ID: 1197259650

View in Genome Browser
Species Human (GRCh38)
Location X:124304641-124304663
Sequence CCAGATCAGCAGTGGCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197259650_1197259659 -5 Left 1197259650 X:124304641-124304663 CCTTAGAGCCACTGCTGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1197259659 X:124304659-124304681 TCTGGGAGTTGGGGGATGGTAGG 0: 1
1: 0
2: 3
3: 70
4: 743
1197259650_1197259660 -1 Left 1197259650 X:124304641-124304663 CCTTAGAGCCACTGCTGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1197259660 X:124304663-124304685 GGAGTTGGGGGATGGTAGGCAGG 0: 1
1: 0
2: 1
3: 44
4: 567
1197259650_1197259658 -9 Left 1197259650 X:124304641-124304663 CCTTAGAGCCACTGCTGATCTGG 0: 1
1: 0
2: 1
3: 9
4: 151
Right 1197259658 X:124304655-124304677 CTGATCTGGGAGTTGGGGGATGG 0: 1
1: 0
2: 8
3: 62
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197259650 Original CRISPR CCAGATCAGCAGTGGCTCTA AGG (reversed) Intronic
901792686 1:11662570-11662592 CCAGATCAGCAGTGCCACCCAGG + Exonic
905076174 1:35272537-35272559 CTAGTACAGCAGAGGCTCTATGG + Intronic
905453333 1:38071089-38071111 CCAGACCAGCAGTGCCCTTAGGG - Intergenic
905618840 1:39422791-39422813 CCAGCTGAGCAATGGCTCCAAGG - Exonic
909483454 1:76149947-76149969 CCAGGTGAGCTCTGGCTCTAGGG - Intronic
909534895 1:76725521-76725543 CCAGATCAGCTTTGGCTATGTGG + Intergenic
915359330 1:155276838-155276860 ACAGATGAGCAGTGGCTTTATGG + Intronic
915804362 1:158828986-158829008 CCACTTCAGCAGTGGCTGAAGGG - Intergenic
917521111 1:175749191-175749213 CCAGCTCAGCCCTGGCTTTAGGG - Intergenic
917615545 1:176740097-176740119 GCATCTCAGCTGTGGCTCTAAGG + Exonic
920422532 1:205844862-205844884 CCTGATCAGCAGGAGCTCCAAGG + Exonic
921206440 1:212853550-212853572 CCTGATCAGCAGAGGCTATATGG - Intergenic
923494930 1:234515720-234515742 CCAGCTTTGCAGTGGTTCTAAGG + Intergenic
1063644181 10:7861952-7861974 GCAGAACATCAGTGACTCTATGG - Intronic
1063899094 10:10713321-10713343 CCTTGTCAGCAGTGACTCTACGG + Intergenic
1067831171 10:49611797-49611819 CCACACCTGCAGTGGCTGTACGG + Exonic
1073767497 10:106699240-106699262 CCAGAGCAGCAGAGGCCCTGAGG - Exonic
1074256565 10:111808321-111808343 GCAGATCAGCAGTGGTGCCAGGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075606225 10:123812671-123812693 TCAGATCAGCGGTGGCATTAGGG + Intronic
1077348577 11:2077154-2077176 GCAGGTCAGCAGTGGCTCATGGG - Intergenic
1078060127 11:8037945-8037967 CTAGCTCAGAAGTGGCTCTAGGG + Intronic
1080041013 11:27759507-27759529 ACAGATCAGCATTTGCTCTGGGG - Intergenic
1081793064 11:45802726-45802748 CCAGATCACCAGGGCCTCTCAGG + Intergenic
1083091756 11:60207270-60207292 CCAGAAAAGCAGTGGCTTTGGGG - Intronic
1089494444 11:118901255-118901277 CCAGAACAGCAGTGGCGTGATGG - Exonic
1089980761 11:122770401-122770423 CCAGACCAGCAGGTTCTCTAGGG - Intronic
1091400403 12:177587-177609 CCAGCTCAGGACTGGCTCCACGG - Exonic
1092223378 12:6730602-6730624 CCAGATGAGCAGGGGCTGGAAGG + Intronic
1092450956 12:8601422-8601444 CCATATAAGCACTGGCTATAAGG - Intergenic
1096466834 12:51851329-51851351 CCACCTCAGCAGGGGCTCTCAGG - Intergenic
1098716655 12:73835060-73835082 CAAGAACATCAGTTGCTCTACGG + Intergenic
1100341658 12:93684901-93684923 CCACATCAGCAGAGGCTCAGTGG + Intronic
1104744876 12:131204377-131204399 CCAGATCCACAGCGGCTCTTGGG + Intergenic
1104789520 12:131473024-131473046 CCAGATCCACAGCGGCTCTTGGG - Intergenic
1107480430 13:40781484-40781506 CCAGGTCTGCAGTGGGTGTAGGG + Intergenic
1108590686 13:51910618-51910640 CCAGAGCAGCCTTGGCACTATGG - Intergenic
1109126847 13:58528596-58528618 CCAGAGCAGCCTTGGCGCTATGG + Intergenic
1111852851 13:93598737-93598759 CCAGTTCAGTAGTGGCAATATGG - Intronic
1114305601 14:21420157-21420179 CCACATCAGCAGAGGCACTAGGG - Intronic
1117573763 14:57076884-57076906 CCACATCAGCAGTGGTTCGATGG - Intergenic
1118833661 14:69459585-69459607 GCAGATCAGCAATCCCTCTAGGG + Exonic
1119769440 14:77211199-77211221 CCAGAGCAGCAGAGGCTCAGGGG + Intronic
1121492976 14:94372949-94372971 CCAGATCAGCAGTGGGCACAGGG + Intergenic
1123218280 14:106832157-106832179 CCAGATTAGCAGAGACCCTAAGG + Intergenic
1123738970 15:23216469-23216491 CCAGCTCAGCAGAGGCTGGAAGG - Intergenic
1124290190 15:28445439-28445461 CCAGCTCAGCAGAGGCTGGAAGG - Intergenic
1124293048 15:28472129-28472151 CCAGCTCAGCAGAGGCTGGAAGG + Intergenic
1124443932 15:29711665-29711687 CAAAATCAGAAGTGGGTCTAGGG - Intronic
1124492752 15:30168141-30168163 CCAGGTCCGCAGTGCCTCTGAGG - Intergenic
1124750782 15:32370184-32370206 CCAGGTCCGCAGTGCCTCTGAGG + Intergenic
1125406619 15:39358855-39358877 TCCTAGCAGCAGTGGCTCTATGG - Intergenic
1127617720 15:60703529-60703551 TCTGATCAGCAGTGGATCTAAGG + Intronic
1128127621 15:65204598-65204620 CCATATCAGCAGGGATTCTATGG + Intronic
1128583876 15:68830293-68830315 CTAGATCAGCACTGGCCCTGAGG + Intronic
1132731359 16:1363815-1363837 CTAGATCAGTACTGGCTCTGAGG - Exonic
1133054608 16:3139298-3139320 CCAGCCCTGCAGTTGCTCTAAGG + Intronic
1135732068 16:24903094-24903116 CCAGCCCAGCAGTGGCTCCTGGG + Intronic
1139176018 16:64688644-64688666 TCAGTCCAGCAGTGGCTTTATGG + Intergenic
1139441097 16:66967395-66967417 CCAGATCAGCAGTGCCCAGAAGG - Intronic
1143858242 17:9868632-9868654 CCAGATGAGCAGAGGCTTCATGG + Intronic
1149674420 17:58446668-58446690 CCAGAGCAACAGTGGTTCTTGGG + Intronic
1152539982 17:80969970-80969992 CCAGAACAGCACTGGCACCAGGG + Intergenic
1152794270 17:82299192-82299214 TCAGAGCAGCAGAAGCTCTAGGG + Intergenic
1155081778 18:22417895-22417917 CCAGAGCAGCCTTGGCGCTACGG - Exonic
1156589076 18:38465776-38465798 CCAGGTCACCACTGACTCTAAGG - Intergenic
1157466675 18:47953261-47953283 CAAGATCAGAAGAGACTCTAGGG + Intergenic
1159935018 18:74358125-74358147 CCACTTCAGCAGTGGATGTATGG - Exonic
1161167821 19:2797828-2797850 CCAGGACAGCGGTGGCTTTATGG - Intronic
1162844156 19:13379437-13379459 CCAAACCAGCAGTGTCTCTGAGG + Intronic
1163691923 19:18742990-18743012 CCAGATCGGGAGTGGCACCATGG + Exonic
1165437715 19:35805743-35805765 CAAGATCTGCAGGGGCTCCAGGG - Intronic
1167409539 19:49336915-49336937 CCAGATCTGCAGAGGCACGAAGG - Exonic
928604921 2:32936742-32936764 CCAGCTGAGAAGTGGCTCTCAGG + Intergenic
933169728 2:79111709-79111731 CCATCTCAGAAGTGGCTCAAAGG - Intergenic
940845683 2:158639430-158639452 CCAGATCAAGAGAGACTCTAAGG + Intronic
942242196 2:173972850-173972872 CCTGGCCAGCAGTGGCTTTATGG - Intergenic
946419438 2:219556707-219556729 CTTCACCAGCAGTGGCTCTAAGG + Exonic
947933624 2:233984673-233984695 ACAGATCAGAAGGGGCTCGAGGG - Intronic
1169278336 20:4248253-4248275 CCAGCCCAGCAGGGGCCCTACGG + Exonic
1174060266 20:47827413-47827435 ACAGATCACCACTGGCTCCATGG - Intergenic
1174071631 20:47903957-47903979 ACAGATCACCACTGGCTCCATGG + Intergenic
1174152418 20:48494678-48494700 ACAGATCACCACTGGCTCCATGG - Intergenic
1174211916 20:48886465-48886487 CCAGCTGAGCAGTGGTTCCATGG - Intergenic
1176310701 21:5147464-5147486 CAAGACCAGCAATGGCCCTAAGG + Intronic
1179644509 21:42767285-42767307 CCAGGGCAGCAGTGTCTCTGGGG - Intronic
1179846354 21:44114571-44114593 CAAGACCAGCAATGGCCCTAAGG - Intronic
1180255834 21:46626825-46626847 ACAGAACAGCTGTGGCTCTGCGG + Intergenic
1182045857 22:27273655-27273677 CCAGAACAGCAGTGGCAGTAAGG + Intergenic
1182477357 22:30583388-30583410 CCAGATTATCAGGGGCTCCAGGG - Intronic
1184747807 22:46466134-46466156 GCAGAGGACCAGTGGCTCTAAGG + Intronic
950649910 3:14401017-14401039 GGGGATCAGCAGTGCCTCTAGGG - Intergenic
952979314 3:38722257-38722279 CCTGCTCAGCAGTGGATCTCTGG - Exonic
958106644 3:89082392-89082414 ACAGCTCAGCACTGGCTCAACGG + Intergenic
959311320 3:104741109-104741131 CCACTTCTGCAGTGGCTCTCTGG + Intergenic
960478339 3:118158446-118158468 CCAGTTCAGCAGTGGCTATAAGG - Intergenic
961514821 3:127425960-127425982 CCTGCTCAGCTGGGGCTCTAGGG + Intergenic
962837325 3:139201088-139201110 CCAGATCAGCCCTAGCTCTGGGG - Intronic
963870460 3:150409386-150409408 CCAGATCACCAGTGTCACCACGG + Exonic
964508718 3:157426252-157426274 CCAGTTCAACAGAAGCTCTAGGG + Intronic
969331067 4:6473589-6473611 CCAGAGCTGCAGGGGCTCTTGGG + Intronic
969443807 4:7232927-7232949 ACAGTGCAGCAGTGTCTCTATGG - Intronic
970033192 4:11701262-11701284 CCAGATCAGCAGAGAGTTTAGGG - Intergenic
970581030 4:17474241-17474263 CCAGTTCAGCAGTTACTCTGTGG + Intronic
975985297 4:80197035-80197057 GCAAATCAGCGGTGGCTCCAGGG + Exonic
977372058 4:96150092-96150114 CCACATCAGCAGTTCCTTTATGG - Intergenic
985635948 5:1036006-1036028 CCAGAGCCGCAGGTGCTCTAGGG - Intronic
986036652 5:3947130-3947152 CAACATCAGCTGTGGCTCTGGGG + Intergenic
987979478 5:25063088-25063110 CCAGACCAGCAGAGGCTCCTTGG - Intergenic
988230826 5:28477052-28477074 GCAAGTCAACAGTGGCTCTAGGG + Intergenic
994476476 5:100277377-100277399 CAAGATCAGCAGGGCCACTATGG - Intergenic
998908202 5:146929382-146929404 ACAAGTCAGCAGTGGTTCTATGG + Intronic
1001686889 5:173600006-173600028 CCAGATCTGCTGTTGCTCCAGGG - Intergenic
1005862075 6:29909459-29909481 CCAAATCTGCAGTGTCTCTGAGG + Intergenic
1008153692 6:47988476-47988498 CCATATCAGCACAGTCTCTAAGG - Intronic
1012122784 6:95387986-95388008 CCAGCTCAGCAGGGACTCCATGG + Intergenic
1013167838 6:107609775-107609797 CCAGACCATCACTGGCCCTAGGG + Intronic
1018936551 6:168277471-168277493 CCTGAGCAGCAGTAGCTCTTGGG + Intergenic
1018938296 6:168289305-168289327 CCAGAGCAGCCTTGGCGCTACGG - Intergenic
1021308796 7:19065654-19065676 CTGGAGCAGCAGTGGCTCAAAGG + Intronic
1022403430 7:30063668-30063690 GCAGATCAGCAGTTGCTAGATGG - Intronic
1025234672 7:57226616-57226638 ACAGATCACCACTGGCTCCATGG + Intergenic
1028128406 7:87142254-87142276 CAAGATCAGAAGTGGTTATAGGG - Intergenic
1032735731 7:134691187-134691209 CCAAAACAGCAGTGCCTCCATGG - Intergenic
1035139792 7:156747930-156747952 CCTAATCAGCATTGGCTCTGTGG - Intronic
1036563603 8:9919166-9919188 CCGCAGCAGCAGTTGCTCTAGGG - Intergenic
1038927061 8:32152693-32152715 CCAGTTCAGCAGTCACTCTTTGG - Intronic
1039834937 8:41248694-41248716 CCTAATCAGAAGTGGCTTTAAGG - Intergenic
1040063252 8:43122590-43122612 CCAGAGCAACTGTGGCCCTATGG + Exonic
1040545012 8:48392261-48392283 CCAGGAAAGCAGTGGCTCTCTGG + Intergenic
1040908188 8:52490685-52490707 GCAGATCAGTGGTGGTTCTAGGG + Intergenic
1041816703 8:61980833-61980855 CCAGTTCAGGAGTGGCTGGATGG - Intergenic
1042977253 8:74483108-74483130 CCAGAAGAGCACTAGCTCTATGG - Intronic
1047780740 8:128109108-128109130 CCAGCCCAGCACTGGCTCGAGGG - Intergenic
1047921368 8:129638033-129638055 CCATATCAGCTGGGGTTCTATGG + Intergenic
1048809904 8:138276452-138276474 CCTAATCAGCAGTGACTCTGGGG - Intronic
1049684834 8:143935130-143935152 GCAGCTCAGCGGTGGCTCTGGGG + Intronic
1050175593 9:2866630-2866652 ACAGATCAACAGTGGTTCTGTGG - Intergenic
1050256494 9:3797459-3797481 CCAGATCAGCAGTGTCAGCATGG + Intergenic
1051966871 9:22838579-22838601 TCACAGCTGCAGTGGCTCTAAGG + Intergenic
1052704756 9:31981603-31981625 CCTCATCAGCTGTGGCACTAAGG + Intergenic
1053350003 9:37407543-37407565 CCAGATCAGGAGTGGATCTCTGG - Intergenic
1053451355 9:38196757-38196779 CCTGATGATCAGTGACTCTAAGG + Intergenic
1053822088 9:41978405-41978427 CCAGAGGAGCCGAGGCTCTAGGG + Intronic
1054608486 9:67209008-67209030 CCAGAGGAGCCGAGGCTCTAGGG - Intergenic
1057191023 9:93087767-93087789 CCAGATAAGCAGTGGCACGCTGG - Intergenic
1058974138 9:110110392-110110414 CTAGATCAGCAGTGCCACTGTGG - Intronic
1059712210 9:116878992-116879014 CCAGATCACCAGAGTCTCTCAGG - Intronic
1060861621 9:126959549-126959571 CCAGCTCAGCTGTTTCTCTAAGG + Intronic
1061844556 9:133379736-133379758 CCAGATCAACAGAGGGACTAGGG + Intronic
1062295325 9:135822239-135822261 TCAGATGAGCAGTGTCTCCATGG - Exonic
1062367128 9:136216128-136216150 CCAGATCAGCAGCTTCTCTGTGG - Intronic
1187606678 X:20892143-20892165 CCAGAACAGCTGTGGCAATAGGG - Intergenic
1187907570 X:24081902-24081924 CCAGACCAGCAGTGGCAACATGG + Intergenic
1192791258 X:74383762-74383784 CTAGATCAGCAGTGGCTGTGAGG + Intergenic
1192902369 X:75513538-75513560 CCAGATCAGTAGAGGCTGTGAGG + Intronic
1193240326 X:79161580-79161602 CCTGAACACCAGTGGCCCTATGG - Intergenic
1195675844 X:107506778-107506800 CCACCTCAGCCGCGGCTCTAGGG + Intergenic
1195950666 X:110269131-110269153 TCAGGTCAACAGTAGCTCTAGGG + Intronic
1197259650 X:124304641-124304663 CCAGATCAGCAGTGGCTCTAAGG - Intronic
1198385411 X:136124393-136124415 CCAGCCAAGCAGTGGCTCAAGGG - Intergenic
1201674008 Y:16558749-16558771 ACAGATCAGTAGTGGTTCTTGGG + Intergenic