ID: 1197260244

View in Genome Browser
Species Human (GRCh38)
Location X:124309529-124309551
Sequence CGTAGAGGATGTTCAACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 46}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197260244_1197260246 21 Left 1197260244 X:124309529-124309551 CCATTAGTTGAACATCCTCTACG 0: 1
1: 0
2: 2
3: 4
4: 46
Right 1197260246 X:124309573-124309595 TGTCCTGAGAATAACTTCAGAGG 0: 1
1: 0
2: 1
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197260244 Original CRISPR CGTAGAGGATGTTCAACTAA TGG (reversed) Intronic
907168208 1:52433924-52433946 TGTACAGGGTGTTCAACTGAGGG + Intronic
908830395 1:68172940-68172962 CTTAGAGGATGTTAAAGCAAAGG + Intronic
912627700 1:111219970-111219992 GGTAGAGGATGTGAAACTCAGGG + Intronic
917381996 1:174421598-174421620 AATAGAGAATGTTCAAATAAAGG - Intronic
918917031 1:190655530-190655552 GGTAGTGGATATTTAACTAATGG - Intergenic
919039298 1:192361931-192361953 CTCAGAGGATATTCAACTTAAGG + Intronic
1063325075 10:5091060-5091082 TGTAGAACATGTTCAAATAATGG + Intronic
1068209101 10:53897107-53897129 AGTTAATGATGTTCAACTAATGG + Intronic
1080671260 11:34380745-34380767 CCTAGAGGATCTTCAGCTAAAGG - Intergenic
1085322204 11:75582296-75582318 AGCAGAGGATGTTGAACTGATGG + Intergenic
1089820557 11:121222116-121222138 CATAGTGGATATTCAACAAATGG + Intergenic
1100110846 12:91240586-91240608 CGTTACGGATTTTCAACTAAGGG + Intergenic
1104234702 12:126922550-126922572 CGTAGATATTGTTCAATTAATGG - Intergenic
1106529336 13:30574415-30574437 CATAGATGATGTTCAATAAATGG + Intronic
1108211412 13:48143336-48143358 TGTAGATGATGTTTAAATAATGG + Intergenic
1111523495 13:89435424-89435446 TGTAGATTATGTTCAACAAATGG + Intergenic
1112273235 13:97989991-97990013 GGTAGATGATGTTCAACCTATGG + Intronic
1117208993 14:53476063-53476085 CTCTGAGGATGTTCATCTAATGG - Intergenic
1119362071 14:74059108-74059130 CGTAAAGGCAGTTGAACTAATGG + Exonic
1121550910 14:94799453-94799475 TGTAGAGGTTGTTCAACTAAAGG - Intergenic
1138989533 16:62374627-62374649 CTTAGAGAATGTACCACTAATGG + Intergenic
1145882228 17:28360687-28360709 CCTAGAGAATGTTGAACTAAAGG + Intronic
1151312208 17:73300208-73300230 AGTAGAGGATGTTCATCTCCAGG - Intronic
1156758667 18:40559739-40559761 GGCAGATGATGTTCAACTCATGG + Intergenic
1159109546 18:64041234-64041256 GGTAAAGGATGGTAAACTAATGG + Intergenic
1159312591 18:66728997-66729019 AATAGAGGAAGTTAAACTAATGG - Intergenic
1166030985 19:40127733-40127755 CCTAGAGGACATTCTACTAAGGG + Intergenic
926266308 2:11325199-11325221 GGTAGTGGATGTGCAACTCACGG - Intronic
945677424 2:212872296-212872318 CATAGAGAATATTCAACAAATGG + Intergenic
945735256 2:213590791-213590813 ATTAGTGGATATTCAACTAAAGG + Intronic
1169827000 20:9779766-9779788 AGTAGAAGATTTTCTACTAAAGG + Intronic
1170807416 20:19644704-19644726 GGTGGAGGAGGTTAAACTAATGG - Intronic
1180075895 21:45461758-45461780 CCTGGAGGATATTAAACTAAAGG - Intronic
949122454 3:403117-403139 CATACAGGCTGTTGAACTAAGGG + Intronic
951555928 3:23920798-23920820 TGTAGAGGTTGTTCAACTGAAGG + Exonic
956367938 3:68525059-68525081 CGTAGGGGATGTGCAGCTCAAGG + Intronic
956994024 3:74802748-74802770 TGTAGAGGGTGTTCAACAACTGG - Intergenic
964583914 3:158274407-158274429 TGTAGAGGTTGTTCAACTAAAGG - Intronic
979572048 4:122238837-122238859 AGGAGAGAATGTTCAACAAAGGG - Intronic
982376822 4:154700643-154700665 CCTGGAGGATGTTATACTAAGGG + Intronic
987998205 5:25313235-25313257 CTTACAGGATGTTGAACTAAGGG - Intergenic
996834313 5:127774492-127774514 AGAAGAGGATCTTCAACAAATGG - Intergenic
1000641807 5:163711963-163711985 TGTAGAGTATATTCAAATAAGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1028316818 7:89412594-89412616 AGTAGAGGCTGTGAAACTAAAGG - Intergenic
1029034729 7:97507287-97507309 TTTAGAGCATGTTCAACTTAGGG - Intergenic
1039253568 8:35693335-35693357 AGTAGTGGATGGGCAACTAAGGG - Intronic
1047944928 8:129866539-129866561 TATAGAGATTGTTCAACTAAAGG + Intronic
1049643684 8:143726774-143726796 CGAAGAGGAAGTCCAACTACAGG - Exonic
1053060811 9:35029910-35029932 GGTAAAGGATGTTCCAGTAAAGG - Intergenic
1059184290 9:112253160-112253182 ACTAGAAGATGTTCAACTAGAGG + Intronic
1194470827 X:94294086-94294108 CATAGAAGATGTTCAGCTACAGG + Intergenic
1197260244 X:124309529-124309551 CGTAGAGGATGTTCAACTAATGG - Intronic