256 17:49560957-49560979 CTGTTTCACTTTCTTATCATCGG - Intergenic
1149600466 17:57890080-57890102 CTGTCTCCATTTCATAGCTGTGG + Intronic
1153794697 18:8610639-8610661 CAGTTTCCATTTCAGATCCACGG - Intronic
1155292583 18:24356588-24356610 CTATTCCAATTTCATATTCAGGG - Intronic
1155314456 18:24557939-24557961 CTGTTTCAATATCATCCCCAGGG - Intergenic
1156427609 18:37031730-37031752 ATTTTTCAGTTTCATATTTAGGG + Intronic
1157459537 18:47875692-47875714 CTCTTTCAATTTTATTTATAAGG + Intronic
1157698255 18:49742077-49742099 GTGTATCAATCTCATCTCTACGG - Intergenic
1158095456 18:53765295-53765317 CTGTTTAAATTTTACATCTTAGG - Intergenic
1158225716 18:55198948-55198970 CTCTTGCAGTTTAATATCTATGG - Intergenic
1158772589 18:60538201-60538223 CTGTTTAAATTTAATATCTGGGG - Intergenic
1159675135 18:71274706-71274728 ATTTTTCAATTACATATGTAGGG - Intergenic
1162325214 19:9995333-9995355 CTGGTTCTATTTCAGATCTCAGG + Intronic
1163068902 19:14821276-14821298 CTGTATCTATTCCATATTTATGG - Intronic
1163986400 19:20955786-20955808 CTTTTTCAGTATTATATCTATGG + Intergenic
1164196273 19:22965432-22965454 TTGTTTTTATTTTATATCTAAGG + Intergenic
1165934564 19:39381284-39381306 CTGCTTCAATTTTATCTCTCAGG + Intronic
1202709520 1_KI270714v1_random:9926-9948 CTGTTTCTATTTCATTTCCTGGG - Intergenic
925693160 2:6546465-6546487 CTGTTTCCATTACTTCTCTATGG + Intergenic
927127782 2:20028626-20028648 CTGATTCAATTTCAGAACTCAGG - Intergenic
927338784 2:21956203-21956225 ATATATCAATTTCATATGTAAGG + Intergenic
928199462 2:29238141-29238163 CTGGTTCAACTGCACATCTATGG - Intronic
928439020 2:31275929-31275951 CTTCATCAATTTCATTTCTAAGG - Intergenic
929471074 2:42193496-42193518 CTGTTGCAATTTTATTTCTTAGG + Intronic
930894702 2:56431877-56431899 CTGGTTCAATTACTTATATACGG + Intergenic
930927093 2:56831472-56831494 GCCCTTCAATTTCATATCTATGG + Intergenic
931830167 2:66042798-66042820 CTGTTTTAGTTTCACATGTATGG + Intergenic
931975680 2:67641599-67641621 CTTTTGCAATTTCTCATCTAAGG + Intergenic
934324928 2:92004306-92004328 CTGTTTCCATTTCATTCCTGGGG + Intergenic
936264585 2:110992991-110993013 CTATATCACTATCATATCTATGG + Intronic
937701201 2:124864906-124864928 CTGTCTCCCTTTTATATCTAAGG - Intronic
937857576 2:126683626-126683648 CTGTTTAAATTTTTTTTCTAAGG + Intronic
938283986 2:130092341-130092363 GTGTTTCTATTTCATTTCTGTGG - Intronic
938334631 2:130480907-130480929 GTGTTTCTATTTCATTTCTGTGG - Intronic
938355193 2:130639763-130639785 GTGTTTCTATTTCATTTCTGTGG + Intronic
938420804 2:131144940-131144962 ATGTTTAAATTTCAAAACTAGGG - Intronic
938430468 2:131231983-131232005 CTGTCTCCATTTCATTTCTGTGG + Intronic
938431621 2:131246552-131246574 GTGTTTCTATTTCATTTCTGTGG + Intronic
938913637 2:135911534-135911556 CTATTTCTATTACATATATACGG + Intronic
938955542 2:136294540-136294562 TTCCTTCATTTTCATATCTATGG + Intergenic
938971317 2:136435494-136435516 CTGGTTCTATTTCATAGCCATGG + Intergenic
939062310 2:137437372-137437394 CTGCTCCAAGTTCATGTCTAAGG + Intronic
939239940 2:139544455-139544477 CAGTTTCTAATTCATATCTATGG - Intergenic
940154596 2:150641504-150641526 CGGTTTTAATTTCATATTTAGGG + Intergenic
940556798 2:155239111-155239133 CATTTTCAATTTCAAACCTAGGG - Intergenic
941465464 2:165821145-165821167 CTGTTTCCATTTAAGATTTATGG + Intergenic
942338087 2:174912922-174912944 ATGTTTCAAATTAATATCTCTGG - Intronic
943256856 2:185605131-185605153 CTGATTCTATTTAACATCTATGG + Intergenic
944268466 2:197754317-197754339 CAGTTTCAATTTTCTATATATGG - Intronic
944355502 2:198782927-198782949 CTGATTCTATTTCATATTTGTGG - Intergenic
944890467 2:204111807-204111829 CTGTTTCAATTTAATACTTTAGG - Intergenic
945372974 2:209043735-209043757 CTGTTCCATTCTCATCTCTATGG + Intergenic
945584116 2:211636053-211636075 CTGCTTCACTTGCTTATCTATGG + Intronic
945603771 2:211900911-211900933 CTATTTCAATATCATATATTAGG + Intronic
945913457 2:215676979-215677001 CAGTCTCAATTTTCTATCTATGG + Intergenic
946292867 2:218758937-218758959 CTGTTCCTTTTTTATATCTAAGG - Intergenic
947192597 2:227523511-227523533 TTGTTTCAATTACTTATTTATGG - Intronic
947700201 2:232227784-232227806 TTGTTTCAATTTCTGATGTAAGG + Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1169461122 20:5796491-5796513 ATGTTTCAAATTCAAATTTAGGG - Intronic
1173071243 20:39768910-39768932 CTATTTCTATTTCATTTCTCTGG + Intergenic
1174861300 20:54093990-54094012 CTGCCTTATTTTCATATCTATGG + Intergenic
1177941129 21:27412818-27412840 CTGTTCCAATTTCATCTGAAAGG + Intergenic
1178010304 21:28277451-28277473 CTTTTTCAATGTCTTCTCTATGG + Intergenic
1178607325 21:34050743-34050765 CTTTTTGAATTTCATATAAATGG - Intergenic
1179386205 21:40944889-40944911 CAGTTTCAATTTTCTGTCTATGG - Intergenic
1179999487 21:44988883-44988905 CTGTTCCAATTTCATATTCTGGG + Intergenic
1182851325 22:33477046-33477068 CTGTTTCTTTTTCATCTCTTTGG - Intronic
949166096 3:943011-943033 CAGTTTCAATTTTCTATATATGG - Intergenic
949755295 3:7402648-7402670 ATTTTTCAATTTCACATCAAAGG - Intronic
951492130 3:23283096-23283118 CTGATTAAAATTCTTATCTAAGG + Intronic
952032570 3:29162007-29162029 ATGTTTCAACTTAATATCTATGG + Intergenic
952182911 3:30937484-30937506 CTCTTTCAATTTCACCTCTTTGG + Intergenic
953089458 3:39709313-39709335 CTTTTCCACTTTGATATCTAAGG + Intergenic
953640469 3:44702288-44702310 CTGGTTCAACAACATATCTAAGG + Intergenic
953882701 3:46699900-46699922 CTGTTTCTGTTTCTTATCCATGG - Intergenic
954091340 3:48286703-48286725 CTGTTTAAATTTCAGATCCAAGG - Intronic
954482421 3:50812970-50812992 TTGTTTCAATTTTATGTGTATGG + Intronic
955703058 3:61701368-61701390 CTGTTTAATTTTCAGATCTCTGG + Intronic
956365420 3:68496778-68496800 CTGTGTCATTTTCTTCTCTATGG + Intronic
956928185 3:74012141-74012163 CTGTTGCAAGTTGATCTCTATGG - Intergenic
957669001 3:83275915-83275937 CCATTTCAAGTTCTTATCTATGG + Intergenic
958222612 3:90712853-90712875 CTGTTGAAATTTCCTATCGAGGG - Intergenic
958848664 3:99295581-99295603 CTGTTTTAATTTCTTATCCGAGG - Intergenic
958991600 3:100852376-100852398 CTGTTACAATATCTTATGTATGG + Intronic
961937920 3:130605091-130605113 CTGTTTCTACTTCATAGCTTAGG + Intronic
963198646 3:142563865-142563887 CTGTTTCACTTTCTCATCAATGG - Intronic
963565019 3:146918742-146918764 TTGTTACAGTTTCATATCAATGG - Intergenic
963638864 3:147834606-147834628 CAGTTTCATTCTCCTATCTATGG + Intergenic
965022986 3:163259194-163259216 CTGTCTCAGATTCAAATCTAGGG + Intergenic
965180375 3:165395108-165395130 CTGTTTTAAATTCCTATCTAAGG + Intergenic
966557425 3:181278434-181278456 CTGTTTGAATAACATATCAAAGG + Intergenic
970390383 4:15604044-15604066 CTGTTTCACTTTCTTATCATTGG + Intergenic
970847384 4:20556886-20556908 CTGTTTCATTTTCTTATCATTGG - Intronic
971553751 4:27985728-27985750 CAGTTTGACTTTCATATTTAAGG + Intergenic
973237204 4:47918237-47918259 CAGTTTCAATTTTCTATATATGG + Intronic
974700106 4:65432332-65432354 CTATTTCACTTCTATATCTATGG - Intronic
976836373 4:89379380-89379402 CTGTCTTATTTTAATATCTAGGG - Intergenic
983048533 4:163015607-163015629 GTTTTTCAATTTACTATCTATGG - Intergenic
984567245 4:181346021-181346043 CTGTTTCAAATGCATATATTTGG - Intergenic
984596161 4:181670235-181670257 ATTTTTCAAATTCATATCTATGG - Intergenic
985990227 5:3551313-3551335 CTGTTTCAATTTCACACACATGG - Intergenic
986008632 5:3690816-3690838 CTGTTTCAGTATCAAATCCAGGG + Intergenic
986387886 5:7254683-7254705 TTATTTTACTTTCATATCTAAGG + Intergenic
988252677 5:28780616-28780638 CTGTTTTATTTTCATTTCTCTGG - Intergenic
988412544 5:30905716-30905738 CTGTATCAATTTCATATATAAGG + Intergenic
989234160 5:39125327-39125349 ATCTTTCAAATTCATATGTATGG + Intronic
989265028 5:39463645-39463667 TTGTTTCAATTGCATTTCTATGG + Intergenic
989499208 5:42146594-42146616 CAGTTTAAATTCCATCTCTAAGG - Intergenic
989650023 5:43677538-43677560 CATTTTCAATTTCAAATTTAGGG + Intronic
990090703 5:52043700-52043722 CTGTTTCATTTGCATCTCTTAGG - Intronic
990938687 5:61177917-61177939 CTGTTTCAGTTTCAGATGGAGGG - Intergenic
993200243 5:84806762-84806784 CTCTTTCAATTTCTTTTCTTCGG - Intergenic
993396074 5:87390471-87390493 CTTTTTTTATTTAATATCTAAGG - Intronic
993586717 5:89739965-89739987 CTGTTTCAAATTCATGTCTTAGG + Intergenic
993607555 5:90012359-90012381 CTTTTTAAATTTAAGATCTATGG - Intergenic
994611591 5:102047790-102047812 CTGTTTTCAATTCACATCTATGG + Intergenic
995150863 5:108843471-108843493 CTTTTTCATTTTTATATCTCTGG - Intronic
996012061 5:118492029-118492051 TTGATTCAATTTCATATCTGAGG - Intergenic
997419059 5:133751436-133751458 CTGTTTCTTTTTGTTATCTAAGG + Intergenic
998589204 5:143459612-143459634 ATGTTTCAATATGATATCCACGG - Intergenic
999530903 5:152462554-152462576 CAGTTTAGATTTCATATCAAGGG + Intergenic
1000967907 5:167681821-167681843 CTCTTTCAATTTTATATGTCTGG + Intronic
1002484834 5:179527830-179527852 CTGTTCCAGTTTCTTATCTCAGG - Intergenic
1003048418 6:2757634-2757656 ATGTGTCAATTTCATAGTTAGGG + Intergenic
1003621282 6:7703144-7703166 CTGTCTCAATTTCTTCTCAATGG + Intergenic
1004237264 6:13885197-13885219 ATGTTTCTATTTCATAATTATGG + Intergenic
1004847558 6:19662190-19662212 CTGTCTCAAGTTCATGGCTAAGG + Intergenic
1009160391 6:60275448-60275470 CAGTTTCAATTTTCTATGTATGG + Intergenic
1009690856 6:67030726-67030748 CTGTTTCAATCTTCTATATAGGG + Intergenic
1010622651 6:78095563-78095585 CCATTTCAATTTCATAGCAATGG + Intergenic
1011162167 6:84403632-84403654 CTATTTCAATTTCATACATTGGG + Intergenic
1011302388 6:85890109-85890131 CAGTTTCAGTTTCCTGTCTATGG + Intergenic
1011404311 6:87001868-87001890 CAGTTTCAACTTCATCTATAAGG + Intronic
1014313375 6:119832282-119832304 CTTTTTAAATTTCAACTCTATGG - Intergenic
1014839604 6:126202785-126202807 TTGTTTCAATGTGATTTCTATGG + Intergenic
1014897170 6:126916280-126916302 CTTATTCAATTTCATAGATAAGG + Intergenic
1015396802 6:132743737-132743759 CTATTCCAAGTTCATATCAAAGG - Intergenic
1015629234 6:135214764-135214786 CTGTGTCAATTTCATGTTTCGGG + Intronic
1015762771 6:136682840-136682862 CTGTCTGAATTTCATATATCAGG - Intronic
1016260601 6:142165306-142165328 CTGTTTCATTTTGAGACCTACGG - Intronic
1016295923 6:142573648-142573670 CTCTCTCAAGTTCATCTCTAGGG - Intergenic
1017254310 6:152315597-152315619 TTCTTTCAAGTTCATATTTAAGG - Intronic
1019673471 7:2295984-2296006 CTGATTCAAGTTAATCTCTAAGG - Intronic
1021081125 7:16366551-16366573 CTGTTTTCAGTTCATATGTATGG - Intronic
1022085527 7:27063748-27063770 CTGCATCAATTTCTTATGTACGG - Intergenic
1023319788 7:38982129-38982151 GTGTTTCATTTTTATATGTAAGG - Intronic
1027471560 7:78580570-78580592 CACTTTCAATTTTGTATCTATGG - Intronic
1029057192 7:97759314-97759336 CTCTTTAAATTTCATATCCTGGG - Intergenic
1030388698 7:108898936-108898958 ATATGTCAAGTTCATATCTAGGG + Intergenic
1030552586 7:110982260-110982282 CTGATTCAGTTTTATATCTTTGG - Intronic
1030606820 7:111646516-111646538 CTTTTTCCATTTAATATATATGG - Intergenic
1030860456 7:114618307-114618329 TTATTTTAATTTTATATCTAGGG - Intronic
1031046056 7:116889098-116889120 CAGTTTAAATTTCAGATCTATGG - Intronic
1031342679 7:120623482-120623504 CTTTTCCAACTTCATACCTAGGG + Intronic
1032951530 7:136920244-136920266 ATGTTTCACTATCATAACTAAGG - Intronic
1033734743 7:144210554-144210576 CTGTTTAATTTTCATTTCTCTGG + Intergenic
1033748312 7:144340415-144340437 CTGTTTAATTTTCATTTCTCTGG - Intergenic
1033796409 7:144850573-144850595 CTGTTGCAATTTCTTATCTTTGG + Intergenic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1036447615 8:8836208-8836230 CTGTTTCAATTGCAAATTTCAGG + Intronic
1037280467 8:17236004-17236026 CTTTTGCACCTTCATATCTAGGG + Intronic
1037288068 8:17322064-17322086 ATGTTTCAACTTCAGATCTCAGG - Intronic
1037515702 8:19629439-19629461 CTGTTCCCATTTCATAGATATGG + Intronic
1038615038 8:29085925-29085947 CTCTGTTAATTTCATTTCTATGG + Intronic
1039372523 8:37001222-37001244 CTGTTTTAATTTGATTTCTCTGG + Intergenic
1039595120 8:38784973-38784995 GTCTTTCACTTTCAGATCTAAGG + Intronic
1040370309 8:46764307-46764329 CTCTTTAAATTTCATATCCTGGG + Intergenic
1040579411 8:48684566-48684588 TATTTTCAATTGCATATCTAGGG + Intergenic
1041034043 8:53769032-53769054 CTGGTTCAATTAGATATCTATGG + Intronic
1041615738 8:59904437-59904459 CAGTTTCAATTTCCTACATATGG - Intergenic
1042676143 8:71324623-71324645 CTGTTTCCATTTTACATATAAGG + Intronic
1042888280 8:73577126-73577148 CTGTTTAAATATAATATTTATGG + Intronic
1043624425 8:82238253-82238275 CTTTTTAAATTTAATCTCTAAGG + Intergenic
1043687902 8:83111135-83111157 CTGTTTCACTTTCCTATCATTGG + Intergenic
1044371059 8:91411633-91411655 CTGTTCTAATTTCATTGCTATGG - Intergenic
1044504229 8:92999324-92999346 CTGTTTCAATCTATTAGCTAAGG + Intronic
1046472549 8:114695830-114695852 TTGTTTCCTTTTCATATTTAAGG - Intergenic
1047087536 8:121535406-121535428 AAATTTCAATTTCATATATAAGG + Intergenic
1047586612 8:126280384-126280406 CTGTTCCAGTTTCCTATCTGAGG + Intergenic
1047600073 8:126417335-126417357 CTTGTTCAATTTCCTATCTTTGG - Intergenic
1048408274 8:134145012-134145034 CTGTTTCTATTTTATAGATAAGG - Intergenic
1048504679 8:135010264-135010286 TTGTTTCCATTTTATAGCTAAGG + Intergenic
1048602561 8:135933536-135933558 CTGTTTCTATTTCATATTCAGGG - Intergenic
1048687343 8:136919124-136919146 CACTTTCACTTTCATTTCTAAGG - Intergenic
1050959423 9:11708026-11708048 CTGCTTGATTTTAATATCTATGG + Intergenic
1050969979 9:11857964-11857986 CTGATTCAAATGCATTTCTAAGG + Intergenic
1051932820 9:22406935-22406957 CTCTGGCAATTTCATGTCTATGG + Intergenic
1051933557 9:22415749-22415771 CTCTTTCTATTGCATATATAGGG + Intergenic
1052684785 9:31741565-31741587 ATGTTTCAATTGAAAATCTAAGG - Intergenic
1055652587 9:78421130-78421152 CTGTTTCAATATTATTGCTATGG + Intergenic
1056334609 9:85554717-85554739 CTGTTTCTATTTCTTATGTGTGG - Intronic
1056721389 9:89075256-89075278 CTGTTTCATTTCCATCTCAAAGG + Intronic
1057057286 9:91973107-91973129 CAGTTTCAATTTTCTGTCTATGG - Intergenic
1057123581 9:92599161-92599183 CTGTTGGAATTTCATCCCTAGGG + Intronic
1058042722 9:100321910-100321932 TTGTATTAATTTCATATCCAAGG + Intronic
1058710204 9:107672548-107672570 TTGTCTCAATTTTATATATAAGG - Intergenic
1058801255 9:108546362-108546384 CTGTTACAATTTCAGAGATAAGG - Intergenic
1060016054 9:120087304-120087326 CTGTTTCAATTTGCTGTCTGTGG - Intergenic
1060393211 9:123296527-123296549 CTGTTTTTATTTCAGATGTAAGG + Intergenic
1061769618 9:132908419-132908441 CTTTTGCAATTACATATCTGTGG - Intronic
1185927230 X:4161145-4161167 CTGTTTCCCATTCATATCTAGGG + Intergenic
1185988738 X:4868277-4868299 CTGTTTCCATATCATGACTATGG + Intergenic
1186773750 X:12843430-12843452 GGGTTTCTTTTTCATATCTAAGG - Intergenic
1188461895 X:30436983-30437005 CTTCTCCAATTTCATTTCTAAGG - Intergenic
1188658080 X:32723398-32723420 CTGTTTGACTTTCGTATTTAGGG + Intronic
1189393209 X:40595547-40595569 CTGCTTCAATTTGATCGCTATGG + Intronic
1192793992 X:74411724-74411746 CTGTTTTCATTTCATATAAAGGG - Intergenic
1193581214 X:83265345-83265367 CAGTTTCAATTTTCTACCTATGG - Intergenic
1193851535 X:86543366-86543388 CTGTTTCTTTTTCATCTGTAGGG - Intronic
1194019055 X:88664987-88665009 ATGTTTCAATTTCTTAACTCAGG + Intergenic
1194117176 X:89917477-89917499 TTCTTTCAATTTCATAAGTAAGG - Intergenic
1196384479 X:115134041-115134063 CTGTTTCACTTTCTTATTTTTGG - Intronic
1197179511 X:123519220-123519242 CTATTTTTATTTCATGTCTATGG - Intergenic
1197235464 X:124057776-124057798 CTGTTTCAATTTCATATCTAAGG - Intronic
1197312145 X:124917940-124917962 CCCTTTCTATTTCATTTCTAGGG - Intronic
1197812774 X:130462768-130462790 ATGTCTCTATTTCCTATCTATGG + Intergenic
1199292220 X:146117933-146117955 CTGTTTCAATCTTCTATGTATGG - Intergenic
1199692025 X:150315796-150315818 CTGTTACAATCTCACATCTGAGG + Intergenic
1200469968 Y:3574633-3574655 TTCTTTCAATTTCATAAGTAAGG - Intergenic
1201687232 Y:16718919-16718941 CTGTTTCCATGTCATAACTGTGG + Intergenic
1202068634 Y:20967622-20967644 CTTTTTCAACTTCATTTTTAGGG - Intergenic