ID: 1197235866

View in Genome Browser
Species Human (GRCh38)
Location X:124062057-124062079
Sequence TATACTTTTTTAGTTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 821}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197235866 Original CRISPR TATACTTTTTTAGTTGCTGC AGG Intronic
901282094 1:8045737-8045759 TAAACTTTTTTATTGGCTGCTGG - Intergenic
901403397 1:9030182-9030204 GATTATTTTTTAGTTCCTGCAGG - Intergenic
901966314 1:12870226-12870248 TAAACTTTTTGATGTGCTGCTGG + Intronic
902951738 1:19889286-19889308 TATACTTTTTTTTTTTTTGCAGG - Intronic
904447147 1:30583622-30583644 TAAACTTTTTGATGTGCTGCTGG + Intergenic
904844805 1:33402736-33402758 TATACTTTTTTAGTTTTAACTGG - Intronic
905119967 1:35674208-35674230 TATACATTTATAGTTGCTATAGG + Intergenic
906908272 1:49918856-49918878 TAAGCTTTTTGAGGTGCTGCTGG - Intronic
908086787 1:60643644-60643666 TAAACTTTTTGATGTGCTGCTGG - Intergenic
908705199 1:66946064-66946086 TATATATTTTTATTTGATGCTGG - Intronic
908866218 1:68551514-68551536 TATGCTTTTTGATGTGCTGCAGG - Intergenic
909171692 1:72303652-72303674 TATACTTGTTTGGTTTCTGTGGG + Intergenic
909816400 1:80000040-80000062 TAAACTTTTTGATGTGCTGCCGG - Intergenic
909870595 1:80733850-80733872 TAAACTTTTTGATGTGCTGCTGG - Intergenic
909886580 1:80949161-80949183 TAAACTTTTTGATGTGCTGCTGG - Intergenic
909986628 1:82168983-82169005 CATATTTTTTTAGTGGCTACAGG - Intergenic
909998373 1:82309663-82309685 TATACTTTATTGCTTGCTGAGGG + Intergenic
910339018 1:86164719-86164741 TATGCTTTTTGATGTGCTGCTGG + Intergenic
910379493 1:86610826-86610848 TAAACTTTTTGATGTGCTGCTGG + Intergenic
910920564 1:92342024-92342046 GATACTGTTTTATTTGCTACAGG + Intronic
911649524 1:100371666-100371688 TAAACTTTTTGAGGTGCTGCTGG + Intronic
911690155 1:100823833-100823855 TAAACTTTTTGATGTGCTGCTGG - Intergenic
911691696 1:100841991-100842013 TAAACTTTTTAATGTGCTGCTGG + Intergenic
911867537 1:103047971-103047993 TAAGCTTTTTTATGTGCTGCTGG + Intronic
912270687 1:108205785-108205807 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
913504237 1:119501424-119501446 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
913970438 1:143411225-143411247 TATACTTTTTTAGTAGAGACAGG - Intergenic
914064813 1:144236839-144236861 TATACTTTTTTAGTAGAGACAGG - Intergenic
914114338 1:144729515-144729537 TATACTTTTTTAGTAGAGACAGG + Intergenic
914996763 1:152550159-152550181 TAAACTTTTTGACGTGCTGCTGG + Intronic
915639470 1:157212464-157212486 TAAGCTTTTTGACTTGCTGCTGG + Intergenic
915651874 1:157319056-157319078 TACACTTTTTGATGTGCTGCTGG - Intergenic
915804168 1:158827565-158827587 TATACTTCTTGAAATGCTGCAGG + Intergenic
915807366 1:158868481-158868503 TAAACTTTTTGATGTGCTGCTGG - Intergenic
915833259 1:159151076-159151098 TAACCTTTTTGAGGTGCTGCTGG + Intergenic
917092080 1:171363309-171363331 TAAACTTTTTGATGTGCTGCTGG - Intergenic
917172569 1:172193228-172193250 TAAGCTTTTTGATTTGCTGCTGG + Intronic
917290261 1:173464933-173464955 TAAACTTTTTGATGTGCTGCTGG - Intergenic
917305637 1:173621429-173621451 TAAACTTTTTGATGTGCTGCTGG - Intronic
917579398 1:176359628-176359650 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
918029242 1:180787867-180787889 GAGACTTTTTTTTTTGCTGCCGG + Intronic
918471044 1:184873848-184873870 TATACTCTCTTAGGTTCTGCTGG - Intronic
918588586 1:186216217-186216239 TAAACTTTTTGATGTGCTGCTGG - Intergenic
918801873 1:188982937-188982959 TAAACTTTTTGATGTGCTGCTGG + Intergenic
918943533 1:191030976-191030998 TAAGCTTTTTGATTTGCTGCAGG - Intergenic
919050360 1:192504221-192504243 TAAACTTTTTGATGTGCTGCTGG - Intergenic
919164459 1:193874643-193874665 TAAACTTTTTGATGTGCTGCTGG - Intergenic
919219564 1:194608885-194608907 TAAACTTTTTGATGTGCTGCTGG + Intergenic
919332538 1:196189929-196189951 TAAGCTTTTTTATATGCTGCTGG + Intergenic
921004498 1:211079590-211079612 TAAACTTTTTGATGTGCTGCTGG - Intronic
921631614 1:217440135-217440157 TAAACTTTTTGATGTGCTGCTGG - Intronic
921753246 1:218822166-218822188 TAAACTTTTTGATGTGCTGCTGG - Intergenic
921942787 1:220860480-220860502 TAAACTTTTTGATGTGCTGCTGG + Intergenic
922092294 1:222408123-222408145 TAAACTTTTTGATGTGCTGCTGG - Intergenic
922538312 1:226400002-226400024 TAAACTTTTTTCGTTGTTGTTGG - Intronic
923381833 1:233428182-233428204 AATAATATTTTAGTTGCAGCAGG + Intergenic
923472473 1:234304332-234304354 TATATTTTTTTAGTAGAGGCAGG + Intronic
923980787 1:239320547-239320569 TGTACTTTTTTAGTAGAGGCAGG - Intergenic
924066077 1:240223352-240223374 TAAGCTTTTTGATTTGCTGCTGG + Intronic
924272867 1:242351801-242351823 TATCCTTTTTTACTTTCTGCTGG + Intronic
924630012 1:245728153-245728175 TAAACTTTTTGATGTGCTGCTGG - Intergenic
924828679 1:247569574-247569596 TATGCTTTTTAATGTGCTGCTGG + Intronic
1062808142 10:440380-440402 GATAGTATTTTAGTTCCTGCAGG - Intronic
1063859609 10:10293410-10293432 TTTATTTTTTAAGTTGCAGCAGG + Intergenic
1065595115 10:27302997-27303019 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1065606364 10:27422011-27422033 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1065647133 10:27847196-27847218 TAAGCTTTTTGAGTTGCTGCTGG - Intronic
1066007643 10:31161141-31161163 TAATCTTTTTTATGTGCTGCTGG + Intergenic
1066322512 10:34318392-34318414 TATACTTTCTTTGTTGATGCTGG - Intronic
1066711847 10:38244857-38244879 TATCCTTTTTTACTTTCTGCTGG - Intergenic
1067853849 10:49773745-49773767 CATTCATTTTCAGTTGCTGCTGG - Intergenic
1069139586 10:64806804-64806826 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1069264998 10:66446447-66446469 TAAACTTTTTGATGTGCTGCTGG - Intronic
1071059388 10:81551882-81551904 TAAATTTTTTTATGTGCTGCTGG - Intergenic
1071074926 10:81738675-81738697 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1071408978 10:85368393-85368415 TACACTTTTTGATGTGCTGCTGG + Intergenic
1071894216 10:90047445-90047467 TTAACTTTTTTATGTGCTGCAGG + Intergenic
1071954123 10:90738782-90738804 TTTGTTTTTTAAGTTGCTGCTGG - Intergenic
1071975512 10:90951679-90951701 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1072393524 10:95014636-95014658 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1072885435 10:99268468-99268490 TATATTTTTTTAGTTGAGACGGG - Intergenic
1073628673 10:105125558-105125580 TACACTTTCTTATTTGCTGGAGG + Intronic
1073725167 10:106222011-106222033 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1073834281 10:107423330-107423352 TCTACCTTTTTAGTGGCTGGGGG + Intergenic
1074017617 10:109550063-109550085 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1074166559 10:110882990-110883012 TAAACTTTTTCAGGTGGTGCAGG + Exonic
1074992803 10:118725563-118725585 TATACATTTTAACTTACTGCTGG - Intronic
1075936374 10:126345392-126345414 TAAACTTTTTGATGTGCTGCTGG + Intronic
1076340027 10:129738927-129738949 TAAACTTTTTGATGTGCTGCTGG - Intronic
1077953119 11:6983531-6983553 TAAACTTTTTGATGTGCTGCTGG - Intronic
1078008849 11:7554504-7554526 TGCACTGTTTTAGTTGATGCAGG - Intronic
1078119637 11:8493720-8493742 TAAACTTTTTGATGTGCTGCTGG - Intronic
1078701382 11:13687526-13687548 TTTGCTTTTCTAGTTGCTTCTGG + Intronic
1078835110 11:15020070-15020092 TAAACTTTTTGATGTGCTGCTGG - Intronic
1079167442 11:18058705-18058727 TAGACTTTTTGATGTGCTGCTGG + Intergenic
1079463199 11:20702877-20702899 TAAGCTTTTTGAGGTGCTGCTGG + Intronic
1079518119 11:21291699-21291721 TAAACTTTTTGATGTGCTGCTGG - Intronic
1079752898 11:24220858-24220880 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1079757370 11:24281436-24281458 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1079813275 11:25023017-25023039 TAAACTTTTTGATATGCTGCTGG + Intronic
1079843129 11:25428768-25428790 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1081370120 11:42290261-42290283 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1082135483 11:48544273-48544295 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1082206286 11:49438653-49438675 TAAACATTTTTATATGCTGCTGG + Intergenic
1082571403 11:54744747-54744769 TAAACTTTTTGATTTGTTGCTGG + Intergenic
1082596491 11:55088143-55088165 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1082717902 11:56637963-56637985 TATACTTCTTTAGTTTGTGCTGG - Intergenic
1082945433 11:58753604-58753626 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1083494458 11:63038685-63038707 TATGCTTTTTGATTTGCTGCTGG + Intergenic
1084903105 11:72324895-72324917 TATATTTTTTCATTTGCTTCAGG - Intronic
1085170084 11:74442329-74442351 AATACTTTTTTGGTTGCTAAGGG - Intergenic
1085222404 11:74885836-74885858 TAAACTTTTTGATGTGCTGCTGG - Intronic
1085995217 11:81903801-81903823 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1086142513 11:83514895-83514917 TATGCTTTTTGATGTGCTGCTGG + Intronic
1086266590 11:85006092-85006114 TAAGCTTTTTTATGTGCTGCTGG + Intronic
1086301854 11:85434944-85434966 TAAGCTTTTTGATTTGCTGCTGG - Intronic
1086505972 11:87504653-87504675 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1086531716 11:87794232-87794254 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1086532013 11:87797613-87797635 TACACTTTTTGATGTGCTGCTGG - Intergenic
1086648981 11:89263128-89263150 TAAACATTTTTATATGCTGCTGG - Intronic
1086811721 11:91318658-91318680 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1086914712 11:92516261-92516283 TACACTTTTTGATGTGCTGCTGG - Intronic
1087072608 11:94096389-94096411 TAAACTTTTTGATGTGCTGCTGG + Intronic
1087172623 11:95066448-95066470 TATATATTTTTGGTTGTTGCAGG + Intergenic
1087312347 11:96559349-96559371 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1087606960 11:100388558-100388580 TACACTTTTTGATGTGCTGCTGG - Intergenic
1088406185 11:109481368-109481390 TGTTCTTTTTTAGTTTCTGTTGG - Intergenic
1089593961 11:119563879-119563901 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1091708387 12:2716963-2716985 TTAACTTTTTGAGGTGCTGCTGG - Intergenic
1092031222 12:5287312-5287334 TAAGCTTTTTTAAGTGCTGCTGG + Intergenic
1092313581 12:7385180-7385202 TCTACTTTTCTACTTGCTGTTGG - Intronic
1092326029 12:7532262-7532284 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1092639255 12:10485443-10485465 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1092999967 12:13985072-13985094 CATACTTTTTTTGTTGTTGTTGG - Intergenic
1093273759 12:17098255-17098277 TCTACTTTCTTAGTTATTGCAGG + Intergenic
1093329435 12:17816897-17816919 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1093618609 12:21259379-21259401 TACACTTTTTGATGTGCTGCTGG + Intergenic
1093830667 12:23753597-23753619 TATACTTGTTTAGTTGAGGGAGG - Intronic
1094206691 12:27847951-27847973 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1094222121 12:28005388-28005410 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1094431682 12:30376636-30376658 TAACCTTTTTGATTTGCTGCTGG + Intergenic
1094523047 12:31213475-31213497 TATATTTTTTTAGTAGATACGGG - Intergenic
1095104094 12:38210966-38210988 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1095137708 12:38626135-38626157 TATACATTTTTAGATTCTGCAGG + Intergenic
1095551541 12:43447265-43447287 TAAGCTTTTTGATTTGCTGCTGG - Intronic
1096032997 12:48437524-48437546 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1096034293 12:48451106-48451128 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1096894687 12:54809311-54809333 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1097321298 12:58229309-58229331 TAAACTTTTTGATATGCTGCTGG + Intergenic
1097482764 12:60151177-60151199 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1097525308 12:60726980-60727002 TAAACTTTTTGATATGCTGCTGG - Intergenic
1098019650 12:66140094-66140116 TATAATTTTTTATTGGATGCTGG - Intronic
1098047319 12:66413721-66413743 TAAACTTTTTAAAGTGCTGCTGG - Intronic
1098691963 12:73500402-73500424 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1098699773 12:73609455-73609477 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1099082096 12:78196987-78197009 TATACTTTTATATTTGCTGCAGG + Intronic
1099185107 12:79507463-79507485 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1099223839 12:79944986-79945008 TATACTTTTTTTTTTTTTGCAGG + Intergenic
1099327876 12:81242631-81242653 TAAACTTTTTGATGTGCTGCTGG - Intronic
1099511706 12:83546735-83546757 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1100198764 12:92276512-92276534 TATGCATTTTGAGTTACTGCAGG - Intergenic
1100517915 12:95345922-95345944 TATACTTTTTTTTTTTCTGTTGG - Intergenic
1100740430 12:97585462-97585484 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1101299655 12:103465965-103465987 TAAACTTTTTGATGTGCTGCTGG + Intronic
1101391271 12:104302804-104302826 TATACTTTGCTATTTGCTGCTGG + Intronic
1101596200 12:106167212-106167234 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1102773490 12:115499069-115499091 TATACTTTTTTAGATGTGGTTGG - Intergenic
1103255094 12:119534784-119534806 TAAGCTTTTTGATTTGCTGCTGG + Intronic
1103483567 12:121267283-121267305 TGTATTTTTTTAGTAGATGCAGG + Intronic
1104241224 12:126991634-126991656 TATATTTTTTTTGTTGTTGTTGG - Intergenic
1104934246 12:132356046-132356068 TAAACTTCTTCAGTTGCTTCAGG + Intergenic
1105226836 13:18443313-18443335 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1105569927 13:21592638-21592660 TAAACTTTTTGATGTGCTGCTGG - Intronic
1105906778 13:24819744-24819766 TCTACTTTTTTATTTTCTACAGG - Intronic
1107208153 13:37820560-37820582 TTTACGTTTTTATGTGCTGCTGG - Intronic
1107267248 13:38570647-38570669 TAAACTTTTTGATATGCTGCTGG - Intergenic
1107333824 13:39331993-39332015 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1107358938 13:39598855-39598877 TATAGTTTGTTAGTAGCAGCTGG - Intronic
1107551118 13:41476710-41476732 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1108031832 13:46239774-46239796 TAAACTTTTTGATGTGCTGCTGG - Intronic
1108547657 13:51512072-51512094 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1108784853 13:53885727-53885749 TATACTTATTTATTTTCTGATGG - Intergenic
1108882237 13:55134269-55134291 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1109385572 13:61625347-61625369 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1109531519 13:63654802-63654824 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1109661347 13:65464676-65464698 TAAACTTTTTGATATGCTGCTGG + Intergenic
1109752415 13:66712801-66712823 TATGCTTTTCTAGTTTGTGCAGG - Intronic
1109930594 13:69212028-69212050 TATACTTTTTGATTTGTTGTTGG + Intergenic
1110402656 13:75111949-75111971 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1110942400 13:81366605-81366627 TACACTTTTTGATGTGCTGCTGG - Intergenic
1110989030 13:82013210-82013232 TATCCATTTTTTGTTGCTTCAGG - Intergenic
1111356017 13:87103404-87103426 TATACATTAATAGTTGCTGTAGG + Intergenic
1111443170 13:88307119-88307141 TAAAATATTTTAGTTGCTGAGGG + Intergenic
1111461863 13:88555421-88555443 TATTGTTTCTTAGTTGCTGTGGG + Intergenic
1111645235 13:91023856-91023878 TACAATTTTCTTGTTGCTGCTGG + Intergenic
1111739188 13:92180958-92180980 TATACAATTTTAGTAGCTGAAGG - Intronic
1112087702 13:96049104-96049126 TAAGCTTTTTGAGATGCTGCTGG - Intronic
1112706210 13:102071962-102071984 TTTACTTTTTTATATGCTGGGGG - Intronic
1113528055 13:110997321-110997343 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1114785508 14:25592887-25592909 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1115007758 14:28507499-28507521 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1115272556 14:31570102-31570124 TATTCTTCTTTACTTTCTGCCGG - Intronic
1115295021 14:31815903-31815925 TAAGCTTTTTTATGTGCTGCTGG + Intronic
1115774060 14:36696276-36696298 TAAACTTTTTGATGTGCTGCTGG + Intronic
1115924548 14:38416252-38416274 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1116077946 14:40135918-40135940 TTTGCTTTTTTGTTTGCTGCTGG + Intergenic
1116362928 14:44024849-44024871 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1116511481 14:45752392-45752414 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1116572098 14:46531441-46531463 TATGCTTTTTGATATGCTGCTGG + Intergenic
1116985592 14:51215978-51216000 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1117188637 14:53268777-53268799 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1117502001 14:56361957-56361979 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1117624808 14:57624577-57624599 TAAACTTTTTGATGTGCTGCTGG - Intronic
1117829575 14:59736800-59736822 TAAACTTTTTGATGTGCTGCTGG - Intronic
1117849720 14:59955011-59955033 TAAACTTTTTGATGTGCTGCTGG + Intronic
1117936262 14:60910693-60910715 TAAACTTTTTGATGTGCTGCTGG + Intronic
1118226591 14:63906172-63906194 TTAACTTTTTTATGTGCTGCTGG + Intronic
1118494874 14:66298235-66298257 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1118498792 14:66336547-66336569 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1118660443 14:68003882-68003904 TAAACTTTTTGATGTGCTGCTGG + Intronic
1120243257 14:81974743-81974765 CCTACTTTTTTGGTTGCTGATGG - Intergenic
1120283464 14:82467628-82467650 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1120564241 14:86035252-86035274 TAAACTTTGATAGTAGCTGCTGG - Intergenic
1120565002 14:86044699-86044721 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1120619592 14:86747397-86747419 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1122936291 14:104958016-104958038 TGTAATTTTTTGGTGGCTGCTGG - Intronic
1124021113 15:25924200-25924222 TAGGCTTTTTGATTTGCTGCTGG + Intergenic
1124669910 15:31629461-31629483 TAAGCTTTTTGAGGTGCTGCTGG + Intronic
1124923877 15:34052120-34052142 TAAACTTTTTGATGTGCTGCTGG - Intronic
1125288862 15:38123495-38123517 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1125847319 15:42869091-42869113 TATACTTTTTTATTTGAGACAGG + Intronic
1126074174 15:44892910-44892932 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1126239810 15:46428678-46428700 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1126365814 15:47893226-47893248 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1126765290 15:52005351-52005373 TGTACTTTTTTAGTAGCGACAGG - Intronic
1126771873 15:52065440-52065462 CATTCATTTTCAGTTGCTGCTGG - Exonic
1127042703 15:54994580-54994602 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1127049646 15:55067605-55067627 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1127100512 15:55559811-55559833 TAAACTTTTTGATGTGCTGCTGG - Intronic
1127202614 15:56672546-56672568 TAAACTTTTTGATGTGCTGCTGG + Intronic
1127355686 15:58197168-58197190 TAAACTTTTTGATGTGCTGCTGG - Intronic
1127518480 15:59719330-59719352 TGTACTTTTTTAGTTGAGACGGG - Intergenic
1127739608 15:61889512-61889534 TATTCTTTTTTAGAGGCTGATGG - Intronic
1128437350 15:67666696-67666718 CTTACTTTTTCAGTTGGTGCTGG + Intronic
1129484601 15:75857900-75857922 TATACTTTTTTCTTTCCTGGTGG + Intronic
1130451964 15:84064260-84064282 TTAACTTTTTGATTTGCTGCTGG + Intergenic
1131579601 15:93629483-93629505 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1131981153 15:97996178-97996200 GGTACTGTTCTAGTTGCTGCAGG + Intergenic
1132033595 15:98459845-98459867 TTTCCTTTTTTAACTGCTGCTGG - Intronic
1132348262 15:101121486-101121508 TATTTATTTTTAGTGGCTGCGGG - Intergenic
1132801270 16:1755261-1755283 TGTACTGCCTTAGTTGCTGCTGG + Intronic
1134436898 16:14267960-14267982 TATATTTTTTTAGTAGCTTTGGG + Intergenic
1136650926 16:31669821-31669843 TTTACTTTTTGATCTGCTGCTGG + Intergenic
1137296715 16:47101074-47101096 TATGCTTTTTGATGTGCTGCTGG - Intronic
1137808876 16:51333564-51333586 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1138228734 16:55323215-55323237 TATACTTTTAAAGTTGCACCAGG - Intergenic
1138866547 16:60828379-60828401 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1139910098 16:70392405-70392427 AATACTTCTTTAGCTGCTGGAGG - Intronic
1140047112 16:71447833-71447855 TCTACTTTTCTTGATGCTGCTGG + Exonic
1140771600 16:78210408-78210430 CAAACTTTTGTAGTTGCTGCTGG + Intronic
1142935697 17:3329079-3329101 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1144294363 17:13859223-13859245 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1146420483 17:32680629-32680651 TAAACTTTTTGATGTGCTGCTGG + Intronic
1146752835 17:35397564-35397586 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1147049634 17:37783050-37783072 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1147461377 17:40572351-40572373 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1149405166 17:56341674-56341696 TATACTTTTTGATGTGCTGCTGG + Intronic
1150025038 17:61665466-61665488 TATGCTTTTTAATGTGCTGCTGG + Intergenic
1150686987 17:67328835-67328857 TATACTTTTCTGGTTTTTGCTGG + Intergenic
1150881831 17:69038340-69038362 TAAACTTTTTGATGTGCTGCTGG - Intronic
1151122894 17:71812291-71812313 TTTGCTTTTTTAAATGCTGCTGG - Intergenic
1151394068 17:73808979-73809001 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1153599699 18:6768317-6768339 TGTAGTTTTTTAGTTAATGCTGG + Intronic
1153988993 18:10378516-10378538 TATACTTTTATAGCTGATTCTGG - Intergenic
1154184382 18:12169500-12169522 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1154320335 18:13345450-13345472 TAAACTTTTTGATGTGCTGCTGG + Intronic
1154401970 18:14047615-14047637 CATACTGTTTTAATTGCTGTAGG + Intergenic
1154526546 18:15296161-15296183 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1155027331 18:21953567-21953589 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1155161574 18:23200433-23200455 TATACTTTTTTAGTAGAGACGGG + Intronic
1155673147 18:28396396-28396418 TCTACATTTTCAGTTGCTTCTGG - Intergenic
1155759102 18:29542173-29542195 TATTTTTCTTTAGTTGCTACTGG - Intergenic
1155769310 18:29676665-29676687 TTAACTTTTTGATTTGCTGCTGG - Intergenic
1156014277 18:32530411-32530433 CATGCTTTATTAGTTGCTGTAGG + Intergenic
1156038832 18:32796128-32796150 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1156353205 18:36319091-36319113 TAAGCTTTTTGATTTGCTGCTGG + Intronic
1156529591 18:37802272-37802294 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1156664986 18:39393852-39393874 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1156675922 18:39527343-39527365 TAGACTTCTTTAGTTCTTGCTGG + Intergenic
1156735557 18:40254214-40254236 GATACTTTTTTAATTCCTGCTGG - Intergenic
1156749954 18:40440171-40440193 TTTTCTTTTTTTGTTGTTGCGGG - Intergenic
1157769341 18:50331946-50331968 TATTCATTCTTAGTGGCTGCTGG - Intergenic
1158874060 18:61716058-61716080 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1158921276 18:62193731-62193753 TAAACTTTTTGACGTGCTGCTGG + Intronic
1159296053 18:66490290-66490312 TATACTTTCTTATTTGTTTCAGG - Intergenic
1159429690 18:68335902-68335924 TAGTGTTTTTTAGTGGCTGCAGG + Intergenic
1159486783 18:69071324-69071346 TATAATTTTTAAGTTTATGCTGG + Intergenic
1159660583 18:71091254-71091276 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1159719218 18:71865376-71865398 TTAACTTTTTGACTTGCTGCTGG + Intergenic
1159789090 18:72754162-72754184 TTTACTTTCTTAGTTGCTTTAGG - Intronic
1163481234 19:17557604-17557626 TATACTTTTTTTTTTGATACAGG + Intronic
1163955067 19:20630147-20630169 TAAGCTTTTTTATGTGCTGCTGG + Intronic
1164110440 19:22152136-22152158 TAAACATTTTGATTTGCTGCTGG - Intergenic
1164259221 19:23554681-23554703 TGTGGTTTTTTAGTTGCTTCAGG - Intronic
1164420878 19:28091395-28091417 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1165606139 19:37106384-37106406 TAAACTTTTTGATGTGCTGCTGG + Intronic
1165660997 19:37579824-37579846 TATACTTTTTTTGATCCAGCTGG + Intronic
1202653688 1_KI270707v1_random:29452-29474 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
925133152 2:1508253-1508275 TAAGCTTTTTCATTTGCTGCTGG + Intronic
925301539 2:2817246-2817268 TAAACTTTTTGATGTGCTGCTGG + Intergenic
926552779 2:14319992-14320014 TATAGTTTTCTTGTTTCTGCTGG + Intergenic
927023763 2:19044437-19044459 TATATTTTTTCAGTTGCAGGTGG - Intergenic
927366751 2:22305719-22305741 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
927386696 2:22542710-22542732 TCTACTTTCTCAGATGCTGCTGG + Intergenic
927694902 2:25232985-25233007 TATGTTTTTTTATTTGCTCCAGG + Exonic
927773457 2:25883639-25883661 TTTACTCTTTTGGCTGCTGCAGG - Intergenic
927995583 2:27483367-27483389 TCTCCTTTTTTAGTTGCTCTGGG - Exonic
928546166 2:32331109-32331131 TATATTTTTTTAGTAGCGACGGG - Intergenic
928906153 2:36369897-36369919 TGTATTTTTTCAGTTGCTGAGGG + Intronic
929191662 2:39146080-39146102 TATACTATTTCAGTTTCTACGGG + Intergenic
929257383 2:39827338-39827360 TAAACTTTTTAATGTGCTGCTGG + Intergenic
929814378 2:45219620-45219642 TATATTTTTTTTGTCCCTGCCGG - Intergenic
930523188 2:52493968-52493990 TTTTCTTTTTTAGTTGAAGCTGG + Intergenic
930894030 2:56424806-56424828 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
930926125 2:56820215-56820237 TAAACTTTTTGATGTGCTGCTGG - Intergenic
931532803 2:63235621-63235643 TTGACTTTTTAATTTGCTGCTGG - Intronic
931567886 2:63634819-63634841 TATCCTTTTTTAGTTCCTTAAGG - Intronic
931889717 2:66658170-66658192 TAAACTTTTTGATGTGCTGCTGG + Intergenic
932914233 2:75837745-75837767 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
933268950 2:80212586-80212608 TAAACTTTTTGATGTGCTGCCGG + Intronic
933435348 2:82242738-82242760 TAAACTTTTTGATGTGCTGCTGG - Intergenic
935567605 2:104626087-104626109 TAAACTTTTTGATGTGCTGCTGG + Intergenic
935822964 2:106912936-106912958 TATGCTTTTTGATGTGCTGCTGG - Intergenic
936036189 2:109114003-109114025 TAAACTTTTTGATGTGCTGCTGG + Intergenic
936995844 2:118413342-118413364 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
937559243 2:123200896-123200918 AATATTTTTTTTGTTGCTGTTGG - Intergenic
937673647 2:124565240-124565262 AATATTTTTTTTGTTTCTGCAGG - Intronic
937807634 2:126164544-126164566 TACACTTTTTGATGTGCTGCTGG - Intergenic
937848799 2:126613635-126613657 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
938855323 2:135304424-135304446 TATACTTTTTTACATACTGGTGG + Intronic
939018771 2:136933401-136933423 TATTCTTTTTTAGTAGAGGCAGG - Intronic
939381698 2:141444795-141444817 TATGCTTTTTGATGTGCTGCTGG + Intronic
939527757 2:143318796-143318818 GATACTTTTCTAGGTGCTGGGGG - Intronic
939653165 2:144789019-144789041 TAAACTTTTTGATGTGCTGCTGG - Intergenic
939704863 2:145440377-145440399 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
939858218 2:147386554-147386576 TAGAATTTTTTAGTTCCTTCAGG - Intergenic
939912726 2:148003385-148003407 TAAACTTTTTGATGTGCTGCTGG - Intronic
940125148 2:150314452-150314474 TATGCTTTTTGATGTGCTGCTGG - Intergenic
940512355 2:154633135-154633157 TATCCTTTTTTATTTGATGATGG - Intergenic
940726716 2:157343420-157343442 TATAGTTCTTCAGTTGCTTCAGG + Intergenic
940964859 2:159825731-159825753 TAAACTTTTTGATGTGCTGCTGG - Intronic
941190824 2:162379848-162379870 TATACCTGTTAAGTTGCTCCTGG + Exonic
941761827 2:169252263-169252285 TAAGCTTTTTGATTTGCTGCTGG - Intronic
941767140 2:169310569-169310591 TAAACTTTTTGATGTGCTGCTGG + Intronic
942608185 2:177713830-177713852 TGAATTTTTTTAGTTACTGCAGG - Intronic
942707639 2:178794597-178794619 TATGCTTTTTTATTTTCTACTGG - Intronic
942955582 2:181768985-181769007 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
942958388 2:181800921-181800943 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
943087117 2:183325710-183325732 TAAACTTTTTGATGTGCTGCTGG - Intergenic
943111998 2:183618349-183618371 TATGCTTTTTAATATGCTGCTGG + Intergenic
943200728 2:184820190-184820212 TAACCTTTTTTATGTGCTGCTGG - Intronic
943217634 2:185059038-185059060 TAAGCTTTTTAAGGTGCTGCTGG - Intergenic
943306402 2:186267892-186267914 TAAACTTTTTGATGTGCTGCTGG - Intergenic
943496769 2:188630154-188630176 TATTCTTTTTGACTTGCTGTGGG + Intergenic
943605573 2:189973352-189973374 TAAACTTTTTGATGTGCTGCTGG + Intronic
943975212 2:194467786-194467808 AATATTCTTTTAGTTGCTGGAGG + Intergenic
945455375 2:210046328-210046350 TGGAATTTTTTAGTTGATGCTGG - Intronic
945660185 2:212676198-212676220 TTAACTTTTTTATGTGCTGCTGG + Intergenic
946082511 2:217134773-217134795 TATGCTTTTTGATGTGCTGCTGG + Intergenic
947068140 2:226253846-226253868 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
947086366 2:226457489-226457511 TGAACTTTTTGAGGTGCTGCTGG - Intergenic
947146806 2:227075273-227075295 TATGCTTTTTGATGTGCTGCTGG - Intronic
947492472 2:230607419-230607441 TAAACTTTTTGATGTGCTGCTGG - Intergenic
947902514 2:233733674-233733696 TAAACTTTTTGATGTGCTGCTGG + Intronic
948146770 2:235714185-235714207 TATATTTTTTTAGTTGAGACAGG + Intronic
948221541 2:236273459-236273481 CATAATTTTATAGTTTCTGCAGG - Intergenic
948924413 2:241085644-241085666 TATAGTTTTTTATTGGATGCTGG + Intronic
1168933154 20:1640977-1640999 TAAACTTTTTGATGTGCTGCGGG + Intronic
1169153899 20:3312893-3312915 TAAACTTTCTTTGTTGCTGAGGG - Intronic
1169992239 20:11516232-11516254 AATACTGTTTTTGTTTCTGCTGG - Intergenic
1170766706 20:19295720-19295742 TAAACTTTTTGATGTGCTGCTGG + Intronic
1171074747 20:22111222-22111244 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1171466665 20:25333580-25333602 TATGCTTTTTGATGTGCTGCTGG - Intronic
1171861887 20:30408397-30408419 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1174371457 20:50091562-50091584 TATACTTTTTTAGTAGCGACCGG + Intronic
1174794105 20:53507487-53507509 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1174847163 20:53953715-53953737 AGTACATTTTTAGTGGCTGCAGG + Intronic
1174961497 20:55162243-55162265 TTTGACTTTTTAGTTGCTGCTGG + Intergenic
1176598445 21:8769812-8769834 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1176636564 21:9249172-9249194 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1176770887 21:13072333-13072355 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1177090152 21:16757862-16757884 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1177130010 21:17244232-17244254 TAAACTTTTTGACGTGCTGCTGG - Intergenic
1177136766 21:17312680-17312702 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1177230942 21:18318675-18318697 TACACTTTTTCAGTTACTTCCGG - Intronic
1177264620 21:18766218-18766240 TAGACTTATTTACTTGCTTCAGG + Intergenic
1177563542 21:22787785-22787807 TCTACTTGTTTATTTGTTGCGGG - Intergenic
1178771107 21:35505047-35505069 TATACTTTGATACTTGCTCCTGG - Intronic
1179046535 21:37849870-37849892 TATAGTGTTTCAGTTGCTCCTGG - Intronic
1180724339 22:17934230-17934252 TAAACTTTTTGATGTGCTGCTGG - Intronic
1181833528 22:25582629-25582651 TACACTGTTTTAGTTGCTAGAGG - Intronic
1182152629 22:28040360-28040382 TAAGCTTTTTTATGTGCTGCTGG - Intronic
1182938597 22:34251837-34251859 TAAACTTTTTGAAGTGCTGCTGG + Intergenic
1182950262 22:34368022-34368044 TAAACTTTTTGATATGCTGCTGG + Intergenic
1182983000 22:34689323-34689345 TACACTGTTTTAGTTACTGTAGG - Intergenic
1183988604 22:41583306-41583328 TGTACTTTTTTAGTAGAGGCAGG - Intronic
949265339 3:2150934-2150956 GATACTTTTTGAGTTCCTACTGG + Intronic
949446080 3:4135246-4135268 TAAACTTTTTGATGTGCTGCTGG - Intronic
949456070 3:4240136-4240158 TAAACTTTTTGATGTGCTGCTGG + Intronic
949689390 3:6618089-6618111 TATAATGTTTTAGTAGCTGTGGG + Intergenic
950023674 3:9806577-9806599 TATACGTTATTGGTTGCTGTGGG + Intronic
950906845 3:16546271-16546293 TGTTCTTTCTCAGTTGCTGCAGG - Intergenic
951005897 3:17615252-17615274 TAAACTTTTTGATATGCTGCTGG + Intronic
951361155 3:21725950-21725972 TAAACTTTTTGATGTGCTGCTGG - Intronic
951370359 3:21838544-21838566 TATTGTTTTTTAGTGGCTGTTGG - Intronic
951439347 3:22705434-22705456 TCTACTTTTCTAGTTGCTTGGGG - Intergenic
951653395 3:24978119-24978141 TAAACTTTTTGATGTGCTGCTGG + Intergenic
951758798 3:26121984-26122006 TTTACTTTTTGATGTGCTGCTGG - Intergenic
952206357 3:31184685-31184707 TATTCCTTTCTAGTTGCTCCTGG + Intergenic
952566687 3:34667849-34667871 TATGCTTTCTTAATTGCTACAGG + Intergenic
952616669 3:35281704-35281726 TACACTTTTTGATGTGCTGCAGG - Intergenic
953047578 3:39308326-39308348 TAAACTTTTTGATGTGCTGCTGG - Intergenic
953684956 3:45070189-45070211 TATACTTTTTTAGTTTTAACTGG + Intergenic
954521965 3:51236332-51236354 TATGTTGTTTTAGTTTCTGCAGG + Exonic
955424522 3:58773996-58774018 TTTTTTTTTTTAGTTGCTGGAGG + Intronic
956269115 3:67431226-67431248 TAAACTTTTTGATGTGCTGCTGG - Intronic
956300000 3:67761786-67761808 TAAACTTTTTGATGTGCTGCTGG + Intergenic
956375077 3:68605579-68605601 TATACCTTTTCATGTGCTGCTGG - Intergenic
956536951 3:70287426-70287448 TAAACTTTTTGATGTGCTGCTGG + Intergenic
956858184 3:73296407-73296429 TAAACGTATTTACTTGCTGCAGG + Intergenic
957344914 3:78948287-78948309 TAAGCTTTTTGATTTGCTGCTGG - Intronic
957360257 3:79147163-79147185 TATTCATTTTAAGTTGCTACTGG - Intronic
957466291 3:80597349-80597371 TAAACTTTTTGATGTGCTGCTGG - Intergenic
957640263 3:82844425-82844447 TAAGCTTTTTGATTTGCTGCGGG - Intergenic
957688208 3:83532094-83532116 TATACTTTATTAATTACTGTAGG + Intergenic
957728378 3:84098738-84098760 AACACTTTTTTAATGGCTGCAGG - Intergenic
958015047 3:87930654-87930676 TAAACTTTTTTATGTGCTTCTGG + Intergenic
958253274 3:91294889-91294911 TATGCTTTTTGATGTGCTGCTGG - Intergenic
958811253 3:98862492-98862514 TAAACTTTTTGATGTGCTGCTGG - Intronic
959290374 3:104466206-104466228 TAAGCTTTTTTGGGTGCTGCTGG + Intergenic
959522630 3:107337476-107337498 TAAACTTTTTGATGTGCTGCTGG - Intergenic
960075131 3:113475557-113475579 TAAACTTTTTGATGTGCTGCTGG - Intronic
960316629 3:116186407-116186429 GGTACATTTTTAGTTTCTGCTGG + Intronic
960566136 3:119133844-119133866 TAGACTTTTTGATGTGCTGCTGG - Intronic
961023924 3:123535457-123535479 TATTGCTTTTTGGTTGCTGCTGG - Intronic
961588567 3:127957645-127957667 TATACTTTTTTTTTTGGTGGCGG - Intronic
962011693 3:131397787-131397809 AATACATTTTTATTTGCTGATGG + Intergenic
962239324 3:133738085-133738107 TAAACTTTTTGATGTGCTGCTGG - Intergenic
962690042 3:137886563-137886585 TAAACTTTTTGATGTGCTGCTGG - Intergenic
962702691 3:138014585-138014607 TATACTTCTGTGGTGGCTGCTGG - Intronic
962879978 3:139567709-139567731 TATGCTTTTTGATGTGCTGCTGG + Intronic
962907708 3:139820190-139820212 TAAGCTTTTTGATTTGCTGCAGG - Intergenic
963527891 3:146437144-146437166 TAAACTTTTTGATGTGCTGCTGG + Intronic
964161896 3:153655639-153655661 TAAACTTTTTGATGTGCTGCTGG - Intergenic
964390919 3:156197170-156197192 TAAACTTTTTGATATGCTGCTGG + Intronic
964429686 3:156592008-156592030 TAAACTTTTTGATGTGCTGCTGG + Intergenic
964464035 3:156969895-156969917 TATGCTTTTTGATGTGCTGCTGG - Intronic
964596425 3:158437436-158437458 TAAGCTTTTTGAGGTGCTGCTGG - Intronic
964846177 3:161046712-161046734 TAAACTTTTTGATGTGCTGCTGG - Intronic
964890279 3:161526518-161526540 TAAACTTTTTGATGTGCTGCTGG + Intergenic
965332352 3:167391353-167391375 TAAACTTTTTGATGTGCTGCTGG + Intergenic
965391150 3:168105939-168105961 TACAGTTTTTTAGTTGTTCCAGG - Intergenic
966129970 3:176625999-176626021 TATACTTTTTTAGGTGAGGGAGG - Intergenic
966316340 3:178650682-178650704 TATTCTTTTTGATGTGCTGCTGG - Intronic
966536699 3:181043119-181043141 TATGCTTTTTGATGTGCTGCTGG + Intergenic
966574234 3:181481402-181481424 TAAACTTTTTGATGTGCTGCTGG - Intergenic
967445618 3:189562758-189562780 TTTAGTTTTTCAGTTGCAGCAGG + Intergenic
968269544 3:197392821-197392843 TATAACTTTTTACATGCTGCAGG - Intergenic
968399778 4:283438-283460 TATACTCTTTTAGTTATTACTGG - Intronic
968835146 4:2958296-2958318 TGGTCTTTTTTTGTTGCTGCTGG - Intronic
969123559 4:4928369-4928391 TAAGCTTTTTGACTTGCTGCTGG - Intergenic
969970679 4:11044638-11044660 TAAACTTTTTGATGTGCTGCTGG + Intergenic
970179542 4:13375879-13375901 TATACTTTTTTAGTTGCACAGGG + Intronic
970259506 4:14209466-14209488 TAAACTTTTTGATGTGCTGCTGG + Intergenic
970604830 4:17669311-17669333 TAGACTATGTTATTTGCTGCTGG - Intronic
970822226 4:20231409-20231431 TATACTTTATTATTTTCTTCGGG - Intergenic
970995292 4:22260455-22260477 TAAACTTTTTGATGTGCTGCTGG - Intergenic
971285692 4:25287479-25287501 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
971442048 4:26697634-26697656 TAAACTTTTTGATGTGCTGCTGG - Intronic
971561052 4:28079968-28079990 TATGCTTTTTGATGTGCTGCTGG - Intergenic
971708227 4:30076401-30076423 TAAACTTTTTGATGTGCTGCTGG + Intergenic
972219657 4:36939385-36939407 TAAACTTTTTGATGTGCTGCTGG - Intergenic
973836107 4:54810858-54810880 TAAACTTTTTGATGTGCTGCTGG - Intergenic
974141772 4:57897103-57897125 TAAACTTTTTGATGTGCTGCTGG + Intergenic
974162101 4:58153290-58153312 TAAACTTTTTAATGTGCTGCTGG - Intergenic
974280282 4:59783070-59783092 TAAACTTTTTGATGTGCTGCTGG - Intergenic
974577188 4:63740664-63740686 TATTCTTTTTGATGTGCTGCTGG + Intergenic
974580315 4:63790982-63791004 TATCATTTTTTAGTTGATTCTGG - Intergenic
974600523 4:64073902-64073924 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
974641208 4:64633186-64633208 TAAACTTTTTTACGTGCTACTGG + Intergenic
974741900 4:66017934-66017956 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
974797549 4:66772409-66772431 TAAACTTTTTGATGTGCTGCTGG + Intergenic
974823434 4:67097110-67097132 TAAACTTTTTGATCTGCTGCTGG + Intergenic
974995897 4:69158227-69158249 TAAACTTTCTGATTTGCTGCTGG - Intronic
975088815 4:70376267-70376289 TATGCTTTTTGATGTGCTGCTGG - Intronic
975199677 4:71572142-71572164 TTTACTTCTTTGGGTGCTGCAGG + Intergenic
975403080 4:73959816-73959838 TAAACTTTTTGATGTGCTGCTGG + Intergenic
975842616 4:78491426-78491448 TAAACTTTTTGATGTGCTGCTGG - Intronic
976060986 4:81128199-81128221 TAAACTTTTTTATGTGCTGCTGG + Intronic
976070958 4:81239219-81239241 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
976527518 4:86111595-86111617 TAAGCTTTTTTATGTGCTGCTGG + Intronic
976861923 4:89675719-89675741 TATGCTTTTTGATGTGCTGCTGG - Intergenic
976993117 4:91394710-91394732 TATACTTCGTTAGTTTTTGCTGG - Intronic
977344011 4:95795136-95795158 TAAACTTTTTGATGTGCTGCTGG - Intergenic
977497588 4:97797556-97797578 TAAACTTTTTGATGTGCTGCTGG + Intronic
977843653 4:101741261-101741283 TAAACTTTTTGATGTGCTGCTGG + Intronic
978004511 4:103599823-103599845 TAAACTTTTTGATGTGCTGCTGG + Intronic
978007609 4:103637211-103637233 TAAGCTTTTTGATTTGCTGCTGG - Intronic
978076897 4:104542199-104542221 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
978126096 4:105136738-105136760 AATATTTTTGTAGTTGCTGTGGG - Intergenic
978912632 4:114082502-114082524 TCTAGTTCTTTAGTTGTTGCTGG + Intergenic
979103812 4:116658982-116659004 TAAACTTTTTGATGTGCTGCTGG - Intergenic
979143191 4:117204575-117204597 TTAACTTTTTTATTTGCTGCTGG - Intergenic
979176386 4:117669018-117669040 TAAACTTTTTGATGTGCTGCTGG + Intergenic
979321167 4:119326634-119326656 TAAACTTTTTGATGTGCTGCTGG + Intergenic
979373611 4:119918249-119918271 TAAACTTTTTGATGTGCTGCTGG - Intergenic
979725761 4:123958985-123959007 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
979749958 4:124266822-124266844 TATATTTTTTCATTTACTGCTGG + Intergenic
979879791 4:125941113-125941135 TATGCATTTCTAGTTACTGCTGG - Intergenic
979925288 4:126555475-126555497 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
979978265 4:127223680-127223702 TAAACTTTTTGATGTGCTGCTGG + Intergenic
980090074 4:128433874-128433896 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
980173545 4:129318024-129318046 TATACTTTTTTAGTAGAGACAGG + Intergenic
980578868 4:134722071-134722093 TAGATTTATTTAGTTGCAGCTGG + Intergenic
980644560 4:135626291-135626313 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
980687956 4:136254708-136254730 TAAACTTTTTGATGTGCTGCTGG - Intergenic
981131917 4:141166565-141166587 TAAGCTTTTTGATTTGCTGCTGG - Intronic
981501938 4:145461257-145461279 TAAACTTTTTGATCTGCTGCTGG - Intergenic
981560616 4:146044634-146044656 TAAACTTTTTGATGTGCTGCTGG + Intergenic
981810041 4:148763512-148763534 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
982885565 4:160776157-160776179 TTTACTTTTGTAGTTTCTACAGG - Intergenic
982916027 4:161210492-161210514 TTTATTTTTGTATTTGCTGCTGG + Intergenic
983688116 4:170435059-170435081 TAAACTTTTTGATGTGCTGCTGG - Intergenic
983819984 4:172181241-172181263 TATACTTTTTGATGTGCTGCTGG - Intronic
983948491 4:173612767-173612789 TAAACTTTTTGATGTGCTGCTGG + Intergenic
984144138 4:176040653-176040675 TATGCTTTTTGATGTGCTGCTGG + Intergenic
984525799 4:180858215-180858237 TAAACTTTTTGACGTGCTGCTGG + Intergenic
985204874 4:187524528-187524550 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1202751452 4_GL000008v2_random:7611-7633 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1202753130 4_GL000008v2_random:28090-28112 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
986675533 5:10181399-10181421 TAAACTTTTTAATGTGCTGCTGG - Intergenic
986753883 5:10815727-10815749 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
986896800 5:12381089-12381111 TATGCTTTTTGATGTGCTGCTGG + Intergenic
986928428 5:12788663-12788685 TATATTTTTTTTTTTGCTGGTGG + Intergenic
987637406 5:20562891-20562913 TATACTTATTCAGTTAATGCTGG + Intronic
987889327 5:23855729-23855751 TACACTTTTTGATGTGCTGCTGG + Intergenic
988063857 5:26209076-26209098 TTTACTTTTTGATGTGCTGCTGG - Intergenic
988116364 5:26897442-26897464 TAAGCTTTTTGATTTGCTGCTGG - Intronic
988157555 5:27474758-27474780 CTTACTTTTTTTGATGCTGCAGG - Intergenic
988235486 5:28538063-28538085 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
988240916 5:28607452-28607474 TATCCTTGTTTAGATGCTGTTGG - Intergenic
988612397 5:32739259-32739281 TACACTTTTTCAGCTGCTGCAGG + Intronic
988630274 5:32922529-32922551 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
988840487 5:35078831-35078853 TAAGCTTTTTGATTTGCTGCTGG - Intronic
989029283 5:37101468-37101490 TAAACTTTTTGATGTGCTGCTGG + Intergenic
989320368 5:40127435-40127457 TAAACTTTTTAATGTGCTGCTGG + Intergenic
989794931 5:45456951-45456973 TATGCTTTTGTAGTTGGAGCAGG - Intronic
989845416 5:46134630-46134652 TATGCTTTTTGATGTGCTGCTGG - Intergenic
989953892 5:50333844-50333866 TATGCTTTTTGATGTGCTGCTGG - Intergenic
990443293 5:55868004-55868026 TATTATATTTTCGTTGCTGCAGG - Intronic
990647127 5:57857592-57857614 TATACTTTTCCAATTCCTGCTGG + Intergenic
990843269 5:60107631-60107653 TAAACTTTTTGATGTGCTGCTGG - Intronic
990870308 5:60424305-60424327 TAAACTTTTTGATGTGCTGCTGG - Intronic
990907562 5:60820164-60820186 TTTACTTTTTTTGTGGCTGTAGG - Intronic
991203866 5:64026560-64026582 TATCTTTTTTTAGTTGCCACAGG + Intergenic
991324060 5:65409770-65409792 TAAACTTTTTGATGTGCTGCTGG - Intronic
991596248 5:68309503-68309525 TATAACTTTTTAATTGCTGATGG - Intergenic
992336983 5:75781609-75781631 TAAACTTTTTGATGTGCTGCTGG - Intergenic
992862287 5:80923415-80923437 TATACTTTTTTGTTTGATACAGG + Intergenic
992974076 5:82094279-82094301 TACAGTTTTTTAGTTGTTTCAGG + Intronic
993154584 5:84206669-84206691 TAAACTTTTTGATGTGCTGCTGG - Intronic
993375609 5:87146537-87146559 TAAACTTTTTGATATGCTGCTGG + Intergenic
993494322 5:88590380-88590402 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
993541929 5:89162597-89162619 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
993609365 5:90035275-90035297 TAAACTTTTTAATGTGCTGCTGG - Intergenic
993867927 5:93216782-93216804 TAAACTTTTTGATGTGCTGCTGG - Intergenic
994157245 5:96517727-96517749 TATAGTATTTTAGTAGCTGATGG - Intergenic
994264856 5:97702647-97702669 TAAACTTTTTGATGTGCTGCTGG + Intergenic
994345708 5:98683564-98683586 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
994864621 5:105251044-105251066 TATACTATTTTGGTTACTGTAGG - Intergenic
995255572 5:110042425-110042447 TAAACTTTTTGATGTGCTGCTGG + Intergenic
995658815 5:114457930-114457952 TCTGCTTTTTTAGTTGTTTCAGG + Intronic
995720034 5:115121017-115121039 TAGGCTTTTTTATGTGCTGCTGG - Intergenic
995796823 5:115950143-115950165 TATGATGTTTTTGTTGCTGCAGG - Intergenic
995806376 5:116057048-116057070 TAAACTTTTTGATATGCTGCTGG - Intronic
995812505 5:116123437-116123459 TAAACTTTTTGACGTGCTGCTGG + Intronic
996213056 5:120835190-120835212 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
996240548 5:121195277-121195299 TATCCTTTTTTAGTTCTTTCAGG - Intergenic
996292784 5:121873551-121873573 TATACTTTGTAAGTTAATGCAGG + Intergenic
996323739 5:122249149-122249171 TAAACTTTTTGATGTGCTGCTGG + Intergenic
996427564 5:123331726-123331748 TAAACTTTTTGATGTGCTGCTGG + Intergenic
997138072 5:131347772-131347794 TAAGCTTTTTGAGGTGCTGCTGG - Intronic
997144667 5:131419983-131420005 TTCAGTTTTTTAGTTGCTTCAGG - Intergenic
998277859 5:140775784-140775806 TAAACTTTTTGATGTGCTGCTGG + Intergenic
998552058 5:143087331-143087353 CATCCTTTTATAGTTGCTGAAGG - Intronic
998655008 5:144169062-144169084 TAAACTTTTTTAGATGGTTCTGG - Intronic
998752410 5:145337148-145337170 TATTCTTTTTTAGTTTCTTAAGG - Intergenic
998873010 5:146571396-146571418 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
998884330 5:146678165-146678187 TAAGCTTTTTGAGGTGCTGCTGG - Intronic
999970322 5:156853968-156853990 TATTCTTTTTTGGTTTCTGCAGG - Intergenic
1001823867 5:174730646-174730668 TATACTTTTTTACATGTTGGGGG + Exonic
1003438407 6:6116556-6116578 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1003724160 6:8740509-8740531 TTAACTTTTTTATGTGCTGCTGG - Intergenic
1003948491 6:11096482-11096504 AATACTTTTTTTGTTGTTGTTGG + Intronic
1004590691 6:17048533-17048555 TATATTTCTTTTGTTGCTGAAGG - Intergenic
1004593612 6:17077529-17077551 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1004758405 6:18638794-18638816 TATGCTTTTTGAGGTGCTTCTGG + Intergenic
1004976296 6:20970741-20970763 TATACTTCTTTAGATACTTCTGG + Intronic
1005177413 6:23062588-23062610 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1005239510 6:23807686-23807708 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1005447605 6:25940752-25940774 AATACTTTTTTATTTGGGGCTGG + Intergenic
1005581512 6:27239549-27239571 TATATTTTTGTTGTTGTTGCAGG - Intergenic
1005924795 6:30434047-30434069 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1007194171 6:40046032-40046054 CCCACTTTTTTAGTTGCTGTTGG - Intergenic
1008080507 6:47189751-47189773 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1008122908 6:47637997-47638019 TAAACTTTTTTATGTGCTGCAGG + Intergenic
1008189693 6:48439357-48439379 TGGACTTTTTGAGTTGATGCTGG + Intergenic
1008189697 6:48439426-48439448 TGGACTTTTTGAGTTGATGCCGG + Intergenic
1008532091 6:52471692-52471714 TGTATTTTTTTAGTAGATGCAGG - Intronic
1008812023 6:55514186-55514208 TATATTTTTCAGGTTGCTGCTGG - Exonic
1009330740 6:62416922-62416944 TACACTTTTTGATGTGCTGCTGG - Intergenic
1009399205 6:63234149-63234171 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1009754531 6:67919403-67919425 TAAGCTTTTTTACTTTCTGCTGG + Intergenic
1010158871 6:72828110-72828132 TATGCTGTTGTAGTTCCTGCAGG + Intronic
1010275141 6:73960289-73960311 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1010718122 6:79253667-79253689 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1010722158 6:79295636-79295658 TTAACTTTTTGATTTGCTGCTGG + Intergenic
1010789670 6:80050450-80050472 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1010956747 6:82098873-82098895 TATACTTTTTGATGTGCTGTGGG - Intergenic
1010959249 6:82126552-82126574 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1011005113 6:82635816-82635838 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1011308441 6:85955271-85955293 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1011613258 6:89174181-89174203 TGTACTTTCTTATTTACTGCAGG + Intergenic
1012075360 6:94675983-94676005 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1012081315 6:94761529-94761551 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1012086126 6:94827919-94827941 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1012590390 6:100973172-100973194 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1012708398 6:102565073-102565095 TCTTCTTTTTTATTTGCTCCTGG - Intergenic
1013387728 6:109648864-109648886 TAAACTTTTTGATGTGCTGCTGG - Intronic
1013669593 6:112385407-112385429 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1013926345 6:115477405-115477427 TACACTTTTTGATGTGCTGCTGG + Intergenic
1013933580 6:115566323-115566345 TTAACTTTTTTATGTGCTGCTGG - Intergenic
1013939944 6:115648921-115648943 TAAGCTTTTTAATTTGCTGCTGG - Intergenic
1014145372 6:117991811-117991833 TATACTTTTTTGGTTAGTACTGG + Intronic
1014330492 6:120057890-120057912 TTTACTTTTTGATGTGCTGCTGG - Intergenic
1014560291 6:122881667-122881689 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1014589567 6:123246875-123246897 TAAACTTTTTGATGTGCTGCTGG - Intronic
1014869329 6:126572370-126572392 CCTACTTTTTTCCTTGCTGCTGG - Intergenic
1014881558 6:126730013-126730035 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1015047964 6:128800945-128800967 TCTATTTTTTTAATTGCTGTTGG - Intergenic
1015133359 6:129839201-129839223 TAAACTTTTTTATGTGCTGCTGG - Intronic
1015162725 6:130171307-130171329 TAAACTTTTTGATGTGCTGCTGG + Intronic
1015967380 6:138708283-138708305 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1016483143 6:144504626-144504648 TACACTTTTTGATATGCTGCTGG + Intronic
1016778107 6:147928034-147928056 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1016910875 6:149197747-149197769 TCTAGTTTTTTAGTTGTTTCAGG - Intergenic
1017125833 6:151063908-151063930 TATAATATTATAGTTGCTGCAGG + Intronic
1017310347 6:152968712-152968734 TAGGCTTTTTGAGGTGCTGCTGG + Intergenic
1017411853 6:154175945-154175967 TAAGCTTTTTGATTTGCTGCTGG - Intronic
1017432070 6:154381330-154381352 TCTACTTTTTAAGTTGCAGGGGG - Intronic
1017475346 6:154785633-154785655 TATCACTTTTTAGTAGCTGCAGG + Intronic
1017640945 6:156493519-156493541 GATTCTTCTTGAGTTGCTGCAGG - Intergenic
1017653892 6:156608447-156608469 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1017915328 6:158827057-158827079 GACACTGTTTTAGTTGCTGAGGG - Intergenic
1018353893 6:162992108-162992130 TAAGCTTTTTGAGGTGCTGCTGG + Intronic
1018628478 6:165802929-165802951 TACACTTTTTCAGTTGTTTCCGG + Intronic
1020428971 7:8099897-8099919 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1020773814 7:12428708-12428730 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1021282363 7:18736602-18736624 TAAACTTTTTGATATGCTGCTGG + Intronic
1021407377 7:20287984-20288006 TATTTTTCTTTAGCTGCTGCTGG + Intergenic
1021738695 7:23663889-23663911 TGTACTTATTTTGTTGCTGGAGG + Intergenic
1022448527 7:30491803-30491825 TATACTTTTTTAGTGGTTCTAGG + Intergenic
1022644873 7:32220640-32220662 TATATTTTTTTAGTAGAGGCGGG - Intronic
1022745047 7:33163197-33163219 TAAACTTTTTGATGTGCTGCTGG + Intronic
1023321172 7:38999249-38999271 GATACTTTTTTATTAGCTACTGG + Intronic
1024173004 7:46809769-46809791 TATTCTTTTCCTGTTGCTGCTGG + Intergenic
1024461565 7:49665056-49665078 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1024738436 7:52330510-52330532 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1025001464 7:55318893-55318915 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1025569929 7:62549768-62549790 TAAACTTTTTGATATGCTGCTGG + Intergenic
1027819235 7:83022335-83022357 TATACTGTTTTAGTTCATTCAGG - Intronic
1029641226 7:101821292-101821314 AATACTTTTATGGTTGCTGGTGG - Intronic
1029961913 7:104696646-104696668 TATTATTTTTTAGTTATTGCTGG - Intronic
1030202811 7:106922574-106922596 TGTGCTTTTTGAGGTGCTGCTGG - Intergenic
1030413459 7:109211818-109211840 TATTCTTTTTGATGTGCTGCTGG + Intergenic
1030749627 7:113215520-113215542 TAGATTTTTTTAGTTGTTGCAGG - Intergenic
1031189434 7:118528485-118528507 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1031239085 7:119215515-119215537 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1031270793 7:119646454-119646476 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1031391735 7:121223325-121223347 TAAACTTTTTGATGTGCTGCTGG + Intronic
1031453004 7:121945180-121945202 TAGTCTTTTTTATTTTCTGCTGG - Intronic
1031736278 7:125366116-125366138 TTAACTTTTTGATTTGCTGCTGG + Intergenic
1032536055 7:132665314-132665336 TAAACTTTTTGATGTGCTGCTGG - Intronic
1032920273 7:136537644-136537666 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1032922150 7:136561251-136561273 TACACTTTTTGATGTGCTGCTGG + Intergenic
1033624168 7:143092036-143092058 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1033794080 7:144826660-144826682 TTTATTTTTTTTGTTGCTGTTGG - Intronic
1034723029 7:153312713-153312735 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1035607062 8:936698-936720 TTTGGTTTTTTAGTTGCTGTTGG + Intergenic
1036411071 8:8502106-8502128 TGAACTTTTTTATTAGCTGCAGG - Intergenic
1038151716 8:24947212-24947234 CATTCTTTCTTAGTTTCTGCAGG - Intergenic
1038551581 8:28473807-28473829 TATTCTTTTTTACTTACTGTAGG - Exonic
1038565432 8:28616450-28616472 TATACTTTTTTAGTAGAGGCGGG - Intronic
1039285154 8:36031822-36031844 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1040393521 8:46972007-46972029 CATTCATTTTCAGTTGCTGCTGG + Intergenic
1040405441 8:47097333-47097355 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1040458614 8:47625010-47625032 TAAGCTTTTTGAGGTGCTGCTGG - Intronic
1040771981 8:50988853-50988875 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1040863693 8:52026260-52026282 TATACCTTTTTAATTGCTTCTGG - Intergenic
1040903705 8:52442996-52443018 GATTCTTTTTTAGTTACTTCGGG - Intronic
1041703479 8:60818263-60818285 TAGACATTTTTAGTTGCAGCAGG - Intronic
1041885634 8:62804423-62804445 TAAACTTTTTGATGTGCTGCTGG - Intronic
1041946217 8:63445871-63445893 TATACTTTTTGATGTGCTGCTGG + Intergenic
1041972264 8:63757430-63757452 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1042111285 8:65383718-65383740 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1042541456 8:69911304-69911326 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1042629381 8:70800229-70800251 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1042644955 8:70976585-70976607 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1042853181 8:73237220-73237242 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1043911601 8:85870661-85870683 TAAGCTTTTTTATATGCTGCTGG + Intergenic
1044030114 8:87225608-87225630 TAAGCTTTTTGAGGTGCTGCTGG + Intronic
1044074102 8:87796993-87797015 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1044113635 8:88306552-88306574 TATGCTTTTTTATATGCTGCTGG - Intronic
1044116885 8:88346595-88346617 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1044127657 8:88477969-88477991 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1044135568 8:88581452-88581474 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1044201675 8:89445647-89445669 TAAACTTTTTGATATGCTGCTGG - Intergenic
1044882715 8:96740831-96740853 TAAGCTTTTTGAGGTGCTGCTGG + Intronic
1044939908 8:97331505-97331527 TAAACTTTTTAATGTGCTGCTGG + Intergenic
1044960437 8:97525391-97525413 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1044967979 8:97591949-97591971 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1045164582 8:99589166-99589188 TAAACTTTTTGATGTGCTGCTGG + Intronic
1045595207 8:103647199-103647221 TATGCTTTTTTATGTGCTGCTGG + Intronic
1045882887 8:107062051-107062073 TACACTTTTTGATGTGCTGCTGG + Intergenic
1045933188 8:107650564-107650586 TAAACTTTTTGAAGTGCTGCTGG + Intergenic
1045978155 8:108152828-108152850 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1046068289 8:109221740-109221762 TGTTCTTTTTGAGCTGCTGCTGG - Intergenic
1046088716 8:109471561-109471583 CATTCATTTTCAGTTGCTGCTGG - Intronic
1046318167 8:112534803-112534825 TAAACTTTTTGATGTGCTGCTGG - Intronic
1046326578 8:112655190-112655212 TATAGTTTTATATTTGCTGTTGG - Intronic
1047031554 8:120887215-120887237 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1048424435 8:134309879-134309901 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1049136370 8:140904365-140904387 TATGCTTTTTCATGTGCTGCTGG + Intronic
1049561264 8:143311910-143311932 TATACTTTGTGAGTTGGTTCTGG - Intronic
1050373813 9:4950077-4950099 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1050688736 9:8201342-8201364 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1050864078 9:10475751-10475773 TAAGCTTTTTGATTTGCTGCTGG - Intronic
1050927708 9:11286642-11286664 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1050942819 9:11482115-11482137 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1051479768 9:17546750-17546772 TACACTTTTTGATGTGCTGCTGG - Intergenic
1051800238 9:20924633-20924655 TATTCTTTTTTTGTTGTTGTGGG + Intronic
1051902095 9:22054763-22054785 TTTACTTTATTTGTTGTTGCTGG + Intergenic
1052078857 9:24178688-24178710 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1052173680 9:25431646-25431668 TAAACTTTTTGATTTGCTGCTGG - Intergenic
1052280869 9:26731966-26731988 TAAACTTTTTCATGTGCTGCTGG + Intergenic
1052475121 9:28949895-28949917 TAAACTTTTTAATGTGCTGCAGG - Intergenic
1052475132 9:28950017-28950039 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1052506143 9:29357151-29357173 TAAACTTTTTGAAATGCTGCTGG + Intergenic
1052667664 9:31515744-31515766 TAAGCTTTTTCAGGTGCTGCTGG + Intergenic
1052696491 9:31885526-31885548 TAAGCTTTTTCAGGTGCTGCTGG + Intergenic
1052949898 9:34200016-34200038 TATACTTTCTTAGTTTCTTCTGG + Intronic
1055168659 9:73227538-73227560 TACACTTTTTGATGTGCTGCTGG - Intergenic
1055226754 9:74006329-74006351 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1055234419 9:74103128-74103150 TAAACTTTTTGATATGCTGCTGG - Intergenic
1056465619 9:86851121-86851143 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1057768757 9:97947709-97947731 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1058199727 9:102024606-102024628 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1058208097 9:102133176-102133198 TAAACTTTTTTATGTGCTGCTGG + Intergenic
1058512103 9:105730438-105730460 TAAACTTTTTGATGTGCTGCTGG + Intronic
1062298067 9:135845139-135845161 TAAACTTTTTGATGTGCTGCTGG - Intronic
1203690905 Un_GL000214v1:41865-41887 TAAGCTTTTTTATATGCTGCTGG + Intergenic
1203718971 Un_KI270742v1:185940-185962 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1203533916 Un_KI270743v1:12800-12822 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1203645390 Un_KI270751v1:62326-62348 TAAGCTTTTTTATATGCTGCTGG - Intergenic
1203653205 Un_KI270751v1:149617-149639 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1186794315 X:13029672-13029694 TTTATTTTTACAGTTGCTGCTGG - Intergenic
1186964095 X:14769027-14769049 TAAACTTTTTGACCTGCTGCTGG + Intergenic
1187105044 X:16233058-16233080 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1187271456 X:17783740-17783762 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1187303037 X:18069899-18069921 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1187537010 X:20150862-20150884 TATACTTTGCTAGTTGCTCTGGG + Exonic
1187763458 X:22612928-22612950 TAAACTTTTTGATATGCTGCTGG - Intergenic
1187767573 X:22660295-22660317 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1188109355 X:26178906-26178928 TAAGCTTTTTTATGTGCTGCTGG + Intergenic
1188723222 X:33548640-33548662 TAAGCTTTTTGATTTGCTGCCGG + Intergenic
1188969690 X:36598574-36598596 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1189582977 X:42427229-42427251 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1190604121 X:52122922-52122944 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1190608972 X:52174541-52174563 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1191068294 X:56373888-56373910 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1191079284 X:56491812-56491834 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1191173184 X:57470868-57470890 TAAGCTTTTTTATGTGCTGCTGG - Intronic
1191193104 X:57688023-57688045 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1191196367 X:57727846-57727868 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1191973291 X:66841646-66841668 TATGCTTTTTGATGTGCTGCTGG - Intergenic
1192620852 X:72678719-72678741 AATAGTTTTTTAGTTGTTGCAGG - Intronic
1192672169 X:73156858-73156880 GATACTTTTTTAGTTTCTAGTGG - Intergenic
1192712290 X:73603869-73603891 TAAGCTTTTTGATTTGCTGCTGG + Intronic
1192714204 X:73622064-73622086 TAAGCTTTTTGATTTGCTGCTGG + Intronic
1192857898 X:75033600-75033622 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1193001876 X:76571797-76571819 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1193146232 X:78078730-78078752 TAAACTTTTTGATGTGCTGCTGG + Intronic
1193281178 X:79652765-79652787 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193309565 X:79989635-79989657 TAAACTTTTTAATGTGCTGCTGG - Intergenic
1193334987 X:80277515-80277537 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1193381801 X:80824574-80824596 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193385359 X:80864823-80864845 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193452997 X:81693824-81693846 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1193461406 X:81794832-81794854 TAAGCTTTTTTATGTGCTGCTGG - Intergenic
1194024250 X:88732021-88732043 CATACTTTTTGATGTGCTGCCGG + Intergenic
1194121412 X:89967824-89967846 TTTACTTTTTGATGTGCTGCTGG + Intergenic
1194208171 X:91036502-91036524 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1194274342 X:91860831-91860853 TAAGCTTTTTGATTTGCTGCTGG + Intronic
1194805521 X:98322324-98322346 TTTACTTTTTGATGTGCTGCTGG - Intergenic
1194819609 X:98489650-98489672 TATACTGTCTCAGATGCTGCTGG - Intergenic
1195153012 X:102093441-102093463 TCTACTTTTTTATGTGCTGTGGG + Intergenic
1195508602 X:105687845-105687867 TATGCTTTTTGATGTGCTGCGGG - Intronic
1195836146 X:109116944-109116966 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1195855506 X:109328024-109328046 TAAGCTTTTTTATTTGCTGCTGG + Intergenic
1195984248 X:110612078-110612100 TGTACTTTTTTTGTTGTTGTTGG - Intergenic
1196512684 X:116530897-116530919 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1196562517 X:117167599-117167621 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1197107574 X:122733834-122733856 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1197191439 X:123652054-123652076 TAAACTTTTTGATGTGCTGCTGG - Intronic
1197235866 X:124062057-124062079 TATACTTTTTTAGTTGCTGCAGG + Intronic
1197349477 X:125365699-125365721 TATGCTTTTTGATGTGCTGCTGG + Intergenic
1197438628 X:126462896-126462918 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1197600927 X:128528764-128528786 TTTACTTTTTGATATGCTGCTGG - Intergenic
1198784123 X:140269246-140269268 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1199006520 X:142704869-142704891 TTTAATTTTTTAGTTTCTGTGGG - Intergenic
1199167391 X:144693031-144693053 TAAACTTTTTGACGTGCTGCTGG + Intergenic
1199371455 X:147054667-147054689 TATATTATTTAAGTTGGTGCAGG - Intergenic
1199481391 X:148302116-148302138 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1199946839 X:152676853-152676875 TAAGCTTTTTGAGGTGCTGCTGG + Intergenic
1199994843 X:153016368-153016390 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1200088332 X:153622556-153622578 TATACTTTTCTTTTTTCTGCCGG - Intergenic
1200474268 Y:3625275-3625297 TTTACTTTTTGATGTGCTGCTGG + Intergenic
1200565133 Y:4755625-4755647 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1200591580 Y:5082237-5082259 TAAGCTTTTTGATTTGCTGCTGG + Intronic
1200899169 Y:8410338-8410360 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1200955907 Y:8945412-8945434 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1201173126 Y:11290782-11290804 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1201483040 Y:14461146-14461168 TAAACTTTTTGATGTGCTGCTGG - Intergenic
1201492052 Y:14552550-14552572 TAAACTTTTTGATGTGCTGCTGG - Intronic
1201529223 Y:14973536-14973558 TAAACTTTTTGATGTGCTGCTGG + Intergenic
1201566674 Y:15372249-15372271 TAAGCTTTTTGAGGTGCTGCTGG - Intergenic
1201595615 Y:15665142-15665164 TAAGCTTTTTGATTTGCTGCTGG + Intergenic
1201710717 Y:16988684-16988706 TAAGCTTTTTGATTTGCTGCTGG - Intergenic
1201984094 Y:19944285-19944307 AACACTTTTTGATTTGCTGCTGG + Intergenic
1202112717 Y:21440537-21440559 TACACTTTTTGATGTGCTGCTGG + Intergenic
1202165821 Y:21986569-21986591 TACACTTTTTGATGTGCTGCTGG + Intergenic
1202225537 Y:22599803-22599825 TACACTTTTTGATGTGCTGCTGG - Intergenic
1202273162 Y:23089568-23089590 TATTCTTTCTCAGCTGCTGCAGG - Intergenic
1202292864 Y:23331114-23331136 TATTCTTTCTCAGCTGCTGCAGG + Intergenic
1202317576 Y:23595858-23595880 TACACTTTTTGATGTGCTGCTGG + Intergenic
1202426159 Y:24723312-24723334 TATTCTTTCTCAGCTGCTGCAGG - Intergenic
1202444630 Y:24946774-24946796 TATTCTTTCTCAGCTGCTGCAGG + Intergenic
1202553189 Y:26074200-26074222 TACACTTTTTGATGTGCTGCTGG - Intergenic