ID: 1197251244

View in Genome Browser
Species Human (GRCh38)
Location X:124218272-124218294
Sequence TGTTCATTAATTAAAGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197251244 Original CRISPR TGTTCATTAATTAAAGGGGG GGG Intronic
901584605 1:10278052-10278074 GGTTCGTGAATTAAAGGAGGAGG + Exonic
901613016 1:10514011-10514033 TGTTAAATAATTACAGGGAGCGG - Intronic
902971731 1:20058202-20058224 TGTTCATTACTGAGAGAGGGTGG + Intronic
903920972 1:26800458-26800480 TGTTCTTTAATGAAGGTGGGAGG + Intergenic
907168747 1:52440613-52440635 TGGTCATTAATTAAAAGTGATGG - Intronic
909927939 1:81460685-81460707 TGTTAATAAAGTAAAAGGGGTGG - Intronic
913606400 1:120470590-120470612 TGTATTTTAATTAAATGGGGAGG + Intergenic
914210031 1:145569544-145569566 TGTATTTTAATTAAATGGGGAGG - Intergenic
914268954 1:146061916-146061938 TGTATTTTAATTAAATGGGGAGG - Intergenic
914584798 1:149051241-149051263 TGTATTTTAATTAAATGGGGAGG - Intergenic
917389571 1:174520159-174520181 TTTTCATTTATTAAAGGGATAGG + Intronic
923781583 1:237030127-237030149 AGTGCATTGAATAAAGGGGGCGG + Intergenic
923891107 1:238215659-238215681 TGTTCATAAAAGAAATGGGGAGG + Intergenic
1063183825 10:3632264-3632286 TGTGCATTTATTAAAGTGGCGGG + Intergenic
1065486535 10:26241261-26241283 TGTTCATTAATAAAATGGCTTGG - Intronic
1066421043 10:35265098-35265120 TCTTAATTTCTTAAAGGGGGAGG + Intronic
1066541255 10:36449101-36449123 TGTTCCTTAAAAGAAGGGGGTGG + Intergenic
1067677079 10:48390733-48390755 TCTTCATTAGTAAAGGGGGGCGG - Intronic
1068289302 10:54981769-54981791 AATTAATTAATTAAAGGAGGTGG - Intronic
1069016717 10:63438066-63438088 TGTTTGTTAGTTAAAGGGAGAGG - Intronic
1069109962 10:64435096-64435118 TGTTAATTAATTAGGAGGGGTGG + Intergenic
1069117177 10:64522070-64522092 TGTTGATGAATTGAAGTGGGAGG - Intergenic
1069809619 10:71148743-71148765 TCTCCATTCCTTAAAGGGGGAGG - Intergenic
1072572679 10:96672501-96672523 AGTTCATTTATTTAAGGGAGTGG - Intronic
1080766868 11:35305263-35305285 TGATCATTATTCAAAGTGGGTGG - Intronic
1084340999 11:68500906-68500928 TGTTCAATACTTGAAGGGTGAGG + Intronic
1085845414 11:80059270-80059292 TCTTCCTTATTTAAAAGGGGAGG + Intergenic
1086722901 11:90144187-90144209 TCTTCATTCATTAAAGTTGGGGG - Intronic
1087469808 11:98558142-98558164 AGTTCATTAATTAATGGAAGAGG + Intergenic
1087645264 11:100801898-100801920 TGTTTATTACTTAAAAGGTGAGG + Intronic
1088039382 11:105359149-105359171 TGTTCATTAATTAAAGACTAAGG + Intergenic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1091777487 12:3194033-3194055 AGTTCATTAACTAAAGGATGGGG - Intronic
1093135176 12:15440686-15440708 TGTTTATTATTTAAAGGATGGGG - Intronic
1094266892 12:28569687-28569709 TGATCAGCAATTAAAGTGGGTGG - Intronic
1096474205 12:51898010-51898032 TGATCAATAATTAGAGGGAGAGG + Intergenic
1097839241 12:64305045-64305067 TGTTTTTTAAATAAAGGGGGAGG - Intronic
1099906548 12:88778158-88778180 TGTTGATTAATTCAGGGAGGGGG - Intergenic
1099982854 12:89626931-89626953 TGGTCATAAATTATAGGGGAGGG - Intronic
1100042114 12:90332544-90332566 TGCTCAATAATTTAAGGAGGGGG - Intergenic
1101267123 12:103100668-103100690 TGATCATTAATTAGAGTGTGTGG + Intergenic
1102420310 12:112798238-112798260 TGTTGATTAATTGCAGGGGGTGG - Intronic
1102538884 12:113603754-113603776 GATTCATTAATTAAAGGAGATGG - Intergenic
1107262180 13:38506180-38506202 TGTTCATTAGATCATGGGGGCGG + Intergenic
1107414802 13:40190512-40190534 TGTTCTTTAAAAAAAGGAGGTGG - Intergenic
1107672268 13:42758270-42758292 TGTTCATTATTGAATGGGAGAGG + Intergenic
1108528476 13:51305819-51305841 TGTTAAATAATTGAAGGGGGCGG - Intergenic
1108891587 13:55267276-55267298 TGTTACCTAATTAAAGTGGGTGG + Intergenic
1113705553 13:112430443-112430465 TGTTTTTTAATTAAATTGGGAGG + Intronic
1115453604 14:33576573-33576595 TGTACATTAAGTAAAGGAGAGGG + Intronic
1116935150 14:50732122-50732144 TGATCTTTAATTACAGTGGGGGG + Intronic
1119678478 14:76574229-76574251 TCTTCATCTATTAAAGGAGGAGG + Intergenic
1120881669 14:89418598-89418620 TGCTCAGTAATCAAAGGGGTGGG - Intronic
1122040325 14:98983314-98983336 TGTTCATAAAATGAAGAGGGGGG - Intergenic
1122850317 14:104524654-104524676 GGTTCATTTTTTAAAGGGTGGGG + Intronic
1124532841 15:30521827-30521849 TGTTCATTGATTGAGGGAGGAGG - Intergenic
1126918162 15:53489286-53489308 TGTTCATTGATTAAATTGGATGG - Intergenic
1128759629 15:70207335-70207357 TGTGCAGTAATTAAAAGGGCTGG + Intergenic
1128874097 15:71188093-71188115 TGTTCATAAGATAAAAGGGGTGG + Intronic
1129454847 15:75671098-75671120 TGTCCCCTAATTAAAGGGTGAGG + Intergenic
1130179936 15:81615464-81615486 TGTCCTTTTATTAAAGAGGGAGG + Intergenic
1137489174 16:48916811-48916833 TGTTCATTCTTTAAAAGGGCTGG + Intergenic
1137761975 16:50948345-50948367 GGGTCATTAGTTAAAAGGGGAGG + Intergenic
1143800028 17:9371392-9371414 TGTACTTTAACTATAGGGGGTGG - Intronic
1145964618 17:28907809-28907831 TGTTCAAAAATAAAAGGGGAGGG - Intronic
1145985649 17:29044235-29044257 TGTTCATAAAATGAAGGGGCTGG + Intronic
1149228979 17:54510091-54510113 TGTTCATTAATTTTATTGGGAGG - Intergenic
1155901592 18:31397375-31397397 TCTTCATAAAGTAAAGGGAGAGG - Intronic
1156583519 18:38407045-38407067 TGTTCATTAAATAAAATGGCTGG + Intergenic
1159701187 18:71630206-71630228 CATTCATAAATTAATGGGGGTGG + Intergenic
1162368266 19:10262760-10262782 AATTCATTAATTAAATAGGGGGG + Intergenic
925388458 2:3479669-3479691 TGTTCATGAATGCAAGGGGCAGG + Intronic
926548987 2:14278185-14278207 TGATTTTTAATTAAAGGAGGGGG + Intergenic
927783559 2:25957204-25957226 TCTTCATTTATTAAATGCGGAGG - Intronic
931623635 2:64235580-64235602 GTTGCATTAATTAAATGGGGTGG + Intergenic
931801299 2:65760653-65760675 TGTTGAATAATTAAGGAGGGGGG - Intergenic
932229909 2:70074576-70074598 TATTCATTAAACAAAGGGGTTGG - Intergenic
932250604 2:70240432-70240454 TGTTCTTGAATAAAAGGGAGTGG + Intronic
933595910 2:84282977-84282999 TGTTCATTAATTGAAAGGACTGG + Intergenic
933921371 2:87050533-87050555 TGTTCATTAATAGAAGGAGAAGG + Intergenic
933930257 2:87143266-87143288 TGTTCATTAATAGAAGGAGAAGG - Intergenic
934001590 2:87719055-87719077 TGTTCATTAATAGAAGGAGAAGG - Intergenic
935098240 2:99967737-99967759 TGGTAATTAATTAAATGTGGAGG - Intronic
935707325 2:105868375-105868397 TGTTCATAAGTTAAAGGCTGGGG + Intronic
935914158 2:107931244-107931266 TGTTCTGTAATTAAAGGGAAAGG + Intergenic
938988660 2:136605287-136605309 TGGTCACTAATTCAAGGGGTTGG + Intergenic
944368750 2:198956098-198956120 TGTTAATTAATTAAATATGGTGG - Intergenic
944420573 2:199525800-199525822 TGATCAAAAATTCAAGGGGGTGG + Intergenic
944489436 2:200242922-200242944 CGTTCAATAATTAAAGAGGTAGG - Intergenic
945071654 2:205995081-205995103 TATTTATTAATGAAAGGAGGAGG + Exonic
945189174 2:207168101-207168123 TGTTCATGAATAATAGGGGAAGG + Intergenic
946222138 2:218237117-218237139 TGTTCAATACTTAAAGTGTGTGG - Intronic
946621037 2:221563402-221563424 TGATCCTTACTTAAAGAGGGCGG - Intronic
948188127 2:236037233-236037255 TATTCAATAATTAGAGGTGGTGG + Intronic
1169566179 20:6855944-6855966 TTTTCTTTATTTAAGGGGGGTGG - Intergenic
1170899623 20:20449055-20449077 AGTTCATTAATTAAACAGTGCGG + Intronic
1172292273 20:33784526-33784548 TGTTCATGAATTAAGGCAGGTGG - Intronic
1172329614 20:34066185-34066207 TTTTCATTTATAAAATGGGGCGG + Intronic
1174616302 20:51838160-51838182 AGTTCATTATTTAAAGAAGGCGG + Intergenic
1175640963 20:60629803-60629825 TGTTCATTAATTAACGAGACAGG - Intergenic
1178346752 21:31835398-31835420 TGCTCATGAATTAAAAGGGAGGG + Intergenic
1181263613 22:21616745-21616767 TGTGCTTTAAAAAAAGGGGGGGG - Intronic
949383936 3:3478741-3478763 TTTTTATTAATAAAAGGGAGAGG - Intergenic
951148788 3:19262628-19262650 TGTTCATTTATTAAATGGGTGGG - Intronic
954142368 3:48615068-48615090 TATTCATTATTGAAAGTGGGGGG + Intergenic
954197345 3:49004608-49004630 TTTCCACTAAATAAAGGGGGCGG - Intronic
956645862 3:71455437-71455459 TTTTCTTTAATTAAAAGGGAAGG - Intronic
960484808 3:118238946-118238968 TGTTGAATAATTAAAAGGAGGGG + Intergenic
966258522 3:177947942-177947964 TGATAGTTAATTAAAGAGGGAGG + Intergenic
968952781 4:3703273-3703295 AGTCCATTAATTAAGAGGGGGGG + Intergenic
970384198 4:15539930-15539952 TCTCTAGTAATTAAAGGGGGTGG - Intronic
970721029 4:18988554-18988576 TGTCCATGAGTTAAAGGGAGAGG - Intergenic
970904003 4:21193969-21193991 TTTTCATTGTGTAAAGGGGGAGG + Intronic
972871652 4:43307780-43307802 TTTTCTTGAATTAAAGGGAGGGG + Intergenic
973183171 4:47292887-47292909 TGTTCATCAATTCATGAGGGTGG + Intronic
973710970 4:53630076-53630098 TCTTCATTAAAAAAAGGTGGGGG + Intronic
974126009 4:57696558-57696580 GGATCATTAATTCAAGGGTGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
977681855 4:99806316-99806338 TTTTCATTAATTAAAGGAAAGGG + Intergenic
979312075 4:119214361-119214383 TTTTCATTAATGAAACTGGGAGG + Intronic
980972090 4:139576390-139576412 TGTTCACTATTTATAGCGGGAGG + Intronic
982831690 4:160069253-160069275 TGTTTATTATTAAAAGGGAGAGG + Intergenic
983623840 4:169785524-169785546 TGTTCATAATATACAGGGGGGGG + Intergenic
983624023 4:169786667-169786689 TGTTCATAATTTTCAGGGGGTGG - Intergenic
986013987 5:3741327-3741349 TGTTCATTAAAATATGGGGGTGG - Intergenic
986874261 5:12087889-12087911 TATTCATTCATTAAACTGGGTGG + Intergenic
987300035 5:16589122-16589144 TGTTGAATAAGCAAAGGGGGTGG - Intronic
987937257 5:24481942-24481964 AGTTCACTAACTAAAGGAGGAGG + Intergenic
989988760 5:50735960-50735982 CATTCACTAATAAAAGGGGGGGG - Intronic
994391507 5:99197615-99197637 TGTTCATAACATAAAGGGGAAGG - Intergenic
994424652 5:99569554-99569576 TTTACATTATTTAAAGGGCGTGG - Intergenic
995633970 5:114163986-114164008 TTTTCATTATTTAATGGGGGTGG + Intergenic
998830866 5:146157402-146157424 TGTTAAGGAATTAATGGGGGAGG - Exonic
999519591 5:152337559-152337581 TGTTAATCCATTAAAGAGGGTGG - Intergenic
1000504825 5:162102837-162102859 TTTATATTAATTAAAGAGGGAGG - Intronic
1000838240 5:166182725-166182747 TGTTCATTAATGTACGGTGGAGG + Intergenic
1003632519 6:7800889-7800911 TGGTCATAAAATAAAGCGGGGGG + Intronic
1004761208 6:18668580-18668602 TGGTCATTGATTAGAGGGTGAGG - Intergenic
1007070695 6:39036042-39036064 TGTTTTTAAATTAAAGGAGGTGG - Intergenic
1010095240 6:72035462-72035484 TGTTGCTAAATTAAAGGAGGGGG - Intronic
1014550416 6:122783985-122784007 TGTTTATAAAAAAAAGGGGGGGG - Exonic
1016101395 6:140105620-140105642 TGTTGTTAAATTAAAGGGGGAGG - Intergenic
1016505987 6:144779563-144779585 TGTTGATTAATCTGAGGGGGAGG + Intronic
1016930150 6:149397552-149397574 GGTTAATTGATTAAAGTGGGTGG + Intronic
1017492086 6:154953635-154953657 TTTTCATTAATTTGCGGGGGTGG + Intronic
1018408145 6:163509464-163509486 TGACCATTTAATAAAGGGGGGGG + Intronic
1020382795 7:7565471-7565493 TGTTCATGATTAAAAGTGGGTGG - Intergenic
1021290291 7:18835282-18835304 AGTTCAGGAAGTAAAGGGGGTGG + Intronic
1023320933 7:38996867-38996889 TGTCCATTCATTAAAGGTGGGGG - Intronic
1025823857 7:64995368-64995390 TGTCCATGAATTAAAGGGAATGG - Intronic
1029287455 7:99475657-99475679 TGGTCCTAAATTAAAGGGAGTGG + Intronic
1029729111 7:102427766-102427788 AGTTAACTAATTAAAGGGGCGGG - Intergenic
1029787488 7:102807165-102807187 TGATCAGTGATTGAAGGGGGTGG + Intronic
1030832257 7:114239459-114239481 TGTTGATGAATTAAATGGGTTGG + Intronic
1033364368 7:140660183-140660205 TGTTCATGAACAAAAGGGAGTGG + Intronic
1034526895 7:151670298-151670320 GGTTGATTAATTGAAGGGGAAGG - Intronic
1034625715 7:152490837-152490859 TCATCATTAATTAAAGGCGATGG + Intergenic
1036963690 8:13273216-13273238 TGTCCATGAATCAAAGGGGAGGG + Intronic
1039919593 8:41883918-41883940 TGTTCATAAATCAGAGGGAGTGG + Intronic
1041697590 8:60752594-60752616 TGCTCTTTAATGAAAGGGGAGGG + Intronic
1043377641 8:79668349-79668371 AGTTCATCTATTAAAGGGTGGGG - Intergenic
1043445716 8:80317548-80317570 TGGTGATTAATTAATGGGGAGGG - Intergenic
1044893032 8:96857342-96857364 TGTTCCTTAAGTAGAGGAGGAGG - Intronic
1048821267 8:138382815-138382837 TGTTCATTCATTACAAGGGAGGG - Intronic
1050083991 9:1945319-1945341 TGTTCATTTATAAAAGGAGTGGG + Intergenic
1051674936 9:19549377-19549399 TGTGTCTTGATTAAAGGGGGAGG - Intronic
1053655902 9:40218169-40218191 TGTTGTTTAATTGAGGGGGGGGG + Intergenic
1053906254 9:42847376-42847398 TGTTGTTTAATTGAGGGGGGGGG + Intergenic
1054368012 9:64364395-64364417 TGTTGTTTAATTGAGGGGGGGGG + Intergenic
1054528708 9:66158123-66158145 TGTTGTTTAATTGAGGGGGGGGG - Intergenic
1056292251 9:85155675-85155697 TGTTCATTCATTAATTGGAGAGG - Intergenic
1057262666 9:93594189-93594211 TGTGCATTAATGGAGGGGGGGGG - Intronic
1058404086 9:104652219-104652241 TATTCATTAATTAATGCTGGTGG - Intergenic
1058931300 9:109721819-109721841 AGTTCATTAATTAAAAGGACTGG - Intronic
1186829242 X:13374184-13374206 AGTTCATTATTTTGAGGGGGTGG + Intergenic
1186947617 X:14586427-14586449 TGATCAATAATTAATGGGGCAGG - Intronic
1188407768 X:29832932-29832954 TGATCATTAATAAATGGTGGGGG + Intronic
1190057139 X:47187541-47187563 TGTATATTAATAAATGGGGGAGG - Intergenic
1190923829 X:54883217-54883239 TGTTGATTAAGTAAAAGGGCGGG - Intergenic
1193261555 X:79412523-79412545 TATTAATTAAAAAAAGGGGGAGG - Intergenic
1195174184 X:102298648-102298670 TGATGATTAAATAAAGAGGGTGG + Intergenic
1195184681 X:102388444-102388466 TGATGATTAAATAAAGAGGGTGG - Intronic
1195403737 X:104490068-104490090 AGTTAATTAATTAAAGGGGAAGG - Intergenic
1197251244 X:124218272-124218294 TGTTCATTAATTAAAGGGGGGGG + Intronic
1197390976 X:125864045-125864067 TGTTCAAAAATTCAAGGAGGAGG + Intergenic
1198295574 X:135283403-135283425 TGTTCCTCATTTAAAGGAGGGGG - Intronic