ID: 1197243087

View in Genome Browser
Species Human (GRCh38)
Location X:124140575-124140597
Sequence ATGCACTTTTAGAAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 1, 2: 12, 3: 50, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197243086_1197243087 2 Left 1197243086 X:124140550-124140572 CCATGGAGAAAGTTGCTAACAAA 0: 1
1: 0
2: 0
3: 21
4: 242
Right 1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG 0: 1
1: 1
2: 12
3: 50
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197243087 Original CRISPR ATGCACTTTTAGAAAAGTGA AGG Intronic
900864103 1:5255073-5255095 ATACATTTTTAGAAAAGTCCTGG - Intergenic
903281807 1:22254535-22254557 AGCCACTTTTAGAAAAGTAGGGG + Intergenic
903776940 1:25799707-25799729 AGGAACTTTTAGAAAACTGGTGG + Intergenic
905679574 1:39858945-39858967 ATGCACATTAAGAAAACTAAAGG + Intronic
906965031 1:50447986-50448008 TTGCATTTTTAGAAGTGTGAGGG + Intronic
907001974 1:50870152-50870174 TTGCATTTTTAAAAAATTGAAGG + Intronic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907531104 1:55098192-55098214 ATGGACTTTTAAAATATTGAGGG - Intronic
907651194 1:56296318-56296340 AAGCAGTTTCAGAAAAGTGGTGG + Intergenic
908232216 1:62116935-62116957 ATGCATTTAAAGAACAGTGATGG - Intronic
908554665 1:65245772-65245794 ATGCACTTTTTGCAAAATGAGGG + Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910809643 1:91223092-91223114 ATCCCCTTTTAGAAGAGTGAAGG - Intergenic
910949813 1:92634104-92634126 ATGAAGTTTTAGAAATGTTAAGG - Intronic
913235423 1:116776895-116776917 TTGCATTTTTAGAAGAGAGACGG - Intergenic
916336126 1:163672946-163672968 AGGCACTTTGAGAGATGTGAAGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
917474819 1:175360140-175360162 TTGCACTTTTATAAATGTAAGGG + Intronic
918065352 1:181096992-181097014 ATGCAGTTTAAGAAAAGCCAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918674544 1:187266403-187266425 ATGTAGTTTTAGAGAAGTGGGGG + Intergenic
919956595 1:202423433-202423455 ATGAACTTTTAGAACAGTCAGGG + Intronic
921385618 1:214566418-214566440 ATGCTATTTTAGAGAAATGATGG - Intergenic
921393063 1:214636687-214636709 CTGCACTGTTAGAAAACAGATGG - Intronic
921570593 1:216773797-216773819 ATGCACTTTTAGAAATGAGAAGG + Intronic
921886792 1:220315135-220315157 ATGCACCTGAAGAAAACTGAGGG - Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922407957 1:225338386-225338408 ATGCACAGTTTGAAAAGTGTTGG - Intronic
922593100 1:226793418-226793440 ACCCACTGTCAGAAAAGTGAAGG - Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
924391246 1:243561529-243561551 ATGCAATTTTTTAAAGGTGAGGG - Intronic
924498190 1:244610711-244610733 ATGCGCTTTCATGAAAGTGATGG - Intronic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063579931 10:7297105-7297127 CTGAACCTTTAGAAAAGTAACGG - Intronic
1063673914 10:8122582-8122604 ATAGAATTGTAGAAAAGTGATGG + Intergenic
1068566040 10:58576656-58576678 ATACATTGTTACAAAAGTGAGGG + Intronic
1069634959 10:69919453-69919475 ATGCACATTTAGCAAATTAAAGG - Intronic
1069663734 10:70140928-70140950 CTGCACTTTTAAAAATGTCAAGG - Intronic
1071741705 10:88366007-88366029 ATGCACTTTTCTAGACGTGAAGG + Intronic
1071907873 10:90194861-90194883 ATTAACTTGTAGAAAATTGATGG + Intergenic
1072447074 10:95508450-95508472 ATGCATTTTGAAAAAAGTAATGG - Intronic
1072748290 10:97957668-97957690 ATCCACTTTCAGAAGACTGAAGG - Intronic
1072912708 10:99518277-99518299 ATGCATTTTTAACAAATTGAAGG - Intergenic
1074156637 10:110805739-110805761 ATGCAGTCCTAGAAAAGTGCTGG - Intronic
1074720371 10:116259091-116259113 ATGCGCTTTAAGAAAACTGCTGG + Intronic
1076033663 10:127180595-127180617 CTGCATTTTTAGATTAGTGACGG + Intronic
1076109472 10:127849747-127849769 ATGCACATTTAACAAAATGAAGG + Intergenic
1076479031 10:130772296-130772318 AAGCAGTTTTAGCAAAGTGCTGG + Intergenic
1077632575 11:3821008-3821030 ATGCACTCTGAGTAATGTGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080014352 11:27489233-27489255 TTGCACTTTTAGAACAGGAATGG + Intergenic
1080057910 11:27926551-27926573 CTGGGCTTTTTGAAAAGTGAGGG - Intergenic
1080599495 11:33808519-33808541 ATGAGCTTTTAGAAAACTGCAGG + Intergenic
1081370643 11:42297508-42297530 TTCTACTTTTAGAAAACTGAAGG - Intergenic
1081948398 11:47019844-47019866 TTGCATTTTTTGAAAATTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085824984 11:79836797-79836819 ATACATTCTTAGAAAATTGAAGG + Intergenic
1086423679 11:86662981-86663003 TTGCTCTTTCAGAAAACTGAAGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088079201 11:105890192-105890214 ATGCATTTTTGTAAAAGTCAAGG + Intronic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088157558 11:106827037-106827059 ATGGTCTCTTGGAAAAGTGAAGG + Intronic
1088491244 11:110389945-110389967 AAGAAATTTAAGAAAAGTGAAGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090536223 11:127644772-127644794 AGGTACTTGTAGAAAACTGAGGG + Intergenic
1091029997 11:132177516-132177538 CTTCATTTTTAGCAAAGTGAAGG - Intronic
1092609735 12:10159529-10159551 ATGCAATTTTAGGAGTGTGAGGG + Exonic
1093635444 12:21461110-21461132 ATGGTCTCTTGGAAAAGTGAAGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097285534 12:57874202-57874224 ATTCAGTTTTAGTAAAATGAGGG - Intergenic
1097481259 12:60128618-60128640 ATACACGTTTACAAAAGTAATGG + Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098791025 12:74822136-74822158 ATTTTCTTTTAAAAAAGTGATGG + Intergenic
1099074227 12:78084713-78084735 AAACAGTTTTAGAAGAGTGATGG - Intronic
1099485499 12:83224597-83224619 ATGAACTTTTTAAAAAGGGAAGG - Intergenic
1100898069 12:99206991-99207013 ATGGACTCTTAGAAGAATGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102168651 12:110825429-110825451 ATGGAAGTTTAGAAAAATGAAGG - Intergenic
1104874490 12:132024562-132024584 CTGCTCTTTAAAAAAAGTGAGGG + Intronic
1106601075 13:31187492-31187514 ATGCACCTTGGGACAAGTGAGGG + Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107357943 13:39587971-39587993 AGGCACTTTTAGAAGACAGAAGG - Intronic
1108319392 13:49273249-49273271 ATTCACTTTTAGGAAATTGTAGG + Intronic
1108614251 13:52115867-52115889 ATGCACTTTTAAAAAATCAAGGG + Intronic
1109756480 13:66767564-66767586 ATGTACTTTTAGAAGTTTGAAGG - Intronic
1109833793 13:67828520-67828542 ATGCATTTTTACAAAATTGAAGG + Intergenic
1110356267 13:74571470-74571492 ATGCCCTGGTAGTAAAGTGACGG + Intergenic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1111217346 13:85161584-85161606 ATGGACTTTCAGCAGAGTGATGG + Intergenic
1111291318 13:86174198-86174220 ATGCAATTTTATAAAATTGTAGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111716151 13:91881549-91881571 ATGCACATTCAGAAAAAAGAAGG - Intronic
1111927451 13:94478575-94478597 TTGCACTTGTTGAAAAGGGATGG - Intronic
1113014679 13:105815141-105815163 AAGCAAGTTTAGAAAAGTTAAGG - Intergenic
1113303085 13:109044595-109044617 ATTCACTTCTAGAAAATTAATGG - Intronic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114039929 14:18668380-18668402 AGACACTTTTGGAGAAGTGATGG - Intergenic
1114044971 14:18866927-18866949 AGACACTTTTGGAGAAGTGATGG - Intergenic
1114119251 14:19652595-19652617 AGACACTTTTGGAGAAGTGATGG + Intergenic
1114208559 14:20596653-20596675 CTGCACTATTAAAAAAGTAATGG - Intronic
1114508911 14:23240064-23240086 ACACACATTTAGAAAAGTAATGG - Intronic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114937029 14:27551257-27551279 ATGCACTTTGAGGAAAATGAAGG + Intergenic
1114973622 14:28066263-28066285 ATACACATTTGGAAAAGAGAGGG - Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1115614519 14:35081463-35081485 ATGATCTTTTAAAAAAGTTAAGG + Exonic
1115781295 14:36771777-36771799 ATGCCCTTTTAATAAAATGATGG - Intronic
1115839740 14:37455811-37455833 ATGCACTTTCAGAAATTTGGTGG + Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1116725624 14:48558391-48558413 ATACCCTTATAGAAGAGTGAAGG + Intergenic
1120232149 14:81851488-81851510 ATGCCCCTTTAGAATAGTGAAGG + Intergenic
1120672090 14:87374291-87374313 ATGCAGTTTTAGAAATGAGCTGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1122403832 14:101485317-101485339 AAGCAATTTAAAAAAAGTGAGGG - Intergenic
1124858414 15:33413158-33413180 ATGCCGTTTGAGAAAAGGGAGGG + Intronic
1125349870 15:38755404-38755426 ATGAACTGTTAGAAAAATGGGGG + Intergenic
1126391674 15:48162595-48162617 TTGCACTTTTTGCAAATTGAAGG + Intronic
1127290461 15:57565820-57565842 ATGTACTTTTAGTATACTGAGGG + Intergenic
1128017839 15:64363260-64363282 TTGCACTTTTAGTAGAGTCAGGG + Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1129261375 15:74369727-74369749 AAGCTCTTTCAGAGAAGTGAGGG - Intergenic
1132161369 15:99546083-99546105 ATAAACTTTTAAAAAAATGATGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140677544 16:77348046-77348068 ATGAACTCTTAGAAAATTGAGGG - Intronic
1140696510 16:77539495-77539517 ATGCACTTTGGGAAAATGGATGG - Intergenic
1141546690 16:84775111-84775133 AAGCACTTTTAGAAAGGTTCAGG - Intronic
1143040752 17:4034533-4034555 ATGGACATTTTGAAAGGTGAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146075519 17:29725039-29725061 ATGAACTTTTATAAAAGCCAGGG + Intronic
1146662108 17:34671711-34671733 ATGCAGTCATAGAAAAGAGAAGG + Intergenic
1147112804 17:38276276-38276298 TTGCTCATTTAGTAAAGTGAGGG - Intergenic
1148416815 17:47512967-47512989 TTGCTCATTTAGTAAAGTGAGGG + Intergenic
1150163331 17:62917596-62917618 TTCCACTTTTAAAAAAGTTATGG + Intergenic
1150772124 17:68051113-68051135 AAGCACATTTACAAAAGTGTAGG - Intergenic
1152480197 17:80545729-80545751 AGGCACTGTGAGAAAATTGAAGG + Exonic
1153881650 18:9426461-9426483 TTGTACTTTTAGAAGAGTCAGGG - Intergenic
1154226176 18:12506476-12506498 ATACACCTTGCGAAAAGTGATGG - Exonic
1154352150 18:13593138-13593160 ATGTACTTTTAGTAGAGTCAGGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1154931518 18:21001879-21001901 ATGCAATCTTAGAAAACTGATGG + Intronic
1155426688 18:25714613-25714635 TTGTACTTTTAGTAAAGAGAGGG - Intergenic
1155803424 18:30137294-30137316 ATGCCCTTTTAAAAGAATGAAGG + Intergenic
1155914981 18:31548176-31548198 ATTAACTTGTAGAAAAGGGAAGG - Exonic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1157395722 18:47339310-47339332 ATGCACCTTTTTAATAGTGATGG - Intergenic
1159075388 18:63675324-63675346 ATGCAATTTGACAAAAGTCAAGG - Intronic
1159538831 18:69749306-69749328 ATGAACATTTAAAAAAATGAAGG + Intronic
1159680837 18:71350101-71350123 ATGCACATTTAGAAATGTTTTGG - Intergenic
1159817187 18:73089841-73089863 ATGGATTCTTTGAAAAGTGAGGG + Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1164212606 19:23112892-23112914 ATGCCCATTTAGAAAAGTAATGG - Intronic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1164508642 19:28879523-28879545 ATCCAGTTTGAGAAAAGAGAAGG - Intergenic
1168518388 19:57028008-57028030 ATGCACATTCTGCAAAGTGATGG - Intergenic
925951497 2:8916857-8916879 ATGCACTTATTGAAAAGTTAGGG + Intronic
926003193 2:9350958-9350980 ATGCAGTGTTTGAAATGTGAAGG - Intronic
926443309 2:12913027-12913049 ATAAACTTTTTGGAAAGTGATGG - Intergenic
927873791 2:26640893-26640915 ATGCAGATTTAGCAAAGAGAGGG + Intronic
928065963 2:28164819-28164841 ATTTACTTTAAGAAAAGTTATGG - Intronic
928274752 2:29890372-29890394 ACTCACTTTTAGAAAACTCAGGG - Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929224155 2:39495764-39495786 ACTCACTTGTAGAAAAGTGCTGG + Intergenic
930605103 2:53485407-53485429 ATGCACTTTGGGAAAAGGGAGGG + Intergenic
931100986 2:59000856-59000878 ATGCACTATTTGATAAGTGATGG - Intergenic
931466013 2:62487533-62487555 AAGGGCTTTTAAAAAAGTGAGGG - Intergenic
932252820 2:70258998-70259020 ACGCATTTTTAATAAAGTGACGG - Intronic
932531311 2:72536491-72536513 TTACAATTTTAAAAAAGTGATGG - Intronic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933453669 2:82493408-82493430 CTGTACTTTTAGAAAAGCTAAGG - Intergenic
933884817 2:86708762-86708784 ATGGATTTTTAGAAACGTGCTGG + Intronic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
938270620 2:129967214-129967236 AGACACTTTTGGAGAAGTGATGG + Intergenic
939262264 2:139825567-139825589 AATCACTTTCAGAAAAGTGAAGG + Intergenic
939722157 2:145667378-145667400 ATGCCCTTTGAAAAAGGTGATGG - Intergenic
940297692 2:152145357-152145379 CTTCACTTTTAGACCAGTGATGG - Intronic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
942124936 2:172814454-172814476 ATGCAGTTTCAGAAAAGAAAGGG + Intronic
942451532 2:176111289-176111311 ATGCAGTTTTAAAAAATAGATGG - Intronic
942692660 2:178603065-178603087 AAGCACTTTCAGAAAGGTAAAGG - Intronic
943423146 2:187695611-187695633 ATTCATTTTTTGAAAAGTTAAGG + Intergenic
943745922 2:191462858-191462880 CTGCACTTTTGGCAAAGTGCAGG - Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
944605168 2:201346197-201346219 ATGCAAATTAAGTAAAGTGAGGG - Intronic
944957765 2:204832397-204832419 ATTGACATATAGAAAAGTGAAGG + Intronic
946101372 2:217327536-217327558 ATGCAGCCTTAGGAAAGTGATGG + Intronic
946296317 2:218786393-218786415 ATGCAGTTTTTGACAACTGAGGG - Intronic
947087301 2:226467644-226467666 AAGCACTGCTAGAAAAGGGATGG - Intergenic
947280535 2:228447894-228447916 GAGCACTTTTAGAAAACTGTTGG + Intergenic
948187449 2:236032581-236032603 AAGCATTATTAGAAAAGAGAGGG + Intronic
1169698418 20:8418246-8418268 ATTCACTCTTACAAAACTGAGGG - Intronic
1170199922 20:13731751-13731773 ATGCACAATTAGAAAGGTGAGGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1172794600 20:37528041-37528063 ATGCACTTTTACAAAACTCTGGG + Intergenic
1173410580 20:42806104-42806126 ATGCACTTTAGGAAATGAGAGGG - Intronic
1174091154 20:48048884-48048906 ATGCAATTTTTGAAAAAGGAAGG - Intergenic
1175657348 20:60782573-60782595 TTGAACTTCTAGAGAAGTGATGG + Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1177492558 21:21846339-21846361 ATGCAATTTTAAAAAATTCAAGG - Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1177731787 21:25036589-25036611 ATAGATTTTTAGAACAGTGAAGG - Intergenic
1178118485 21:29442696-29442718 AAGCACTTTTAGAAAACTAAAGG - Intronic
1178250124 21:30995898-30995920 ATGCACTTAGAGAAATGTAAAGG + Intergenic
1179127328 21:38601844-38601866 ATGCTCCTTTAAAAAAGTGCTGG - Intronic
1180463494 22:15589487-15589509 AGACACTTTTGGAGAAGTGATGG - Intergenic
1180760019 22:18194297-18194319 ATGCACTTTTAAATAACTGTTGG + Intergenic
1180770331 22:18378596-18378618 ATGCACTTTTAAATAACTGTTGG + Intergenic
1180775649 22:18430403-18430425 ATGCACTTTTAAATAACTGTTGG - Intergenic
1180775999 22:18484070-18484092 ATGCACTTTTAAATAACTCATGG - Intergenic
1180808722 22:18741440-18741462 ATGCACTTTTAAATAACTCATGG - Intergenic
1181071650 22:20346414-20346436 ATGCACTTTTAAATAACTCATGG - Intergenic
1181194720 22:21175356-21175378 ATGCACTTTTAAATAACTCATGG - Intergenic
1181214724 22:21317414-21317436 ATGCACTTTTAAATAACTCATGG + Intergenic
1181525114 22:23478559-23478581 ATGCACTTTTAAATAACTCATGG + Intergenic
1183397786 22:37582680-37582702 ATGCTCTTTTTGCTAAGTGAGGG - Intergenic
949123977 3:423289-423311 AAGCAATTTTAGAGTAGTGATGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951841564 3:27039463-27039485 ACGCCCTTTTAGAAGAATGAAGG + Intergenic
952604848 3:35133131-35133153 ATGAACTAGAAGAAAAGTGAGGG + Intergenic
953553315 3:43922295-43922317 AAACACCTTTTGAAAAGTGAAGG - Intergenic
955214046 3:56970244-56970266 CTACAATTTTTGAAAAGTGAGGG + Intronic
955455270 3:59113393-59113415 ATTCACTGTAAGAAAAGTAAAGG + Intergenic
956003065 3:64749598-64749620 TGGAACTTTTACAAAAGTGAGGG + Intergenic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
958065395 3:88538939-88538961 TTGCACTTTTAGAAATATTATGG + Intergenic
958542420 3:95495896-95495918 ATACACCTTAAGAACAGTGAAGG - Intergenic
958701961 3:97603040-97603062 ATTCACATTTAGAAAAGTAATGG - Intronic
959132634 3:102376317-102376339 ATGTACTTTTAGAAGATTGCTGG - Intronic
959404704 3:105946554-105946576 AAGCACTTTTCCAAAAGTTAGGG - Intergenic
959465077 3:106676009-106676031 ATGGAGTCTTAGAAAAGTAAAGG - Intergenic
960268795 3:115651731-115651753 AAGCAATTTTAGAACAGTGGGGG - Intronic
961761473 3:129172225-129172247 ATACACCTTGATAAAAGTGATGG + Intronic
962532407 3:136295337-136295359 ATGTAGTTTTAAAAAAGTTAGGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963728335 3:148946627-148946649 ATTCACTTTCAGAAAAGAAATGG - Intergenic
964858754 3:161176622-161176644 ATTCACTGTGAGAACAGTGATGG + Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965703881 3:171486463-171486485 ATGCAATGTTTGAAAAGTGATGG + Intergenic
965734535 3:171806998-171807020 ATGCACTTTTAAAAGAGAAAAGG - Intronic
965875189 3:173308788-173308810 ATGCACTTTACGAACAGTAAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
970150609 4:13085800-13085822 CTGCATTTTTAAAAAATTGAAGG + Intergenic
971867069 4:32186399-32186421 ATGCACTAATAGGAAATTGAAGG - Intergenic
972946134 4:44258056-44258078 ATGCTGTTTTAGGAAACTGAGGG + Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974339440 4:60596032-60596054 ATGCATGTATAGAAAACTGAAGG - Intergenic
974649357 4:64734193-64734215 ATGCCCATTTAGAATAGTAAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975645739 4:76544059-76544081 ATGCTTTCTTAGAAAAGTCATGG - Intronic
976320944 4:83714642-83714664 GTTCACTTGTAGAAAATTGATGG + Intergenic
976493934 4:85704333-85704355 AAGCATTTTTAGAAAAGTTGAGG - Intronic
977603285 4:98957003-98957025 ATGATCTTTTAAAAAAGTTAAGG + Intergenic
977739598 4:100462081-100462103 AAGCACCTTGAGAAAAGAGAGGG + Intronic
977936607 4:102813171-102813193 CTCCCCTTTTAAAAAAGTGATGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
980496807 4:133595933-133595955 ATTCGATTTTAGAAAAATGAAGG + Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981662014 4:147178495-147178517 ATGCATTTTAAGAAAATTGCAGG - Intergenic
982199090 4:152942758-152942780 ATTCACATTTAGAAAAGCGTTGG + Intronic
982476021 4:155851763-155851785 ATGCATATCTGGAAAAGTGATGG - Intronic
982931274 4:161410176-161410198 ATGTATTTTTAGAATAGTTAAGG - Intronic
983129626 4:164001010-164001032 AAGAAATTTTAAAAAAGTGATGG + Intronic
983190060 4:164745666-164745688 ATGAACTTTTAAAAAGGTGGGGG - Intergenic
984553528 4:181187452-181187474 TTGTACTTCTAGAAAACTGAAGG + Intergenic
985352352 4:189078541-189078563 ATAGTCTTTTAGAAAATTGATGG - Intergenic
986186031 5:5439526-5439548 CTGCACTATTTGAAAAATGAAGG + Intronic
986450661 5:7860737-7860759 TTGCACTTTAAGCAAAGTTAAGG - Intronic
986476367 5:8137891-8137913 ATGTAATTTTAATAAAGTGAAGG + Intergenic
986490818 5:8287690-8287712 AATTACTTTTAGAAAAGTCAGGG + Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
989219123 5:38935133-38935155 ATGCTTGTTTAGAAATGTGACGG - Exonic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989793924 5:45443562-45443584 AAGCATTTTTAGGAAAGTGTAGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992660776 5:78958574-78958596 ATATTCTTTTATAAAAGTGATGG - Intronic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
993760614 5:91792184-91792206 ATGTATCTTTAAAAAAGTGATGG - Intergenic
993929170 5:93916819-93916841 ATGAATATTTCGAAAAGTGAAGG - Intronic
994103425 5:95919139-95919161 ATGCAGTTTTTGAAAACTAAAGG - Intronic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
995025745 5:107420266-107420288 TTGCATTTTTTGAAAAGTTAAGG - Intronic
995248635 5:109963983-109964005 ATGCACTTTTAAACAAGTTTTGG - Intergenic
996805185 5:127446711-127446733 AGGCCCTTTTAGGAAAGTGAAGG + Intronic
997081908 5:130749117-130749139 ATGCACTTTAAAAATACTGAAGG + Intergenic
997174050 5:131755698-131755720 AAGCACTGTTACAAAAGTTAAGG + Intronic
1000588910 5:163134482-163134504 AAGTATATTTAGAAAAGTGATGG - Intergenic
1000657471 5:163898005-163898027 TTGCATTTTTAAAAAACTGAGGG + Intergenic
1003941320 6:11030180-11030202 ATGCAGTTTTAGAGAACTAAAGG - Intronic
1005639408 6:27781807-27781829 ATGCCTTTTTAGAAGAGTGAAGG - Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1006884752 6:37371857-37371879 CTCCACTTCTAGAAAGGTGAGGG + Intronic
1007535291 6:42581859-42581881 TTGCACATTTAAAAAAGAGAAGG - Intronic
1007881410 6:45172019-45172041 ACTCACTTTTTAAAAAGTGATGG + Intronic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1008869417 6:56254712-56254734 ATGACCTTTAAGAAAAGTTAAGG - Intronic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1009679809 6:66877497-66877519 CTGCACTTTTTGAGAAGTGTAGG - Intergenic
1009829766 6:68915045-68915067 CTGCAAATTTAGAAAAGTAAAGG + Intronic
1009834300 6:68978813-68978835 ATGAACTTTTAGAATATAGAAGG - Intronic
1009883083 6:69593403-69593425 ATACAATTTTAGAAATGTAAAGG + Intergenic
1010063468 6:71652321-71652343 ATGCACTTTGAGGAAAGTGCAGG - Intergenic
1011025550 6:82865352-82865374 ATGTTCTGTTAGAAAAATGAAGG - Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012030129 6:94049283-94049305 ATGGTGTTTTAGAAATGTGAAGG + Intergenic
1012096051 6:94962752-94962774 ATGCACTTCTAGAATGGTGCAGG + Intergenic
1013389307 6:109667126-109667148 AGGCCCTTTTAAAATAGTGATGG + Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1016086280 6:139919367-139919389 TTGTACTTTTAGAAGAGAGATGG + Intergenic
1017319674 6:153075325-153075347 ATGCCCAGTTACAAAAGTGAAGG - Intronic
1019080808 6:169428327-169428349 AAGTACTTTCAGAAAAGTTAGGG + Intergenic
1019174451 6:170153131-170153153 CTTCACTGTTAGAAAAGTGAAGG + Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020493180 7:8814816-8814838 ATTCCCTTTAAGAAAACTGACGG + Intergenic
1020647225 7:10829519-10829541 ATGGCCTTCTAGAAGAGTGAAGG - Intergenic
1021730911 7:23594844-23594866 ATGCACACTTAAAAAACTGATGG + Intergenic
1022140591 7:27489970-27489992 ATGCACACATAGAAAAGTCATGG - Intergenic
1024376922 7:48650370-48650392 ATACAATTTTAGAAAAGAAAAGG + Intergenic
1024464442 7:49696749-49696771 ATGCAAATTTAGAAAAGTTGAGG + Intergenic
1024522090 7:50314686-50314708 ATTCACTGTCAGAAAAGAGAGGG + Intronic
1024954397 7:54901147-54901169 AGGCACTTTTACACAACTGATGG + Intergenic
1026011267 7:66638416-66638438 ATGCCCTATTACAAAGGTGAGGG + Exonic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1027757425 7:82231819-82231841 ATGCACAATTAGAAAAATAATGG + Intronic
1027973858 7:85122979-85123001 AAGCACTTTTAAAAAAGTATTGG - Intronic
1027981834 7:85234310-85234332 ATGCACCTTCAGTAAAGTGCTGG + Intergenic
1028101462 7:86826001-86826023 ATGCCTTTTTAAAAAAGTCATGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030848301 7:114450570-114450592 ATGCACATTCAGAAAAGTTTCGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033872684 7:145775820-145775842 AGGCAATTCTAGATAAGTGAAGG - Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034398836 7:150848120-150848142 ATGCGCTTCTAGAGAAGTGTGGG - Intronic
1034857798 7:154569184-154569206 AAGTAATTTTAGAAAAGGGAGGG + Intronic
1035480800 7:159181987-159182009 AAACACTTTTAAATAAGTGATGG - Intergenic
1036048229 8:5167368-5167390 ATGTAAAGTTAGAAAAGTGATGG - Intergenic
1036155751 8:6340427-6340449 TTGCACTTTTAGTAGAGTCAGGG + Intergenic
1038970466 8:32627810-32627832 ATGAATTTTAAGAAAATTGAGGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1041788702 8:61665869-61665891 ATGCAATATTATAAAATTGAGGG + Intronic
1043944638 8:86235694-86235716 ATGCATTTTTAGTAAAGACAGGG + Intronic
1046026283 8:108728034-108728056 GTGCAATTTTAGAAAAGTGGTGG + Intronic
1046143363 8:110123247-110123269 AAAAACATTTAGAAAAGTGATGG + Intergenic
1046487144 8:114901550-114901572 ATACCCTTCTAGAAGAGTGAAGG - Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1047783265 8:128127651-128127673 ATACACTTTTAGGAGACTGAAGG - Intergenic
1048116567 8:131530822-131530844 ATGCCCTGTTAGAAAAGGTAGGG - Intergenic
1048128115 8:131660051-131660073 ATGCAATGTGAGAAATGTGATGG - Intergenic
1048496455 8:134939887-134939909 ATGCACTAATAGAAACGGGAAGG + Intergenic
1048715752 8:137266882-137266904 ATGCACTATCTGAAAAGAGATGG - Intergenic
1049043217 8:140128546-140128568 ATTCTCTTTGAGAGAAGTGAAGG + Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051299762 9:15636119-15636141 ATCCATTTTTAAAAAAGAGAAGG - Intronic
1051610568 9:18957824-18957846 ATGCACTTTAGGAAAAGTGTGGG - Intronic
1051789052 9:20779208-20779230 ATTGACTTAAAGAAAAGTGAAGG + Intronic
1053619353 9:39799588-39799610 CTGCACTATAAGAAAAGTTAAGG - Intergenic
1053877511 9:42558937-42558959 CTGCACTATAAGAAAAGTTAAGG - Intergenic
1054234184 9:62542785-62542807 CTGCACTATAAGAAAAGTTAAGG + Intergenic
1054264803 9:62907841-62907863 CTGCACTATAAGAAAAGTTAAGG + Intergenic
1054891341 9:70255837-70255859 ATGAATTTTTTGAAAAGTAAAGG - Intergenic
1055060342 9:72062063-72062085 ATGCACTTTTAGTCAAATGGTGG + Intronic
1055287729 9:74747115-74747137 GTGGAGTTTCAGAAAAGTGATGG + Intronic
1055873994 9:80920826-80920848 ATGCATTTTTTGCAAATTGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1058361534 9:104152535-104152557 ATGTACATTGAGAAAAGTGGTGG - Intergenic
1058469185 9:105259275-105259297 ATACACTTTTAAATAAGTAATGG + Intronic
1059235436 9:112756761-112756783 ATGAACTGTTAAAAAGGTGAAGG - Intronic
1059937558 9:119326557-119326579 ACCCACATTTAGAAATGTGAGGG + Intronic
1060136660 9:121162949-121162971 ATGGTCTTTTAGAAAAATGTTGG + Intronic
1061657026 9:132100040-132100062 ATGCATCCTTAGAGAAGTGATGG + Intergenic
1185655466 X:1680808-1680830 ATGCACATTGAGAAAAGTTTGGG - Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188596205 X:31904165-31904187 ATGTACTTTTTGAAATATGAAGG + Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189300946 X:39951829-39951851 CTGCACTTCTGGAAAAGAGATGG + Intergenic
1189732470 X:44035876-44035898 ATGGGCTTTCAGAAAAGTAAAGG - Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1193200444 X:78683902-78683924 ATGCACTTTAAGAAAACTCTAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1194750771 X:97681888-97681910 ATACACTTATAGACAATTGAAGG - Intergenic
1195656758 X:107338885-107338907 CTGAAGTTTTAGAAAAGTCAAGG - Intergenic
1195751754 X:108166565-108166587 ATGAAAATTTATAAAAGTGATGG + Intronic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196967936 X:121078558-121078580 ATGCACTTTTAAAATAGTGAAGG + Intergenic
1196973469 X:121134227-121134249 AGGCCCTTTTGGAAGAGTGAAGG + Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197607721 X:128604914-128604936 ATGCATTTTTAAAATAATGAAGG + Intergenic
1197934465 X:131726602-131726624 ATGCCCTTTGAGAAGAGTGAAGG - Intergenic
1197968495 X:132091164-132091186 ATGCTTTTTTAAAAAAGAGATGG + Intronic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199284924 X:146045123-146045145 ATGCAGTTTTCGAAAACTGCTGG - Intergenic
1199528910 X:148825122-148825144 ATGGACTTCCAGAAAGGTGAGGG + Intronic
1199811263 X:151352193-151352215 ATTAAGTTTTAGAATAGTGATGG + Intergenic
1200734268 Y:6776901-6776923 TTGCCCTTTTAGAATAGTGAAGG + Intergenic
1200987337 Y:9316645-9316667 AGGAACTTTTAGAAAAATTAAGG + Intergenic
1201337059 Y:12892679-12892701 TTACACATTTAGAAAAGAGAAGG - Intergenic
1201850146 Y:18471256-18471278 ATGGACTTCTAGGGAAGTGAAGG - Intergenic
1201883172 Y:18849121-18849143 ATGGACTTCTAGGGAAGTGAAGG + Intergenic
1202042652 Y:20701398-20701420 CTTCTCTTTGAGAAAAGTGAAGG + Intergenic
1202118252 Y:21496034-21496056 AGGAACTTTTAGAAAAATTAAGG - Intergenic
1202120704 Y:21519574-21519596 AGGAACTTTTAGAAAAATTAAGG - Intronic
1202123155 Y:21543115-21543137 AGGAACTTTTAGAAAAATTAAGG - Intronic
1202155851 Y:21886266-21886288 AGGAACTTTTAGAAAAATTAAGG + Intronic
1202158299 Y:21909807-21909829 AGGAACTTTTAGAAAAATTAAGG + Intronic
1202160595 Y:21931221-21931243 AGGGACTTTTAGAAAAATTAAGG + Intergenic
1202184753 Y:22174732-22174754 AGGAACTTTTAGAAAAATTAAGG + Intronic
1202198095 Y:22317018-22317040 AGGAACTTTTAGAAAATTAAGGG - Intronic
1202206607 Y:22411669-22411691 AGGAACTTTTAGAAAAATTAAGG - Intronic
1202230761 Y:22655154-22655176 AGGGACTTTTAGAAAAATTAAGG - Intergenic
1202312397 Y:23541011-23541033 AGGGACTTTTAGAAAAATTAAGG + Intergenic
1202558406 Y:26129583-26129605 AGGGACTTTTAGAAAAATTAAGG - Intergenic
1202577998 Y:26347747-26347769 ATGAACTTTTAGAACAGTCAGGG - Intergenic