ID: 1197261736

View in Genome Browser
Species Human (GRCh38)
Location X:124326926-124326948
Sequence CTGTGCTATCATATTTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197261731_1197261736 29 Left 1197261731 X:124326874-124326896 CCAAGAGAGAGAACCATCTTGTT 0: 1
1: 0
2: 0
3: 20
4: 195
Right 1197261736 X:124326926-124326948 CTGTGCTATCATATTTAAGATGG 0: 1
1: 0
2: 0
3: 11
4: 175
1197261735_1197261736 3 Left 1197261735 X:124326900-124326922 CCTCTCTTAGGCATCAATTGTCT 0: 1
1: 0
2: 0
3: 18
4: 146
Right 1197261736 X:124326926-124326948 CTGTGCTATCATATTTAAGATGG 0: 1
1: 0
2: 0
3: 11
4: 175
1197261732_1197261736 16 Left 1197261732 X:124326887-124326909 CCATCTTGTTTTCCCTCTCTTAG 0: 1
1: 0
2: 3
3: 58
4: 602
Right 1197261736 X:124326926-124326948 CTGTGCTATCATATTTAAGATGG 0: 1
1: 0
2: 0
3: 11
4: 175
1197261734_1197261736 4 Left 1197261734 X:124326899-124326921 CCCTCTCTTAGGCATCAATTGTC 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1197261736 X:124326926-124326948 CTGTGCTATCATATTTAAGATGG 0: 1
1: 0
2: 0
3: 11
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197261736 Original CRISPR CTGTGCTATCATATTTAAGA TGG Intronic
902986763 1:20159439-20159461 CTATGATATAATATTTAATAAGG - Intergenic
903406530 1:23101982-23102004 GGGTGCTATCTTATGTAAGATGG - Intronic
903543976 1:24112154-24112176 CAGTGCTGCTATATTTAAGACGG - Exonic
903843757 1:26264223-26264245 ATGGGCATTCATATTTAAGAAGG + Intronic
906078819 1:43070282-43070304 CTGTGCCCTCATCTGTAAGACGG - Intergenic
907573207 1:55503168-55503190 TTGTTCTATCTTATTCAAGATGG - Intergenic
908684685 1:66702412-66702434 CTGTTCTATCATTTTTAAAATGG + Intronic
909032103 1:70554563-70554585 CTGTGCCATCATTTTTAAAATGG - Intergenic
910078487 1:83309805-83309827 CTGTGCTAGTAAATTTAAAAAGG - Intergenic
911753522 1:101526127-101526149 CTGTGCTACCTCATTGAAGAGGG + Intergenic
912068844 1:105781600-105781622 CTGTCTTCTCATATTAAAGAAGG + Intergenic
912630047 1:111238986-111239008 CTCTGCTGTCAAATTGAAGATGG - Intronic
914688207 1:150001488-150001510 CTCTGCTATCTGATTTGAGATGG - Intronic
916832152 1:168504126-168504148 TTGTGGCATCATATTGAAGAAGG - Intergenic
918727619 1:187946285-187946307 GTGTGCTTTCATTTTTAAAAGGG - Intergenic
919001048 1:191831840-191831862 ATGTGTTAAGATATTTAAGAAGG - Intergenic
919611250 1:199748253-199748275 TTGTGCTAGCATATCAAAGAAGG - Intergenic
923077018 1:230618809-230618831 CTGTGCTCTAATATATGAGAAGG - Intergenic
924509740 1:244719809-244719831 CTGTGTTATCTTCTTTAACAAGG + Intergenic
924703186 1:246474925-246474947 CTGTGCTATCAGATTAAGGAGGG + Intronic
1071043894 10:81350123-81350145 CTTTGCAATCATTTTTAAGATGG + Intergenic
1071229241 10:83565351-83565373 CAGTTCTATCTTATTTAAGTTGG + Intergenic
1076657494 10:132034576-132034598 GTGTGCTTTCCTATTTAACAAGG + Intergenic
1078424113 11:11235413-11235435 CTCTGATATCTTATTTATGAGGG - Intergenic
1079104958 11:17564781-17564803 CTGTCTCATCATATTTAAAATGG - Intronic
1079846144 11:25471087-25471109 CAGTAACATCATATTTAAGATGG + Intergenic
1088440314 11:109863461-109863483 CTCTTCTAGCATAATTAAGAAGG + Intergenic
1090718117 11:129448235-129448257 TTTTGCTGTCATATCTAAGAAGG - Intronic
1093712049 12:22338620-22338642 CTCTCCCCTCATATTTAAGAAGG - Intronic
1096915059 12:55022696-55022718 CTCTTCCATCATATTCAAGATGG - Intronic
1098690059 12:73475851-73475873 ATATGTTATCATATATAAGAGGG - Intergenic
1099082123 12:78197671-78197693 CTGTGGTATAATATTAAAGAGGG - Intronic
1099294989 12:80819206-80819228 CTGTGCATACATATTTAGGATGG - Intronic
1099638223 12:85244662-85244684 TTGTGGTATCATTTTGAAGAAGG + Intronic
1103216652 12:119206945-119206967 CTGTGCTATCATTTATTAGCTGG + Intronic
1109405849 13:61898948-61898970 CTGTGCTATTTCATTTAAAATGG + Intergenic
1110523555 13:76508748-76508770 ATTTGCTATCATATTTACCAGGG + Intergenic
1111920397 13:94403870-94403892 TTGTGTTCTCATATTAAAGACGG - Exonic
1115356926 14:32458146-32458168 ATTTGCTTTCATTTTTAAGAAGG + Intronic
1115426479 14:33266230-33266252 CACTGCTATCATATATAAAAAGG - Intronic
1118626395 14:67663291-67663313 ACTTGCTATCATATTTTAGATGG - Intronic
1119180518 14:72601919-72601941 CTGTGCTATGAGAGTTCAGAAGG - Intergenic
1119462212 14:74816058-74816080 CTGTCCTTTCAAATTTATGAAGG + Intronic
1120411361 14:84161088-84161110 CTGTATTATCATATTTAATGTGG + Intergenic
1121617843 14:95325034-95325056 CTGTGCTGTCATCTGTAAAATGG + Intergenic
1122088618 14:99323453-99323475 CAGTGCTATCATCTGTAAAATGG + Intergenic
1124178104 15:27445711-27445733 CTTTGGTGTCATATCTAAGAGGG + Intronic
1129956827 15:79645325-79645347 CTCTTCTATTAAATTTAAGAGGG + Intergenic
1132208118 15:100000294-100000316 CTGTCTTCACATATTTAAGAAGG - Intronic
1132667243 16:1087433-1087455 CTGTGTTATGATATCTAATAGGG + Intergenic
1134437245 16:14271809-14271831 TTTTGTTGTCATATTTAAGAAGG - Intergenic
1135314173 16:21430210-21430232 CTGTGGTATCACTTTTATGATGG + Intronic
1135367096 16:21862488-21862510 CTGTGGTATCACTTTTATGATGG + Intronic
1135444718 16:22508672-22508694 CTGTGGTATCACTTTTATGATGG - Intronic
1135775418 16:25253708-25253730 CAGTCCTCTCATCTTTAAGAGGG - Intronic
1136310841 16:29408918-29408940 CTGTGGTATCACTTTTACGATGG + Intergenic
1136324284 16:29510695-29510717 CTGTGGTATCACTTTTATGATGG + Intergenic
1136438969 16:30250677-30250699 CTGTGGTATCACTTTTATGATGG + Intronic
1139121927 16:64030396-64030418 ATGTGCTTTTATATTTAAGGAGG + Intergenic
1140511218 16:75509827-75509849 CAGTCCTATCATATTTAACTTGG - Intergenic
1142399365 16:89851302-89851324 CTTTGGCATCATATTTCAGAAGG - Intronic
1151528758 17:74690442-74690464 CTGAGGAACCATATTTAAGATGG + Intronic
1157991303 18:52499667-52499689 CAGTGACCTCATATTTAAGATGG - Intronic
925073446 2:989718-989740 CTCTCCTATTATATTTTAGAAGG + Intronic
925841121 2:7993477-7993499 CTGTTCTATCAACTCTAAGATGG + Intergenic
927069106 2:19507321-19507343 CTGTGATAGCATACTAAAGATGG - Intergenic
927205198 2:20604621-20604643 CTGTGCTCTCATCTATAAAAAGG - Intronic
927301373 2:21519790-21519812 ATGTGCTATCATGTGTAAAAGGG + Intergenic
927436323 2:23069565-23069587 CTGTGCTCACATATATCAGATGG - Intergenic
928072305 2:28229322-28229344 CCGTGCTCTCATCTGTAAGATGG + Intronic
929422073 2:41802127-41802149 CTGTGTTATTATATTTAAAGTGG + Intergenic
930103519 2:47620868-47620890 CTGTGTTTTCATCTGTAAGAAGG - Intergenic
931133132 2:59362170-59362192 CTATGCTATCATACTTCACAGGG - Intergenic
938237777 2:129720712-129720734 CAGTGTGGTCATATTTAAGATGG - Intergenic
939260303 2:139799480-139799502 CTGTTCTAAGATTTTTAAGAAGG + Intergenic
942639591 2:178047755-178047777 CTGTGTTTTCATAATTAACATGG + Intronic
943041010 2:182805067-182805089 CTATACTATCATATTTGAGATGG - Intergenic
944720644 2:202420319-202420341 CTATACTATCTTATTTAATAAGG - Intronic
947277704 2:228412299-228412321 GTGTGTTATTATATTGAAGATGG + Intergenic
1172023020 20:31928149-31928171 CTGTGCAAACATTTTTAAGTGGG - Intronic
1173980484 20:47220211-47220233 CGGTGCTTTCACATTTCAGATGG - Intronic
1175146968 20:56904321-56904343 CTGAGCTATCATACTCAGGATGG + Intergenic
1175406635 20:58737196-58737218 CTGTGCTATATTATTTAATCTGG - Intergenic
1175582137 20:60108195-60108217 CTGTGCTAACATGATTCAGATGG + Intergenic
1175886506 20:62294363-62294385 CTGTTTTATCATAATTTAGAAGG - Exonic
1177067133 21:16453689-16453711 ATGTGCTTTCATGTTTAATAGGG + Intergenic
1177849694 21:26331863-26331885 CTGTCCTCTCAAATTTAAAAAGG - Intergenic
1178332544 21:31711523-31711545 CAGTGCTATCATCTGTAAAATGG - Intronic
1184832544 22:46998173-46998195 TTGTGCTTTCATGTTTAAGTGGG + Intronic
949239078 3:1848213-1848235 CTGTTCTATCTTTTTAAAGAAGG + Intergenic
951169236 3:19519801-19519823 CTTTCCTCTCATATTTGAGAAGG + Intronic
951867880 3:27327641-27327663 CTGTGCTATTATAATGAAGCAGG + Intronic
952174768 3:30849939-30849961 CTGAGAAAGCATATTTAAGAGGG - Intronic
954722178 3:52574205-52574227 CTATGTCATCATATTTCAGAAGG + Intronic
954767608 3:52933831-52933853 TTTTGGTATCATATCTAAGAAGG - Intronic
956428412 3:69160196-69160218 CTGTGTTATTATATATAACATGG + Intergenic
956568477 3:70666736-70666758 ATGTGGTATAATATTTCAGAGGG + Intergenic
958517613 3:95138677-95138699 CTGTGCTGTCAAATTGAAAACGG - Intergenic
958809371 3:98842058-98842080 CTGTGCTTTCTTTTTTGAGATGG - Intronic
961627639 3:128274836-128274858 CTGTTCTTACTTATTTAAGAAGG - Intronic
962476832 3:135762456-135762478 CTGTGCCAAGATATTGAAGAGGG + Intergenic
962679155 3:137780924-137780946 CTTTCCTATGATATTTAAGCTGG + Intergenic
965429259 3:168566533-168566555 CTGTGCTCTCTTACTAAAGAAGG - Intergenic
965459354 3:168942676-168942698 CTGTGCCATTATATTTAAAGTGG - Intergenic
966314358 3:178629060-178629082 CTTTTCTATAATATTTAAAATGG + Intronic
966841058 3:184087932-184087954 CTGGAGTATCATATTTCAGAAGG - Intergenic
967535719 3:190600578-190600600 CTGTGCTTTCATATTTGCCAAGG + Intronic
970290160 4:14563254-14563276 CTTTGTTATTACATTTAAGAAGG - Intergenic
971015367 4:22483594-22483616 TTTTGCTATCAGTTTTAAGATGG - Intronic
975556299 4:75668942-75668964 CTGAGTTATAATATTTGAGAGGG - Intronic
976382501 4:84415771-84415793 CTGTGCTATGTTATTTCAGTGGG + Intergenic
977004465 4:91547560-91547582 ATGTGCCTTCATATTTAAAATGG + Intronic
977334417 4:95678241-95678263 ATGTCCTATGATATTAAAGAAGG - Intergenic
979650025 4:123117765-123117787 CTTTGCTTCCATGTTTAAGAAGG + Intronic
981627584 4:146776730-146776752 CTGTGCTAGCATACTTGAGCAGG - Intronic
982420603 4:155192251-155192273 CTGTGGTTTTATATTTAAGAAGG + Intergenic
983849684 4:172565077-172565099 CTGTGCTCTCACATGGAAGAAGG + Intronic
984383420 4:179025266-179025288 CTGTCCTTACATATTTAAGTGGG + Intergenic
996113685 5:119595064-119595086 CTGTGCTAACATTTCTAAAATGG + Intronic
996169908 5:120276798-120276820 GTGTGCTACCATATTTGGGAGGG + Intergenic
997492765 5:134292777-134292799 CTTTGTTATCATTTTTAAGTTGG - Intronic
998825795 5:146099931-146099953 ATGTGCTATCATCTTTGGGAAGG - Intronic
999096476 5:148982653-148982675 GTATGCTATAATATTTAAAATGG + Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000859604 5:166440428-166440450 TTTTGGTGTCATATTTAAGAAGG + Intergenic
1001342501 5:170861192-170861214 CTGTGCTGTAGTATTTAAGAGGG - Intergenic
1006682558 6:35807573-35807595 AAGTGCTGTCATCTTTAAGAGGG + Intronic
1007987210 6:46218718-46218740 CTGTGCTCTCTCATTTAAAAAGG + Intergenic
1008802552 6:55387559-55387581 CTGGGATATCATCTTAAAGAGGG + Intronic
1009606591 6:65877616-65877638 CTAAGCTATCTTATTTAAAATGG + Intergenic
1010785579 6:79995972-79995994 TTGTGCCTTCATATTTAAAAAGG + Intergenic
1011919452 6:92553986-92554008 CTGCATTATCATATTTTAGATGG + Intergenic
1014607890 6:123500477-123500499 TTCTGCTATAATATTTAAGTTGG - Intronic
1015643114 6:135358709-135358731 CTGTGTTATCATTTTAAAGGAGG - Intronic
1017185260 6:151594307-151594329 CTGTTTCCTCATATTTAAGATGG + Intronic
1018239449 6:161758713-161758735 CTGATCTATCATCTTTAAGTGGG - Intronic
1020842384 7:13234938-13234960 CTATGCTATCATTTTTTTGAAGG - Intergenic
1021058774 7:16083437-16083459 TTGTGCTATCTTTTTTAAGAGGG + Intergenic
1021511422 7:21436917-21436939 CTTTGCCATCAAATATAAGAGGG - Intronic
1025952900 7:66159507-66159529 CTATTCAAGCATATTTAAGATGG - Intergenic
1027296268 7:76775074-76775096 CTGTGCTAGTAAATTTAAAAAGG - Intergenic
1028777558 7:94696158-94696180 CTGTGTCTTCATATTTAAGGTGG + Intergenic
1031199627 7:118663968-118663990 CTTTGCTATTGTGTTTAAGAAGG - Intergenic
1034092897 7:148380820-148380842 CTGTGCTCTAATATTGAAGCAGG + Intronic
1034495031 7:151415346-151415368 CTGGGCCATCATTTTTAAAATGG + Intergenic
1034984460 7:155499137-155499159 CTGTGCTATTATGCTTTAGAGGG + Intronic
1035008846 7:155693220-155693242 CTGTCTTTTCATATTTAAAAAGG - Intronic
1036787202 8:11695973-11695995 CTTTTCTAACATATTTTAGATGG + Intronic
1038014816 8:23505382-23505404 CTCTGTTTTCATATTTAAAATGG + Intergenic
1039783364 8:40810325-40810347 CTGTGCTTTAATATCTGAGAGGG - Intronic
1043033116 8:75164170-75164192 CTGAGCTATCACCTTTGAGATGG - Intergenic
1043575230 8:81649003-81649025 CCTTGCTATCATATTTACTAAGG - Intergenic
1045661044 8:104437965-104437987 CTGTGCCTTCATAATTCAGAAGG + Intronic
1045911962 8:107420525-107420547 TTGTTCTATCAAATTTATGATGG - Intronic
1047085756 8:121513585-121513607 CTGTGGTATTATATATAATAAGG - Intergenic
1048876954 8:138844212-138844234 GTGTGCTGTCATATTTCACAGGG - Intronic
1049941223 9:548031-548053 ATATGCTATCATAGTTATGAAGG - Intronic
1050380705 9:5025344-5025366 CTGTGATAGTATACTTAAGATGG + Intronic
1050778624 9:9301408-9301430 CTGTGCCACCATCTTTATGATGG - Intronic
1050821392 9:9884429-9884451 CTCTGCTATAATATTGAGGAAGG - Intronic
1051783266 9:20713449-20713471 CTGGACTACCATATTTAAAATGG + Intronic
1056195276 9:84222766-84222788 CAGTTTTATCATATGTAAGATGG + Intergenic
1059187317 9:112286188-112286210 CTGAGATTTCATATTTAAAATGG + Intronic
1059212477 9:112526646-112526668 CTGTGTTATCACATGTCAGAAGG + Intronic
1060014145 9:120071753-120071775 CTGTCCTCTCATCTGTAAGATGG - Intergenic
1203488470 Un_GL000224v1:80870-80892 CTGAAATCTCATATTTAAGAAGG + Intergenic
1203501091 Un_KI270741v1:22766-22788 CTGAAATCTCATATTTAAGAAGG + Intergenic
1186309093 X:8297998-8298020 CTGCCCTATCATTTTTAAGCAGG - Intergenic
1187663422 X:21575294-21575316 TTTTGCTTTCATATTTAGGAAGG + Intronic
1187836983 X:23442007-23442029 CTGTGGTATAATATATATGATGG + Intergenic
1187930438 X:24288811-24288833 CTCTGCTGACATCTTTAAGAGGG + Intergenic
1188169553 X:26907152-26907174 CTGTGCTTTTATATTTAAAGTGG - Intergenic
1188379652 X:29475536-29475558 CCTTCCTATCATATTTAAGCAGG - Intronic
1188418470 X:29967543-29967565 TTGTACTTTCATGTTTAAGAGGG + Intergenic
1189263754 X:39697892-39697914 CTGTGCTCTAATGTTTAAGTTGG - Intergenic
1189892316 X:45616570-45616592 TTGTGATTTCATATCTAAGAAGG + Intergenic
1192351288 X:70358717-70358739 CTATCCATTCATATTTAAGAGGG + Intronic
1194786876 X:98096642-98096664 TTGGGCTATTATATTTAAAAAGG - Intergenic
1197261736 X:124326926-124326948 CTGTGCTATCATATTTAAGATGG + Intronic
1197405605 X:126044492-126044514 CTATGCTATTATATTTAAATAGG + Intergenic
1197419594 X:126222276-126222298 TTGTGCTATGATATTTATGATGG + Intergenic
1197462470 X:126759308-126759330 CTTTGCTATTATTTTTAACAGGG - Intergenic
1198824417 X:140684207-140684229 CTCAGCTATCATATTGAAAAAGG - Intergenic
1200276029 X:154733625-154733647 CTCTGCTATCATGTTTAGAAAGG + Intronic
1201270456 Y:12248995-12249017 CTGTGATATAATATTTCATAAGG - Intergenic
1201382487 Y:13398314-13398336 CTGTGTTATAATATTTAAGTTGG + Intronic
1201680405 Y:16639071-16639093 CTGTGATATAATATTTCATAAGG + Intergenic