ID: 1197238738

View in Genome Browser
Species Human (GRCh38)
Location X:124098626-124098648
Sequence CAAACTGAAGTGTCTACATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197238738 Original CRISPR CAAACTGAAGTGTCTACATT AGG (reversed) Intronic
907050716 1:51328358-51328380 CAAATGGAGGTGTCTACATAGGG + Intronic
907217211 1:52874564-52874586 TAAATTAAAGTATCTACATTGGG + Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908455721 1:64303011-64303033 TCAGCTGAAGTGTCTACATGTGG + Intergenic
910523372 1:88149338-88149360 GAAACTGAGGTTTCTACCTTTGG + Intergenic
911207058 1:95102438-95102460 AAAATTGAAGTCTCTAGATTGGG + Intergenic
911967406 1:104385683-104385705 CAAACTAGAGTGTCTTCATATGG - Intergenic
918906045 1:190495696-190495718 CAAACTGATATGTCTTCATGTGG - Intergenic
919066648 1:192699631-192699653 CAAACTGAATTATATATATTAGG + Intergenic
921246416 1:213246973-213246995 GAAACTTAAGTGACTATATTAGG - Intronic
923121082 1:230992153-230992175 CAAGCTGAAGTCTTTACAGTGGG + Intronic
1066118935 10:32264932-32264954 TAAACTTAAGTGTCTAAAATGGG - Intergenic
1067479141 10:46584139-46584161 CAACCTGAAATATCCACATTTGG + Intronic
1067615598 10:47757662-47757684 CAACCTGAAATATCCACATTTGG - Intergenic
1068831756 10:61504254-61504276 CAAACTGAGGTGTGTACGTAGGG - Intergenic
1069032455 10:63612125-63612147 AAAAAGGAAATGTCTACATTAGG - Intronic
1072103705 10:92253905-92253927 CAAACTCAAATCTTTACATTTGG - Intronic
1073112838 10:101072887-101072909 AGTACTGAAGTGTCTGCATTTGG - Intergenic
1074700928 10:116091692-116091714 CAGAATTAAGTTTCTACATTTGG + Intronic
1081695011 11:45103553-45103575 CAAACTTAAGTGTTAACCTTTGG + Intronic
1086339017 11:85828046-85828068 CTAACTGTAGTGACTACGTTTGG + Intergenic
1090036625 11:123255029-123255051 CAGAGTGAAGTTTCCACATTTGG - Intergenic
1091098418 11:132845951-132845973 CAAAGTTAAGTGTCCACACTGGG - Intronic
1092725082 12:11476931-11476953 CAAACTGAAGAGTCTAAATCTGG + Intronic
1093288169 12:17291819-17291841 AAAACTGAAGGGACTAAATTAGG - Intergenic
1095789595 12:46150163-46150185 CAAACTGAATGTTCTACAATAGG + Intergenic
1096583919 12:52607186-52607208 CAAAGAGGAGTCTCTACATTTGG + Intergenic
1097475724 12:60053684-60053706 AAAGCTCAAGTGTTTACATTAGG + Intergenic
1099711260 12:86227769-86227791 CAAAATGATGTTTCTACATCAGG - Intronic
1100636968 12:96443815-96443837 CAAACAGAAGTTTCTAAGTTTGG - Intergenic
1105257922 13:18756994-18757016 GAGACTGAAGTTTTTACATTTGG - Intergenic
1107682712 13:42867762-42867784 CAAATTGAAGTCACTACAGTTGG - Intergenic
1111968506 13:94885520-94885542 CAGAGTGAAGATTCTACATTTGG + Intergenic
1113167945 13:107464385-107464407 CACACTGAAGTGTCAAAACTAGG + Intronic
1114038042 14:18647908-18647930 CAAACCAAAGTGACTACTTTTGG - Intergenic
1114120574 14:19667128-19667150 CAAACCAAAGTGACTACTTTTGG + Intergenic
1115016589 14:28622977-28622999 CAGTCTGAAGTGTCCACATTAGG + Intergenic
1115126022 14:29994708-29994730 CAAACTGATGTGTGTAGAGTTGG + Intronic
1119065670 14:71523827-71523849 CAAACTGAAGAGGCCACATCTGG - Intronic
1126297061 15:47151596-47151618 CAGACTCAAGGGTCTACCTTGGG - Intergenic
1126686987 15:51257008-51257030 CAATCTTAAGTGTCTCCTTTTGG + Intronic
1127286316 15:57536779-57536801 CAAGGTGAAGTGACTACATAGGG + Intronic
1127495760 15:59510420-59510442 CAAACTGATGTGTCTAGACTTGG - Intronic
1129404654 15:75308009-75308031 CACTCTGAAGTGTCTGGATTTGG + Intergenic
1134798967 16:17067066-17067088 TAAACTGAAGTATCTATCTTAGG + Intergenic
1140678093 16:77353654-77353676 CTAACAGAAGTGTAAACATTTGG - Intronic
1142380273 16:89728046-89728068 CAAACTGGGGTGTCCTCATTTGG - Intronic
1144012504 17:11163094-11163116 CAAACTCCAGAGTTTACATTAGG - Intergenic
1144414973 17:15037948-15037970 CAAACTGTAGTGTCTTTAGTTGG + Intergenic
1144760101 17:17702299-17702321 CCAACTGAAGGGTCTGAATTTGG - Intronic
1147398780 17:40166088-40166110 GAAACTTAAGTGTCCACATTTGG + Intronic
1149473461 17:56939175-56939197 CAAAATGAAGTGCCTAAACTGGG - Intronic
1155844529 18:30689057-30689079 CAATGTGAAGTCTCTACAGTTGG - Intergenic
1156743452 18:40360921-40360943 TAAACTGAAGTCTCCCCATTTGG + Intergenic
1158192620 18:54847416-54847438 CAAATTGAAGAGTCAACATAGGG + Intronic
1164056711 19:21628247-21628269 AAAACAGAAGGGTCTACTTTGGG - Intergenic
1165639186 19:37369932-37369954 CAAGCTGGAGTGTCCACATGTGG - Intergenic
1168050385 19:53825385-53825407 CCATCTGAAGTGCCTTCATTTGG - Intergenic
925670132 2:6302499-6302521 CCAGCTGAAGTGGCTACAATTGG + Intergenic
930336557 2:50055500-50055522 CACACTGAAGCATCTACAATAGG + Intronic
931036458 2:58249375-58249397 TAAAGTGAAGTGCCAACATTGGG + Intergenic
935730439 2:106060765-106060787 TCAACTGAAGTGCCTACATGTGG - Intergenic
935737202 2:106115679-106115701 GAAACTGAAGTGACTTCCTTGGG - Intronic
936003934 2:108865311-108865333 AAAACTTAAGTGTGTACATGTGG + Intronic
936599261 2:113880085-113880107 CTAAGTGAAATGTATACATTGGG + Intergenic
938443319 2:131354929-131354951 CAAACCAAAGTGACTACTTTTGG - Intergenic
940528577 2:154848951-154848973 CAAATTAAAGTGTCAACTTTTGG - Intronic
941516158 2:166481687-166481709 CAAACTGAAGGGTCTTCAAATGG + Intronic
942403698 2:175630416-175630438 AAAAGGGAAGTGCCTACATTTGG - Intergenic
943171279 2:184404220-184404242 CAACCAGAAGTGGCTACGTTAGG + Intergenic
945424025 2:209676648-209676670 CAAACTGTAGTGTCTTCCTATGG - Intronic
945966457 2:216192466-216192488 CAAACTGAGGTGTGTTCACTGGG - Intronic
1169126794 20:3134224-3134246 CATATTGAAATGTTTACATTTGG + Intronic
1171093540 20:22309474-22309496 TAAAATGTAGTGTCTTCATTTGG + Intergenic
1172061223 20:32188683-32188705 CAAGATGAAGTGGCTTCATTTGG - Intergenic
1176331028 21:5548486-5548508 ACATCTGAAGTGTATACATTTGG + Intergenic
1176396729 21:6272465-6272487 ACATCTGAAGTGTATACATTTGG - Intergenic
1176440428 21:6716639-6716661 ACATCTGAAGTGTATACATTTGG + Intergenic
1176464690 21:7043708-7043730 ACATCTGAAGTGTATACATTTGG + Intergenic
1176488251 21:7425487-7425509 ACATCTGAAGTGTATACATTTGG + Intergenic
1178196184 21:30347581-30347603 CAAAGTGAAGTGTCCTGATTAGG + Intergenic
1178641266 21:34346118-34346140 TAAACAGAGTTGTCTACATTTGG + Intergenic
1179458170 21:41513981-41514003 CAAATGGAAGTGTCTATATGTGG - Intronic
1180462169 22:15574949-15574971 CAAACCAAAGTGACTACTTTTGG - Intergenic
1182358628 22:29734123-29734145 CAAACTGAAGAGCCAACAATGGG + Intronic
1182511952 22:30826227-30826249 CAAAGTGCACTGTCTATATTTGG + Intronic
1183181237 22:36261395-36261417 TAAACTCAGGTGACTACATTTGG - Intronic
1184539254 22:45109207-45109229 GAAACTGAAGTCAGTACATTGGG - Intergenic
951606445 3:24439872-24439894 CAAACTGGAATTTCTTCATTGGG - Intronic
952462660 3:33545424-33545446 CAAAATGAAGTGTGCAGATTTGG - Intronic
953378809 3:42451021-42451043 CAGCCAGCAGTGTCTACATTAGG + Intergenic
955547281 3:60044763-60044785 CAAACAGAAGTGTCTATCTTAGG + Intronic
955663397 3:61325373-61325395 CAAACTGAAATATCTCCAGTGGG + Intergenic
955921255 3:63958075-63958097 CAAACGGAAGTGTCAAAATTTGG + Intronic
957390756 3:79565256-79565278 CAGACAGAACTGTTTACATTTGG + Intronic
957673375 3:83334592-83334614 CACACTGCAGTTTCTACAATAGG + Intergenic
958213869 3:90533804-90533826 CAAACGGAAGTTTCAACAATAGG + Intergenic
958555890 3:95676180-95676202 CATACTGAAATGTCTCCAGTTGG + Intergenic
961810858 3:129520964-129520986 CAAAGGGAAGAGTCTCCATTGGG - Intergenic
963444553 3:145387619-145387641 TAAACTGGATTTTCTACATTTGG - Intergenic
963827959 3:149975352-149975374 CACTATGATGTGTCTACATTTGG + Intronic
964869239 3:161295066-161295088 CAAACTTTATTGTCTAAATTAGG - Intergenic
965764656 3:172117555-172117577 AAAACAGAAGTGTCGACATAGGG + Intronic
965774444 3:172213860-172213882 CAAAATCAAGGGTCTACATTTGG - Intronic
967588238 3:191240310-191240332 AAAACTAAAATGTTTACATTAGG - Intronic
968750027 4:2383989-2384011 CACCCTGAAGTGTCTCCACTGGG + Intronic
969897058 4:10315307-10315329 CTAACTGAAGTGTCTAGAGATGG + Intergenic
970792308 4:19873151-19873173 CAAAATCAAGGGGCTACATTTGG - Intergenic
971677355 4:29649633-29649655 CAAAGTCAAATGTCTACTTTTGG - Intergenic
976876445 4:89858923-89858945 AAAACTGGAATATCTACATTTGG + Intergenic
976912701 4:90327032-90327054 CAAACTGAAGGGTTTTCACTAGG - Intronic
977861274 4:101963352-101963374 CAAAATGAAATCTCTCCATTTGG + Intronic
977942333 4:102872787-102872809 CAAAATGAAGTATCTTCTTTGGG - Intronic
978281642 4:107023381-107023403 CAATCTGAAATGGCTACATATGG + Intronic
979303815 4:119119386-119119408 GAAACTGAATTGTTTATATTGGG - Intergenic
980706804 4:136507790-136507812 CAAACTCAAGTTTCTAACTTGGG + Intergenic
982573001 4:157074416-157074438 CAAACTCTAATGTCCACATTTGG - Intergenic
983766994 4:171496508-171496530 CATTTTGAATTGTCTACATTTGG + Intergenic
987020992 5:13871013-13871035 AAAACTGAACTGTAGACATTTGG - Intronic
988800871 5:34695520-34695542 CAAACTGAGGTGTATACTGTAGG + Intronic
989066153 5:37464022-37464044 CAAACTGTTCTATCTACATTTGG - Intronic
990278024 5:54220198-54220220 CAACCACAAGTGTCTACATATGG - Intronic
990683234 5:58269677-58269699 CAAACTCAATTGTATACATTTGG + Intergenic
990695524 5:58412247-58412269 CAAACTGAACTCTCTGCTTTTGG - Intergenic
991605223 5:68394448-68394470 AGTACAGAAGTGTCTACATTGGG - Intergenic
993185966 5:84620001-84620023 CAAAGTCCAGAGTCTACATTAGG + Intergenic
994611895 5:102052578-102052600 TAAACTGATGTTTCTGCATTGGG + Intergenic
994692681 5:103037202-103037224 CTTACTGAAGTGACCACATTTGG - Intergenic
994964236 5:106646633-106646655 CATAATGAAGTGTGTAAATTTGG - Intergenic
995206196 5:109484135-109484157 CAAACTCAAGTGGCTAAAATTGG + Intergenic
995599844 5:113783405-113783427 CAAGCTGAAGTTTCTACCTTGGG - Intergenic
995903647 5:117097718-117097740 CAATTTCAAATGTCTACATTTGG - Intergenic
998606539 5:143641017-143641039 CAAGCTGAAGCATCTTCATTAGG - Intergenic
999980922 5:156957170-156957192 CAAAGTGAAGAGACTAAATTCGG - Intronic
1001436219 5:171701693-171701715 GGAACTGAAGTGTCCACATCGGG - Intergenic
1004588066 6:17022023-17022045 CAAAGTGCAGAGTTTACATTAGG + Intergenic
1005393909 6:25361877-25361899 CAAACTCAAGAGTCTGCATCTGG - Intronic
1011861827 6:91767617-91767639 CAAAATAAAGTGTTTACAGTGGG - Intergenic
1011880555 6:92018869-92018891 CAAAATGAAGTTTGCACATTAGG + Intergenic
1012359945 6:98364920-98364942 CAAACAGAAATGTCTACTTAGGG + Intergenic
1014783180 6:125588015-125588037 CAAAATTTAGTGCCTACATTGGG - Intergenic
1016235247 6:141856191-141856213 GAATCTGAAGTGTCTACATAGGG + Intergenic
1021299284 7:18952215-18952237 CTAACTGAAGATTCTAAATTGGG + Intronic
1022480067 7:30737241-30737263 CAAACTCCATTGTCTACACTAGG + Intronic
1022893654 7:34726994-34727016 CAAAGTCCATTGTCTACATTAGG - Intronic
1023126999 7:36964537-36964559 GAAACTTAAGTCTGTACATTAGG + Intronic
1027762757 7:82301004-82301026 TAAATTGCAATGTCTACATTTGG - Intronic
1030644122 7:112040294-112040316 CAAAGTACAGTGTCTACATGTGG - Intronic
1032597066 7:133252549-133252571 AAAACTAATGTTTCTACATTAGG - Intergenic
1032931942 7:136682417-136682439 CAAACTGAAAGGGCTACATATGG + Intergenic
1033722015 7:144070553-144070575 CAAAATAAATTATCTACATTAGG - Intergenic
1035667975 8:1392941-1392963 AAAACTGATCTGTCTCCATTTGG - Intergenic
1035668432 8:1396930-1396952 AAAACTGATCTGTCTCCATTTGG - Intergenic
1035668539 8:1397932-1397954 AAAACTGATCTGTCTCCATTTGG - Intergenic
1036984099 8:13507179-13507201 CAAACTAAATTGTGTACATTTGG + Intronic
1037410563 8:18591454-18591476 CAACCTGAAGCTTCTACTTTGGG + Intronic
1038924829 8:32126987-32127009 TGAACTGAAGTGTCTCCACTGGG - Intronic
1039230033 8:35435271-35435293 CAATCTTTAATGTCTACATTAGG - Intronic
1040022224 8:42751022-42751044 AAAATTGAAGTGTTTACATACGG + Intergenic
1045796913 8:106057199-106057221 CAAACTAAAGTGACTACATAAGG + Intergenic
1047236166 8:123043477-123043499 CAAACGGAAGTGTCATTATTGGG + Intronic
1052038282 9:23708058-23708080 TAAACTGAAGAGTGGACATTGGG - Intronic
1055734961 9:79317139-79317161 CACAGCTAAGTGTCTACATTAGG - Intergenic
1056810753 9:89762137-89762159 CACACTGATGTGTCTGCATAGGG - Intergenic
1059030961 9:110695652-110695674 CAAACAGAAATATTTACATTTGG - Intronic
1059252501 9:112898452-112898474 CAAACTGCACTGTGTAAATTAGG + Intergenic
1062443797 9:136584999-136585021 CAAACAGAAGTGTCTGAATGAGG + Intergenic
1203431074 Un_GL000195v1:91840-91862 ACATCTGAAGTGTATACATTTGG - Intergenic
1203400871 Un_KI270519v1:95490-95512 CCAACTGTAGAATCTACATTGGG + Intergenic
1185434102 X:27947-27969 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434232 X:29228-29250 CAAACTCTAGAGTCTGCATTGGG + Intergenic
1185434391 X:30692-30714 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434412 X:30936-30958 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434423 X:31058-31080 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434443 X:31241-31263 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434446 X:31302-31324 CAAACTTCAGAGTCTGCATTAGG + Intergenic
1185434456 X:31422-31444 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434644 X:33190-33212 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434679 X:33556-33578 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434698 X:33739-33761 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434701 X:33800-33822 CAAACTTTAGAGTCTGCATTAGG + Intergenic
1185434710 X:33921-33943 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434799 X:34775-34797 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185434912 X:35812-35834 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435070 X:37276-37298 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435091 X:37520-37542 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435102 X:37642-37664 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435122 X:37825-37847 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435125 X:37886-37908 CAAACTTCAGAGTCTGCATTAGG + Intergenic
1185435135 X:38006-38028 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435324 X:39774-39796 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435359 X:40140-40162 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435378 X:40323-40345 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435381 X:40384-40406 CAAACTTTAGAGTCTGCATTAGG + Intergenic
1185435390 X:40505-40527 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435480 X:41359-41381 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435523 X:41725-41747 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185435681 X:43311-43333 CAAACTCTAGAGTCTGCATTGGG + Intergenic
1185435839 X:44775-44797 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185436117 X:96652-96674 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185436307 X:98542-98564 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185436442 X:99945-99967 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185436453 X:100067-100089 CAAACTTTAGAGTCTCCATTGGG - Intergenic
1185436710 X:102568-102590 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185436722 X:102689-102711 CAAACTTTAGAGTCTCCATTGGG - Intergenic
1185436812 X:103543-103565 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185436833 X:103787-103809 CAAACTTTAGAGTCTGCATTTGG - Intergenic
1185436901 X:104458-104480 CAACCTTTAGAGTCTACATTGGG - Intergenic
1185437051 X:105800-105822 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437061 X:105922-105944 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185437086 X:106166-106188 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437250 X:107752-107774 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437258 X:107874-107896 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437358 X:108850-108872 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437367 X:108971-108993 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185437370 X:109032-109054 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437389 X:109215-109237 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437424 X:109581-109603 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437556 X:110801-110823 CAACCTTTAGAGTCTACATTGGG - Intergenic
1185437706 X:112143-112165 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437716 X:112265-112287 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185437741 X:112509-112531 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437905 X:114095-114117 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185437913 X:114217-114239 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438013 X:115193-115215 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438022 X:115314-115336 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185438025 X:115375-115397 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438044 X:115558-115580 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438079 X:115924-115946 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438322 X:118242-118264 CAAACTTTAGAGTCTACATTAGG - Intergenic
1185438346 X:118486-118508 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438365 X:118669-118691 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438430 X:119340-119362 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438442 X:119461-119483 CAAACTTTAGAGTCTCCATTGGG - Intergenic
1185438532 X:120315-120337 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438553 X:120559-120581 CAAACTTTAGAGTCTGCATTTGG - Intergenic
1185438622 X:121230-121252 CAACCTTTAGAGTCTACATTGGG - Intergenic
1185438764 X:122511-122533 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438925 X:124036-124058 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185438933 X:124158-124180 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439034 X:125134-125156 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439043 X:125255-125277 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185439046 X:125316-125338 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439065 X:125499-125521 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439100 X:125865-125887 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439287 X:127633-127655 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439297 X:127753-127775 CAAACTTCAGAGTCTGCATTAGG - Intergenic
1185439300 X:127814-127836 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439360 X:128363-128385 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439368 X:128485-128507 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439469 X:129461-129483 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439478 X:129582-129604 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185439481 X:129643-129665 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439500 X:129826-129848 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439535 X:130192-130214 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439681 X:131534-131556 CAACCTTTAGAGTCTACATTGGG - Intergenic
1185439844 X:132998-133020 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185439854 X:133120-133142 CAAACTTTAGAGTCTGCATTAGG - Intergenic
1185439879 X:133364-133386 CAAACTTTAGAGTCTGCATTGGG - Intergenic
1185443159 X:238672-238694 CAAACTTTAGAGTCTCCATTGGG + Intergenic
1185443170 X:238794-238816 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443322 X:240258-240280 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443389 X:240929-240951 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443406 X:241112-241134 CAAACTTTAGAGTCTGCATTAGG + Intergenic
1185443489 X:241905-241927 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443507 X:242088-242110 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443517 X:242210-242232 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443605 X:243064-243086 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185443861 X:245564-245586 CAAACTTTAGAGTCTCCATTGGG + Intergenic
1185443872 X:245686-245708 CAAACTTTAGAGTCTGCATTGGG + Intergenic
1185444142 X:248369-248391 CAAACTTTAGAGTCTCCATTGGG + Intergenic
1185527924 X:793950-793972 GAAACTGAAATGTCTTCCTTTGG + Intergenic
1188050473 X:25479092-25479114 CAAAATAATGTGACTACATTTGG - Intergenic
1191956808 X:66651184-66651206 CAAACTGATGTTTCTACAAGAGG - Intergenic
1193634698 X:83934533-83934555 CAAACTGAAGTGTACCAATTTGG + Intergenic
1195431618 X:104795874-104795896 CAATCTGAAGTTCCTACAGTAGG + Intronic
1197212232 X:123837635-123837657 CAATCTGAAAAGTCTACATAAGG - Intergenic
1197238738 X:124098626-124098648 CAAACTGAAGTGTCTACATTAGG - Intronic
1199045833 X:143170471-143170493 CAAACAGAAGTTTGTACAATAGG - Intergenic
1201687216 Y:16718759-16718781 CAGACTCAAATGTCTACATATGG + Intergenic
1202058564 Y:20861915-20861937 TAAACTGTAGTGTCTACCATGGG + Intergenic