ID: 1197239992

View in Genome Browser
Species Human (GRCh38)
Location X:124113894-124113916
Sequence CTGGACAGGCTGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197239992_1197239999 16 Left 1197239992 X:124113894-124113916 CCTTCCACATTCAGCCTGTCCAG 0: 1
1: 0
2: 3
3: 25
4: 304
Right 1197239999 X:124113933-124113955 GTCTGATGTGGTCTATGAGTGGG 0: 1
1: 0
2: 2
3: 9
4: 94
1197239992_1197240000 27 Left 1197239992 X:124113894-124113916 CCTTCCACATTCAGCCTGTCCAG 0: 1
1: 0
2: 3
3: 25
4: 304
Right 1197240000 X:124113944-124113966 TCTATGAGTGGGCTTGCTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 118
1197239992_1197239998 15 Left 1197239992 X:124113894-124113916 CCTTCCACATTCAGCCTGTCCAG 0: 1
1: 0
2: 3
3: 25
4: 304
Right 1197239998 X:124113932-124113954 AGTCTGATGTGGTCTATGAGTGG 0: 1
1: 0
2: 2
3: 6
4: 127
1197239992_1197239995 -9 Left 1197239992 X:124113894-124113916 CCTTCCACATTCAGCCTGTCCAG 0: 1
1: 0
2: 3
3: 25
4: 304
Right 1197239995 X:124113908-124113930 CCTGTCCAGAGATTCTTAGCAGG 0: 1
1: 2
2: 10
3: 39
4: 147
1197239992_1197239997 4 Left 1197239992 X:124113894-124113916 CCTTCCACATTCAGCCTGTCCAG 0: 1
1: 0
2: 3
3: 25
4: 304
Right 1197239997 X:124113921-124113943 TCTTAGCAGGTAGTCTGATGTGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197239992 Original CRISPR CTGGACAGGCTGAATGTGGA AGG (reversed) Intronic
900638114 1:3675603-3675625 CTGCCCAGGCTGAGTGCGGACGG + Intronic
903030674 1:20462188-20462210 CTGGACATTCTGAATAAGGAAGG + Intergenic
903403902 1:23080344-23080366 CTTGACAGCCTGGATGGGGAAGG - Intronic
903508594 1:23856311-23856333 CTTGACAGGCTGAGTGTACAGGG - Intronic
903687486 1:25142537-25142559 CTGGAAAGGCTGGAGGAGGAAGG + Intergenic
904840139 1:33367351-33367373 CAGGACAGGCTGAGTGGGGGTGG + Exonic
905312785 1:37062026-37062048 ATGGACAAGCTGAAAGTTGATGG + Intergenic
905359792 1:37411340-37411362 CTGGTCAGGGTGGGTGTGGAGGG - Intergenic
905994863 1:42373107-42373129 CTTGACAGGCTTAATCTAGATGG + Intergenic
907101310 1:51839267-51839289 CTTGACAGGCTGAAGATGGGAGG - Intronic
909709710 1:78633560-78633582 TTGGATAGGCTGATTGTTGAAGG + Intronic
910792941 1:91069876-91069898 CTTGAAAGGCTGAAGGTGGGAGG - Intergenic
911038213 1:93572006-93572028 CTTAGCAGGCTGACTGTGGAGGG + Intronic
911312987 1:96319044-96319066 CTGGGCTGGCTGACTGTTGAGGG + Intergenic
912267786 1:108175869-108175891 CTAGACAGGCTGACTGTTGAAGG + Intronic
913123295 1:115761962-115761984 CTGGACAGGCACTGTGTGGATGG + Intronic
913224506 1:116687168-116687190 CTCCACAGGCAGAATGGGGAGGG - Intergenic
913262450 1:117011810-117011832 ATGGACAGCCTGAATGTAGTGGG - Exonic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913494998 1:119420343-119420365 TTGGGTAGTCTGAATGTGGAGGG - Intronic
913969284 1:143402258-143402280 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914063661 1:144227857-144227879 CTGGACAAGCAGATTGTGAAGGG + Intergenic
914115489 1:144738497-144738519 CTGGACAAGCAGATTGTGAAGGG - Intergenic
914438756 1:147682481-147682503 CTGGACATGCTGACTGGTGAAGG + Intergenic
914881125 1:151547950-151547972 CTGGACAGGCACTATGTAGAGGG - Intronic
915298694 1:154939870-154939892 CTCAGCAGGCTGAAGGTGGAAGG - Intergenic
919286475 1:195567817-195567839 CTGGACAGGCTTACTGTTGAAGG + Intergenic
919727205 1:200891966-200891988 CGGGCCAGCCTGGATGTGGAGGG + Intronic
920159630 1:203986427-203986449 CTGGACTGGGTGAATGAGAATGG + Intergenic
920377069 1:205514524-205514546 CTGGCCTGCCTGAAAGTGGAAGG + Intronic
921962126 1:221047102-221047124 TTGTACAGTCTGAATGTGGGAGG - Intergenic
922326684 1:224534946-224534968 CTGAAGAGGCTGAATCTGCAAGG - Intronic
922761525 1:228134963-228134985 CTTGATAGGCTGCATGTGGCTGG + Intergenic
923109495 1:230879704-230879726 CGGGGCAGGGTGATTGTGGAGGG - Intergenic
923267382 1:232327828-232327850 CTGGGCACGCTGAATGGGGTCGG - Intergenic
923518870 1:234720792-234720814 CAGGACAGGGTAACTGTGGAAGG - Intergenic
1068785639 10:60969620-60969642 CAGAACAGCCTGAATTTGGAAGG + Intronic
1070302892 10:75217662-75217684 CTGGACTGGCTGGGTGTGGTGGG - Intronic
1070694564 10:78552325-78552347 CAGGGCAGGCTGAACTTGGAGGG - Intergenic
1070893665 10:79963233-79963255 CTTGGCAGGCTGAATCTGGGAGG + Intronic
1072535752 10:96361394-96361416 CTGGCAAGGCTGTTTGTGGATGG + Intergenic
1072609151 10:97005018-97005040 CTGGCCAGGCTGGCAGTGGATGG - Intronic
1073114430 10:101083324-101083346 CTGGGCAGGCTGTGGGTGGAGGG - Intergenic
1074171840 10:110947377-110947399 CTGGACAGGCTGACTGGTAAAGG + Intronic
1075592858 10:123705029-123705051 CTGGGCAGGCGGGATGGGGAAGG + Intergenic
1076296025 10:129385515-129385537 TTGGACATGTGGAATGTGGATGG + Intergenic
1076519654 10:131073648-131073670 CTGGATGGGCAGGATGTGGATGG + Intergenic
1076730644 10:132437261-132437283 GTGCTCAGGCTGAACGTGGAGGG - Intergenic
1078090361 11:8261240-8261262 CTGGACAGGCTGGGGATGGAGGG + Intronic
1080123574 11:28704959-28704981 CTGGACATGGTGTATGAGGAAGG + Intergenic
1080286633 11:30621807-30621829 CTGCAAACGCTGAATATGGAAGG + Intergenic
1080944849 11:36959014-36959036 GTGGACAGGCTGACTGGTGAAGG + Intergenic
1082080818 11:48011253-48011275 CTGCACAGGCTTGATCTGGATGG - Intronic
1082094238 11:48114549-48114571 CTGGACAGGCTTACTGTTGAAGG + Intronic
1082109305 11:48256613-48256635 CTGGACAGGATGAATTTGAGGGG + Intergenic
1083903806 11:65657114-65657136 CAGGACAGTCTAAATGTAGAGGG + Intronic
1084117699 11:67051600-67051622 CAGCACTCGCTGAATGTGGAAGG - Intergenic
1084765043 11:71302745-71302767 CTGGAAAGGCTGAAGTGGGAGGG - Intergenic
1084910397 11:72382692-72382714 CTGGACAGGCTGAATGGTGAAGG + Intronic
1085119317 11:73957162-73957184 CTGGGCCGGCTCCATGTGGAAGG - Intronic
1085464839 11:76716445-76716467 CTCCAGAGGCTGCATGTGGATGG - Intergenic
1085471099 11:76758651-76758673 CTGCACAGGCTGAGTGTGAAGGG + Intergenic
1085883460 11:80496010-80496032 CTGGACAGGCTGACCGATGAGGG - Intergenic
1088548127 11:110982159-110982181 CTGGACAGAAAGAATGTGAAAGG + Intergenic
1089060951 11:115625748-115625770 CTGCCCAGGCTTAATGGGGAGGG + Intergenic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091449676 12:564733-564755 CTGGGCATGCTGAAGGTTGAGGG - Intronic
1094100924 12:26761273-26761295 CTGGACGGGCTGATTGGTGAAGG + Intronic
1095042417 12:37456775-37456797 CAGGACTGGCTTAATGTTGAAGG - Intergenic
1096562613 12:52447559-52447581 CTCCACAGGCTGAATGGCGAAGG - Exonic
1096564784 12:52469431-52469453 CTCCACAGGCTGAATGGCGAAGG - Exonic
1096566702 12:52488089-52488111 CTCCACAGGCTGAATGGCGAAGG - Exonic
1096849766 12:54428102-54428124 CTGGACAGGCTGGAGGAGGTTGG + Intergenic
1097429469 12:59486685-59486707 CTGGACTCACTGAATGTGGCTGG - Intergenic
1097809833 12:64006458-64006480 CTGGAGAGGCAGGCTGTGGAGGG + Intronic
1100705920 12:97199985-97200007 CTGTACAGGCTGAAAGCTGAGGG - Intergenic
1101242022 12:102848386-102848408 CTAGAAAGGCTGAGTGTAGATGG + Intronic
1101242117 12:102848910-102848932 CTGGAGAGGCTGAGTGTAGACGG + Intronic
1102216675 12:111166687-111166709 CTGCAGAGGCTAAACGTGGAAGG + Intronic
1104748437 12:131223953-131223975 CTGGGCAGGCTGGATGTGGGCGG + Intergenic
1106139778 13:27002476-27002498 CAGGAGAGGGTGAATGTGGCTGG - Intergenic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1108970361 13:56367974-56367996 CTGAAGAGGCTGACAGTGGAAGG - Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111913435 13:94337057-94337079 CTGAACAGGGTGAAAGTAGAAGG - Intronic
1112694110 13:101928124-101928146 CTGGACACTCTGCATGTGGAAGG + Intronic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1113791058 13:113028516-113028538 CTGGTCTGGCTGAAGGTGGCCGG + Intronic
1114253804 14:20984742-20984764 GAGGTAAGGCTGAATGTGGAAGG - Intergenic
1114929550 14:27450631-27450653 CTGGCCAGGCTGAATCATGAAGG - Intergenic
1117275342 14:54188051-54188073 CAGGAAAGGCTGAATTTTGAAGG + Intergenic
1120575599 14:86176709-86176731 CTGGAGAGGGTGTATGTGGGCGG + Intergenic
1120743989 14:88137472-88137494 TTGGAGAGCCTGAGTGTGGAAGG - Intergenic
1120865719 14:89293802-89293824 CTGGAGAGACTGCATGTGGAAGG - Intronic
1122871615 14:104641358-104641380 GTGGGCAGGCTGGGTGTGGAGGG - Intergenic
1123054184 14:105561523-105561545 CAGGACAGGCTGGAAGTGGAGGG - Intergenic
1123078768 14:105681942-105681964 CAGGACCGGCTGGAAGTGGAGGG - Intergenic
1123141799 14:106087197-106087219 CTGAACAGGCTGAAGATGGCCGG + Intergenic
1123961106 15:25402199-25402221 CTGGACAGGCTGACTGGTGAAGG - Intronic
1124633078 15:31348205-31348227 CTTGTCAGGATGACTGTGGAAGG + Intronic
1124723538 15:32134108-32134130 TGGGACAGGATGGATGTGGAGGG - Intronic
1125728788 15:41881623-41881645 CTGGCCTGGGTGAAAGTGGAGGG + Intronic
1126142537 15:45449959-45449981 CTGGCCAGGCAGACTGTGGCTGG + Intergenic
1126530866 15:49710373-49710395 CTGGACAAGCTGACTGGTGAAGG - Intergenic
1128775075 15:70314016-70314038 CTGGTAAGGCTGATAGTGGAAGG - Intergenic
1129681462 15:77660722-77660744 GTGGACAGGCAGAGAGTGGAGGG + Intronic
1130069337 15:80633417-80633439 ATGGACAGGTTGACTGTGGCTGG - Intergenic
1130415771 15:83693387-83693409 CTGGCCAGGCTGGAGCTGGAGGG + Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131296540 15:91154427-91154449 TTAGACAGGCAGATTGTGGAAGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132853996 16:2036728-2036750 GTGAACGGGCAGAATGTGGAGGG + Exonic
1134538744 16:15047441-15047463 CTGACCACGCTCAATGTGGAAGG - Exonic
1134843031 16:17416538-17416560 CTGCACAGGCTGATTGTGATAGG - Intronic
1136061342 16:27728725-27728747 CTTTAAAGGCTGAATGTGGCTGG - Intronic
1137400975 16:48154224-48154246 CTGGACAGGCAGAAGCAGGAAGG + Intronic
1139112044 16:63904165-63904187 CTAGATAGGCTGAATGATGATGG - Intergenic
1141453767 16:84124620-84124642 CTGCACAGCCTGAGTCTGGATGG - Exonic
1141626034 16:85261562-85261584 CAGGACAGGCTCAGAGTGGAGGG + Intergenic
1142113298 16:88343426-88343448 ATGGGCAGGCTGCATGTGGGCGG - Intergenic
1142809525 17:2388763-2388785 CGGGAAAGACTGAGTGTGGAGGG - Intronic
1143591008 17:7885680-7885702 TTGGACAGGCAGAGTGGGGACGG + Intronic
1144206695 17:12984611-12984633 GGGGACAGGCTGACTGGGGACGG - Exonic
1147647574 17:42043059-42043081 AGGGCCAGGCTGAAGGTGGAGGG - Intronic
1147724881 17:42560892-42560914 CTTGAAAGGCTGAGTGTGGAGGG - Intergenic
1148954980 17:51346077-51346099 CTGTAAGGACTGAATGTGGAAGG + Intergenic
1149426983 17:56564761-56564783 CTGCACAGGCTGAGTAGGGAGGG - Intergenic
1150290344 17:63977769-63977791 TTGGACAGGCTTGGTGTGGAAGG - Intergenic
1151446715 17:74170969-74170991 CTGGGAAGGAGGAATGTGGATGG + Intergenic
1152430302 17:80245161-80245183 CAAGACAGGCTGATCGTGGAGGG - Intronic
1153970125 18:10218554-10218576 CCTGACAGGCTGAAAGAGGAGGG + Intergenic
1157196901 18:45626830-45626852 CTGGCCTGGCTGAATGGGAAGGG + Intronic
1158355722 18:56616836-56616858 CTTGACTGACTGAATCTGGAAGG + Intronic
1158626788 18:59078510-59078532 CAGGACAGGCTGAAACTGGAGGG + Intergenic
1159002714 18:62988035-62988057 CTGGACAGCCTGGACGTGGGCGG - Intergenic
1159439036 18:68454525-68454547 CTGGCCAGGCTGATTGATGAGGG - Intergenic
1160322053 18:77905505-77905527 ATGGACAGGTGGAAGGTGGAAGG + Intergenic
1161015611 19:1981401-1981423 CCGGACAGGCAGGATGGGGATGG - Intergenic
1161124085 19:2546299-2546321 CTGGAGAGGCTGCAGGTGCAGGG - Intronic
1161421641 19:4179131-4179153 CTGGTCAGCCAGAACGTGGACGG - Exonic
1162042842 19:7980783-7980805 CTGGGCAGGCTGGGGGTGGATGG + Intronic
1162264061 19:9555816-9555838 CTGGACAGGATGTATGTTGCTGG + Intergenic
1162389427 19:10380415-10380437 CTTGACAGGCTGCACTTGGATGG - Exonic
1162706582 19:12559595-12559617 CTGGACAAGCTGGACGTGAAAGG + Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1163764602 19:19155804-19155826 CAGCACAGGCTGAATGTGCCAGG + Intronic
1165798930 19:38536043-38536065 CTGGGCATGGTGAATGAGGATGG + Exonic
1165993866 19:39831383-39831405 CTGGATTGGGTGAATTTGGAGGG - Intronic
1166066967 19:40365843-40365865 CTGGACAGGCTGAACGAGGGTGG - Exonic
1166329948 19:42072040-42072062 CGGGACAGGTTGAATTTAGAGGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166903920 19:46090515-46090537 CTAGACAGGCTTATTGTTGAAGG - Intergenic
925488748 2:4368731-4368753 CTGGGCAGGCTGACTGGAGAAGG - Intergenic
926066736 2:9846375-9846397 CTGGACAGGCTAAATGTGCCAGG + Intronic
926245990 2:11122820-11122842 CTGGACAGGGTGCCTGTGGCTGG - Intergenic
926862838 2:17327012-17327034 GTAGTGAGGCTGAATGTGGAGGG - Intergenic
926891489 2:17643041-17643063 CTGGAGAGCCTACATGTGGAAGG + Intronic
927674368 2:25093746-25093768 CAGGACAGGTTGGATGAGGATGG - Intronic
927855824 2:26527471-26527493 CTGGAGAGGCGAAAGGTGGAGGG - Intronic
929388730 2:41442904-41442926 CTGGAGGGGCTGGAGGTGGAGGG - Intergenic
930628723 2:53728209-53728231 CTGGCAATGCTGAATGTGGAAGG + Intronic
932422996 2:71612396-71612418 CTGAACAGGATGCATTTGGAAGG + Intronic
933977054 2:87520133-87520155 TTGGACAGGTTGCATGTGGAAGG + Intergenic
934173977 2:89563159-89563181 CTGGACAAGCAGATTGTGAAGGG + Intergenic
934284292 2:91637508-91637530 CTGGACAAGCAGATTGTGAAGGG + Intergenic
936316763 2:111430672-111430694 TTGGACAGGTTGCATGTGGAAGG - Intergenic
937882319 2:126877790-126877812 CTGGAAAGACTGAATGGGCAGGG - Intergenic
939465384 2:142547698-142547720 CTGGGCAGGCTGAGTGTTGTGGG + Intergenic
939857853 2:147382047-147382069 TTGGGGAGGCTGTATGTGGAGGG + Intergenic
940980058 2:159991406-159991428 TGGGACAGGCTGAAAGTGCAGGG + Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
943779509 2:191806499-191806521 CTGGACAGAATGACTGTGGTGGG + Intergenic
946332873 2:219020151-219020173 CTGGGGAGGGTGAATGGGGAGGG - Intronic
946338770 2:219055537-219055559 CTGGCCAGGCTGCACGTGGCTGG + Exonic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948678119 2:239611018-239611040 CTTGACTGGCTGGATATGGAGGG + Intergenic
1169215813 20:3794420-3794442 CTGCACAGGGTGTATGTGGCAGG - Intronic
1169309956 20:4527623-4527645 CTGGACAGGCTTACTGGTGAAGG + Intergenic
1171059341 20:21940938-21940960 CTGGGCAGGTTGTATGTGCAAGG - Intergenic
1171240273 20:23562424-23562446 CTGGACAGGATGATTGGTGAAGG - Intergenic
1171300193 20:24053095-24053117 CAGGACAGGCAGACTGGGGAGGG - Intergenic
1172025009 20:31942645-31942667 CTCCAGATGCTGAATGTGGATGG - Intronic
1172034637 20:32002303-32002325 CTGGCCAGGCTGAATGGGTGGGG + Exonic
1173708557 20:45135196-45135218 CTGGACAGATTGACTGGGGAAGG - Intergenic
1173804846 20:45917797-45917819 AGGGACAGGCTGAGTGGGGAAGG - Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175934837 20:62509827-62509849 GTGGACAGGTGGATTGTGGAGGG - Intergenic
1175939942 20:62533291-62533313 CTGGACAGGCTGGACGTGGAGGG - Intergenic
1176179888 20:63744840-63744862 CAGGACATCCTGAGTGTGGAGGG + Exonic
1179253529 21:39695350-39695372 CTGGACTGGCTGAAGGTAAAGGG + Intergenic
1179712021 21:43268925-43268947 CTGGGCAGGATGGATGTGGGTGG - Intergenic
1180086148 21:45508841-45508863 GTGGACAGGGTGCAGGTGGATGG + Intronic
1180982624 22:19886035-19886057 CTGGACAGGCTGGATGGCCAGGG + Intronic
1181262957 22:21611870-21611892 CTTGAGAGGCTGCAAGTGGAGGG + Intronic
1182059623 22:27387761-27387783 CTGTACAGGCTCACCGTGGAAGG - Intergenic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1182748734 22:32625187-32625209 GCCCACAGGCTGAATGTGGACGG + Intronic
1182960202 22:34465021-34465043 CAGGCCAGGCTGAAGGTGGCAGG + Intergenic
1184892599 22:47389016-47389038 CTGGGAAGGCTGGGTGTGGATGG + Intergenic
1185005645 22:48275220-48275242 CTGGACAGGATGATTGCAGAGGG - Intergenic
949396742 3:3622569-3622591 CTGTGAAGGCTGAATGGGGAAGG - Intergenic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
953375815 3:42427868-42427890 CTAGGCTGGCTGAATCTGGAGGG - Intergenic
953865876 3:46582951-46582973 GTAGACAGGCTGAATTTGGAAGG + Intronic
954585285 3:51730035-51730057 CTGGACAGGCTAACTGGTGAAGG - Intergenic
955917903 3:63925038-63925060 ATGGACAGGCTGGTTTTGGATGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956595752 3:70965282-70965304 CTGCCCATGCTGAATGTGAATGG - Intronic
956980801 3:74634976-74634998 CTGGAGAGGCTGAAACTGGGAGG - Intergenic
957754673 3:84470056-84470078 TTGGACAAGATGTATGTGGATGG + Intergenic
958907926 3:99962144-99962166 CTGGAAAGGCTGAAGGTGAGGGG + Intronic
959073658 3:101727506-101727528 CTGGAATGGCTGAATTTGGCAGG + Exonic
962852482 3:139318413-139318435 CTGGAAGGGCTGGATGGGGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963770996 3:149386049-149386071 CTGATCAGACTGATTGTGGACGG - Intergenic
964072594 3:152652978-152653000 CTGGACAGTTTGCACGTGGATGG + Intergenic
967751196 3:193118261-193118283 CTGGAGAGGCTATGTGTGGAAGG + Intergenic
967889997 3:194358140-194358162 TTGCACAGGCTGACTGTGGGGGG + Exonic
969660867 4:8526663-8526685 CAGGAAAAGCTGAATGTGGGAGG + Intergenic
969827823 4:9771975-9771997 CTGGACAAGCAGATTGTGAAGGG + Intronic
970552154 4:17193117-17193139 CAGGATAGGCTGATTGTGGCTGG - Intergenic
973074716 4:45908622-45908644 CTGGAAAGGGTAAATGGGGATGG + Intergenic
976436543 4:85024949-85024971 TTGGCCAGGCTGGATGCGGATGG - Intergenic
976569300 4:86590495-86590517 CTGGATAGGCTGGGTGTGGTGGG + Intronic
978293445 4:107174445-107174467 CTGGACAAGCTTGATGTAGAAGG - Intronic
980702629 4:136452995-136453017 CTGGACTGTCTGACTGTTGAAGG + Intergenic
981178814 4:141714974-141714996 CTGGACATGCTGAGTTTGAAAGG - Intronic
981260551 4:142713635-142713657 CTGGAAAGGTTGATTTTGGAAGG - Intronic
981783028 4:148446215-148446237 CAGGACAGTGGGAATGTGGAAGG - Intergenic
982108505 4:152032091-152032113 CTAGACTGGCCTAATGTGGAAGG - Intergenic
982575980 4:157110774-157110796 CTGGCCAGGTTGAATGGTGAAGG - Intronic
983313750 4:166099355-166099377 CAGGACAGGTTGACTGTGAATGG + Exonic
984093525 4:175405984-175406006 TTTGGCAGGCTAAATGTGGATGG + Intergenic
984208006 4:176809907-176809929 CTGGAAAGGAGGAAAGTGGATGG - Intergenic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985685929 5:1281456-1281478 CCGCCCAGGCTGACTGTGGAGGG - Intronic
985913510 5:2900766-2900788 CTGGAGAGGATGAAGGTGGAGGG - Intergenic
986109811 5:4702620-4702642 CTGGAAAAGATGAATGTAGATGG - Intergenic
986464432 5:8007705-8007727 CTGGACAAGCTGACTGGTGAAGG - Intergenic
986788759 5:11140250-11140272 CTGGACAGGTTGAAGGAGGCAGG - Intronic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
988959262 5:36353255-36353277 CAGGACAGGCGGCAAGTGGAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990689183 5:58343601-58343623 ATGCACAGGCTGACTGTGGCTGG - Intergenic
993251561 5:85531322-85531344 CTGGAGAGGCTGAGTGGGGGAGG - Intergenic
993877094 5:93320125-93320147 CTGTAGTAGCTGAATGTGGAAGG + Intergenic
995484855 5:112629796-112629818 CTGGATAGGCATTATGTGGATGG - Intergenic
996031688 5:118712114-118712136 CTGGATAGGCTCACTGTTGAAGG + Intergenic
996121424 5:119677926-119677948 CGTTACAGGATGAATGTGGATGG - Intergenic
997235243 5:132268690-132268712 GAGGACAGGCTGAGTGTGCAAGG - Intronic
997540549 5:134658157-134658179 CTCGAGAGGCTGAATGAGGCAGG + Intronic
998927288 5:147140676-147140698 TTGAACAGGCTGAAGGTGGCTGG + Intergenic
998954604 5:147426317-147426339 CTGAAAAAGCTCAATGTGGAAGG + Intronic
999328519 5:150657834-150657856 CTGGACAGTCTGAACTGGGATGG - Intronic
1000416057 5:160984884-160984906 CTGGGCAGGCTCCTTGTGGAAGG - Intergenic
1000443939 5:161297145-161297167 CTTGACAGGCTGAAGTGGGAGGG + Intronic
1000571725 5:162923549-162923571 CTGGCCAGGCTGATAGGGGAGGG - Intergenic
1000662272 5:163951230-163951252 CTGGACAGACTCCATGGGGAGGG - Intergenic
1001130224 5:169057635-169057657 CGGCACTGGCCGAATGTGGAAGG + Intronic
1001516198 5:172356775-172356797 CTGGATAGGCAGCATGTGGGAGG + Intronic
1002113327 5:176936659-176936681 GTGAACAGGTTGAATGTGGCTGG - Intronic
1002958234 6:1889460-1889482 CTGTCCAGGGAGAATGTGGAGGG - Intronic
1003291953 6:4787585-4787607 CTGGGCAAGCTGAATGTGTCTGG - Intronic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1003852398 6:10238681-10238703 CTGGATTGGCTGAGAGTGGAGGG - Intergenic
1006723984 6:36182516-36182538 CTGGACAAGCTGACTGGTGAAGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007909681 6:45501048-45501070 CTGGAGAGGTTGAAGGTAGATGG + Intronic
1012412841 6:98979299-98979321 CAGGACAGGCAGCATCTGGAAGG - Intergenic
1013070882 6:106728335-106728357 CTCAAAAGGCTGAATGTGGAGGG - Intergenic
1013150279 6:107439123-107439145 CTGTACAGGAAGAAAGTGGAGGG - Intronic
1013351969 6:109313987-109314009 TTGCACAGGCTGCATGTGAAAGG + Intergenic
1015139315 6:129911788-129911810 CAGGCCAGGCTGAATTTTGAGGG + Intergenic
1016983937 6:149880094-149880116 ATGGACAAGCTTATTGTGGATGG + Intergenic
1018488210 6:164264075-164264097 GTGGACAGGGTAAATGTGTAAGG - Intergenic
1018671051 6:166177755-166177777 CTGGACAGGTTGGATGTGGAGGG + Intergenic
1019670293 7:2274346-2274368 CAGGACACGGTGACTGTGGAAGG + Intronic
1020332606 7:7035527-7035549 TTGGACAGGCTGACTGGTGAAGG + Intergenic
1021470012 7:20991216-20991238 CTGAACAGACTCAGTGTGGAAGG - Intergenic
1024500393 7:50099550-50099572 CTGGCCAGGCTGAAGGGTGAAGG - Intronic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1028288837 7:89040773-89040795 CTGGAAAGGCTGACTGATGAAGG - Intronic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029662129 7:101969550-101969572 CTGGAAAGGCTGAAAGTGCAGGG - Intronic
1032190137 7:129760329-129760351 CTGGAATGGATGAAAGTGGAGGG + Intergenic
1032844673 7:135742210-135742232 CTGGAGAGGCTGGAGGTGGTGGG + Intronic
1034268265 7:149791482-149791504 ATGGGCAGCCTGACTGTGGAAGG + Intergenic
1034437133 7:151068067-151068089 CTGGCCAGGCGGGAGGTGGAGGG - Intronic
1035663808 8:1365521-1365543 CAGGTCCGGCAGAATGTGGATGG + Intergenic
1036124263 8:6048659-6048681 GTGGAGAGGCTGAATGCAGAGGG + Intergenic
1037368761 8:18150493-18150515 CTAGACAGGCTGATTGTTAAAGG + Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1038155463 8:24985224-24985246 GTGGACAGGCTGGATTGGGATGG + Intergenic
1038977792 8:32720347-32720369 CTCACCAGGCTAAATGTGGAAGG - Intronic
1039403587 8:37293974-37293996 CTGGAAATGCTGTGTGTGGAGGG - Intergenic
1039613340 8:38936499-38936521 CTGGACAGGATTACTGTGGAGGG + Intronic
1041947252 8:63460023-63460045 CTGGACAGGTTTACTGTTGAAGG - Intergenic
1043799498 8:84589333-84589355 CTGGACAGGCTGAATCTAACAGG - Intronic
1045171535 8:99676100-99676122 CTAGACAGGCTTACTGTTGAAGG - Intronic
1046407125 8:113789134-113789156 CTGGACATGCAGTATGTGCATGG + Intergenic
1047754033 8:127904917-127904939 CTGCACAGGCTGTATGTCCAAGG + Intergenic
1052234177 9:26189456-26189478 CTGGATGAGCTGAATGTTGAAGG + Intergenic
1052471442 9:28900657-28900679 CTGGACAAGCTGAATGATAAAGG + Intergenic
1052692491 9:31833313-31833335 CTGGGCAGGCTGACTAAGGAAGG - Intergenic
1053273896 9:36769108-36769130 GTAGACAGGCTGAGTGTGGGAGG + Intergenic
1055509764 9:76984601-76984623 CTGGGCAGTCTGGATGAGGAGGG - Intergenic
1058319748 9:103614620-103614642 CTGGACAGCCTGATTGGTGAAGG - Intergenic
1058459637 9:105170982-105171004 CTGGACATGCTCAGTGTGAAGGG + Intergenic
1060799229 9:126533085-126533107 CTGTAAATGCTGAGTGTGGACGG - Intergenic
1060898845 9:127239375-127239397 CTGGCCAGGCTTGATTTGGAGGG - Intronic
1061925552 9:133804489-133804511 CCGGGCAGCCTGACTGTGGAGGG + Intronic
1186500401 X:10046084-10046106 CTGGAGAGGCTCAGTGTGGATGG + Intronic
1186641196 X:11457695-11457717 CTGGTCAGGCTGGAAGTGCAGGG + Intronic
1187950585 X:24466209-24466231 CCGGACAGGGAGAATGTGGGTGG - Intronic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1189078278 X:37941252-37941274 CTGCACAAGCTGGATGTGGTGGG - Intronic
1189831205 X:44975436-44975458 CTGCATAGGCTGACTGTTGAAGG - Intronic
1190717138 X:53114450-53114472 CTGGACAGGCTGACTGGTGAGGG - Intergenic
1191113140 X:56823052-56823074 CTGGATAGGCTGACTGCTGAAGG + Intergenic
1192314891 X:70043818-70043840 CTCAAGAGGCTCAATGTGGATGG + Intronic
1193266241 X:79472876-79472898 CTGGACAGGCTTACTGCTGAAGG + Intergenic
1195773367 X:108376306-108376328 CAAGACACGCTGAATGTGGCAGG + Intronic
1195828538 X:109029629-109029651 CTAGACAAGCTGACTGTTGAGGG + Intergenic
1197239992 X:124113894-124113916 CTGGACAGGCTGAATGTGGAAGG - Intronic
1198491565 X:137146667-137146689 CTTGTCAGGCTGAATGACGAGGG - Intergenic
1198617705 X:138477761-138477783 CTGAACAGCCTGATTTTGGAAGG - Intergenic
1199982199 X:152927367-152927389 CTGGCCAGGGTGGAAGTGGAGGG + Intronic
1199997794 X:153037378-153037400 CTGGACTGGCTGATGGTGAAGGG - Intergenic
1201511069 Y:14763785-14763807 CTGGACAGGATGGATTGGGAGGG - Intronic