ID: 1197262765

View in Genome Browser
Species Human (GRCh38)
Location X:124334612-124334634
Sequence GCCCCAGGACACTCCCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 2, 1: 1, 2: 3, 3: 27, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197262754_1197262765 26 Left 1197262754 X:124334563-124334585 CCACCCTGGTGTTTAGCAGGAGC 0: 3
1: 0
2: 2
3: 6
4: 133
Right 1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG 0: 2
1: 1
2: 3
3: 27
4: 254
1197262755_1197262765 23 Left 1197262755 X:124334566-124334588 CCCTGGTGTTTAGCAGGAGCTGC 0: 3
1: 0
2: 1
3: 9
4: 167
Right 1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG 0: 2
1: 1
2: 3
3: 27
4: 254
1197262756_1197262765 22 Left 1197262756 X:124334567-124334589 CCTGGTGTTTAGCAGGAGCTGCA 0: 3
1: 0
2: 2
3: 11
4: 182
Right 1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG 0: 2
1: 1
2: 3
3: 27
4: 254
1197262759_1197262765 -3 Left 1197262759 X:124334592-124334614 CCAGAAGAAGGTCCAGAGAGGCC 0: 3
1: 0
2: 1
3: 28
4: 185
Right 1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG 0: 2
1: 1
2: 3
3: 27
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197262765 Original CRISPR GCCCCAGGACACTCCCCTGG GGG Intronic
900031359 1:375263-375285 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900051911 1:603463-603485 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900151097 1:1179716-1179738 GCACCAGGCCACTGCCCTGTTGG + Exonic
900172160 1:1274347-1274369 GCCGCAGCACCCTCCCCTGCAGG + Intergenic
900294438 1:1941894-1941916 GCCCCAGAACACATCCCTGGAGG + Intronic
900320274 1:2080075-2080097 GGCCCAGTACAGTCTCCTGGTGG + Intronic
900642863 1:3695643-3695665 GCCCCAGGGCCCTGTCCTGGAGG - Intronic
900903651 1:5535247-5535269 GCCACAGGACACAGGCCTGGAGG - Intergenic
901438558 1:9263982-9264004 GCCCCACGCCTCTACCCTGGAGG + Exonic
901462211 1:9398486-9398508 GCCCCAGGCCCCTGCCCTCGTGG - Intergenic
901639103 1:10684388-10684410 GCCCCAGCACACGCGCCTAGTGG + Intronic
902088189 1:13879498-13879520 GCCCCAGGAGACTCACTGGGGGG + Intergenic
902376341 1:16031761-16031783 GGCCAAGGACACGCCGCTGGAGG + Exonic
903263470 1:22143231-22143253 GGCCCGGGACACCCCCCCGGGGG + Intronic
903579234 1:24358466-24358488 TCCCCAGGACATTCCTCAGGAGG - Exonic
904006141 1:27364247-27364269 GGCCCTGCTCACTCCCCTGGTGG - Exonic
904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG + Intronic
906534419 1:46543830-46543852 GTCCGTGGACACTCCCCTGCGGG + Intergenic
908796992 1:67840017-67840039 CCCCCAGCACCCTCCCCTGAGGG - Intergenic
913673041 1:121116108-121116130 GGCACAGGACAGTCCTCTGGGGG - Intergenic
914024818 1:143903469-143903491 GGCACAGGACAGTCCTCTGGGGG - Intergenic
914250821 1:145919894-145919916 GTCCTAGGTCACTCACCTGGGGG - Intergenic
914663248 1:149811189-149811211 GGCACAGGACAGTCCTCTGGGGG - Intronic
914863758 1:151408227-151408249 GGCCCATGACACTCCTGTGGGGG + Exonic
915498171 1:156295510-156295532 GCCCCAGGGCCCTCACCTGGCGG + Exonic
916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG + Intergenic
917963772 1:180166020-180166042 GCCCCAGGAAACTTCCCTAAGGG + Intronic
919877325 1:201879412-201879434 GGCCAAGGACACAGCCCTGGGGG - Exonic
922163196 1:223093531-223093553 GCCCCTGGACAGTCCCAAGGGGG + Intergenic
922818660 1:228469634-228469656 GCCCCAGGAGTCGCCCCTGATGG - Intergenic
923557562 1:235012771-235012793 TCTCCAGGACACTCCACTGGTGG + Intergenic
1063129264 10:3163469-3163491 GGGCCAGGACCCTCCTCTGGGGG + Intronic
1063377056 10:5560821-5560843 GGCCCAGGACCATCCTCTGGGGG - Intergenic
1067064156 10:43094217-43094239 GCCCCAGGGCTCCTCCCTGGGGG - Intronic
1067708168 10:48626675-48626697 TCCCCAGGACACTCATGTGGAGG + Intronic
1067770138 10:49116660-49116682 GCCCCAGGGCATTCCCCAGAGGG + Intergenic
1069633937 10:69913987-69914009 GCCCCAGGAGCCTCCTCGGGAGG - Intronic
1069822042 10:71234272-71234294 GCCCCAGCAAAAGCCCCTGGAGG - Intronic
1069847744 10:71384442-71384464 GCCACAGGAAAATCCCCTGCAGG - Intergenic
1071496548 10:86171254-86171276 GCCCCAGGTCCCTTCCCTAGTGG - Intronic
1072611593 10:97020784-97020806 GCCCCGGGACCCTCCACTGTGGG - Intronic
1075319351 10:121477575-121477597 ACCCTAGGCCACTCCCCTGATGG + Intergenic
1075989870 10:126826363-126826385 GCCCCATGGCTCACCCCTGGTGG + Intergenic
1076354416 10:129841649-129841671 GGCCCAGGACACTGCACTGTGGG + Intronic
1076826855 10:132973623-132973645 GCCCCTGCACACTCCCCAGAGGG - Intergenic
1076831384 10:132996120-132996142 GCCCCTGGACACACCCCAGGTGG - Intergenic
1076868710 10:133182261-133182283 GCCCCAGGCCTCTCCCTGGGTGG - Intronic
1077331038 11:1983908-1983930 GCCCCAGGACACTATCCCCGGGG + Intronic
1077382243 11:2249642-2249664 GCCCCAGCACAGCCCCCAGGTGG + Intergenic
1077419195 11:2441640-2441662 GGCCCAGGAGACAGCCCTGGGGG + Intergenic
1077578965 11:3404771-3404793 GGCCCAAGACACTCCCCCCGAGG - Intergenic
1078139078 11:8678879-8678901 GCCCCAGGCCTCTCTCCAGGTGG - Intergenic
1081534089 11:43984905-43984927 GCCCAGGGCCACTCCTCTGGTGG - Intergenic
1082235989 11:49820822-49820844 ACCCCAGGACACCCCCCTCAAGG - Intergenic
1082242700 11:49888974-49888996 ACCCCAGGACACCCCCCTCAAGG + Intergenic
1082609497 11:55280750-55280772 ACCCCAGGACACCCCCCTCAAGG - Intergenic
1082657192 11:55869783-55869805 ACCCCAGGACACCCCCCTCAAGG + Intergenic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1083372381 11:62192565-62192587 GCCTCAGGAAAGTCCCCAGGTGG - Intronic
1083896156 11:65620782-65620804 GCCCCAGGGCTCGCCCGTGGGGG + Intronic
1084767193 11:71320315-71320337 GGCCCAGGTCATCCCCCTGGTGG + Intergenic
1085197159 11:74679692-74679714 GCCCCAGGCCAGATCCCTGGAGG + Intergenic
1089213107 11:116819693-116819715 GCCCCAGGACACCCTCCAAGGGG + Intergenic
1090281052 11:125456155-125456177 GCCCCAGGAGCCTCCCCAGCGGG - Intronic
1090774196 11:129948635-129948657 GGCCCAGGACTTTCCTCTGGAGG + Intronic
1091314121 11:134598695-134598717 GGCCCTGGTCACTCCCCTTGGGG + Intergenic
1202814019 11_KI270721v1_random:39084-39106 GCCCCAGGACACTATCCCCGGGG + Intergenic
1091400788 12:179443-179465 GCCCCAGGACACTCGCAGAGAGG + Intergenic
1091973976 12:4810377-4810399 GCCCCTGGACATTTTCCTGGAGG + Exonic
1092050806 12:5468731-5468753 GACACAGGACACTCTGCTGGGGG + Intronic
1092234478 12:6797601-6797623 GCCCCACCACATTCCCCTCGCGG - Intronic
1092276797 12:7067577-7067599 GCCCCATGACTCTTCCTTGGAGG + Intronic
1092589925 12:9943422-9943444 GGCACATGACACGCCCCTGGGGG - Intergenic
1096499381 12:52055784-52055806 TCCCCAGGACACACTACTGGGGG - Intronic
1096862455 12:54539719-54539741 GCCCCAGAACACTCTACTAGAGG - Intronic
1101443239 12:104719116-104719138 CCCCCAGGACTCTGCCTTGGTGG + Intronic
1102229894 12:111255418-111255440 GCCCCAGCAGACACACCTGGAGG + Intronic
1102510742 12:113413753-113413775 CCCCCGGGACACTTCCCTGGAGG - Intronic
1102926386 12:116829382-116829404 GCCCCAGAAACATCCCCTGGAGG - Intronic
1103944820 12:124520145-124520167 TCCCCAGGAAACACCCCTGGGGG + Intronic
1104087934 12:125493083-125493105 GCGCCAGGCCACTGCCCTGCAGG - Intronic
1104283787 12:127404432-127404454 GCACCAGGTCAGTCCCTTGGAGG + Intergenic
1106598903 13:31170632-31170654 GACCCAGAACTCTTCCCTGGGGG + Intergenic
1106605437 13:31224136-31224158 ACCCCAAAACACTCCCCTGTGGG - Intronic
1106766215 13:32916503-32916525 GACACAGGACAGTCTCCTGGCGG - Intergenic
1107959083 13:45543086-45543108 GCCCCGGGACACCTCTCTGGTGG + Intronic
1111979769 13:95003351-95003373 GCCACAGAACAATCCCCTTGGGG + Intergenic
1113848874 13:113406955-113406977 TCCCCTGCACACTCGCCTGGGGG + Intergenic
1119166831 14:72501637-72501659 TCCCTGGGACACTCTCCTGGTGG - Intronic
1121570806 14:94945236-94945258 GCCGCAGGCCACTGCCCTCGAGG - Intergenic
1121637346 14:95462595-95462617 GCCCCAGGACACTGCCAGGCGGG + Intronic
1122088415 14:99322558-99322580 TCCCCAGGAATCTCCCCTGCAGG - Intergenic
1122599128 14:102912571-102912593 GCCCCAGGACACAGCCTTGCTGG + Intergenic
1124414864 15:29466568-29466590 TCCCCTGGGCTCTCCCCTGGGGG - Intronic
1124414893 15:29466636-29466658 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124414962 15:29466805-29466827 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124414977 15:29466839-29466861 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124415019 15:29466941-29466963 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124455680 15:29840617-29840639 GCCCCAGGACACGCCTCCTGAGG + Intronic
1129678313 15:77644051-77644073 TCACAAGGACTCTCCCCTGGAGG - Intronic
1129885299 15:79032865-79032887 GGCCTAGGACACTCCCCAAGAGG + Intronic
1130875402 15:88009601-88009623 GCCACAGGACACACCCCTATAGG + Intronic
1132244277 15:100281817-100281839 GGGACAGGACACTCCCCTGGGGG + Intronic
1132600492 16:770656-770678 CCCCCAGGCGGCTCCCCTGGTGG - Exonic
1132865735 16:2091891-2091913 GCCCCAGGACCATGCCCTGCCGG + Exonic
1132933912 16:2471646-2471668 GCCCCAAGACGCTGCCCTTGGGG - Exonic
1133770401 16:8864418-8864440 GCCCCAGGACACTGCTGTGGTGG - Intronic
1134028961 16:10976748-10976770 CCCCCAGGCCCCTGCCCTGGAGG - Intronic
1134034004 16:11015760-11015782 GCCCCAGCACCCTGGCCTGGAGG - Intronic
1134096824 16:11423915-11423937 GCCCCAGCACCAGCCCCTGGCGG + Intronic
1136025299 16:27464677-27464699 CCCCCAGGCCAGACCCCTGGAGG - Exonic
1136117154 16:28101723-28101745 GACCCGGGACAGGCCCCTGGGGG - Intronic
1141050758 16:80761214-80761236 GCCCCACCAGAATCCCCTGGCGG - Intronic
1141666146 16:85466349-85466371 GCCCCTGCCCACTCCCCAGGGGG - Intergenic
1141710584 16:85696693-85696715 GCAGCAGGAGACTCACCTGGAGG + Intronic
1141911301 16:87060179-87060201 TCCCCAGCACCCTCTCCTGGAGG + Intergenic
1142222089 16:88860545-88860567 GCCCCAAGACAGTGTCCTGGTGG - Intronic
1142347873 16:89565580-89565602 GGCCCAGGATACCCCGCTGGTGG + Exonic
1142549489 17:729477-729499 GCCCCAGGTCACACTGCTGGTGG - Intergenic
1143586420 17:7852894-7852916 GCCCCAGGGCCCTCCCCTAGGGG - Intronic
1143598310 17:7928854-7928876 ACCCAAGGACACTCCACTGGAGG + Intronic
1144494434 17:15737496-15737518 GCCCCACGTCAGTGCCCTGGAGG + Exonic
1144773981 17:17774974-17774996 GCCCCAAGACTCTGCCCTGAAGG - Intronic
1144860090 17:18296151-18296173 GCCCCAGTAAATTCTCCTGGAGG + Intronic
1147317899 17:39629556-39629578 GCCCCAGGAAACTCACCTGGTGG - Exonic
1147720327 17:42536122-42536144 GTACCAGGATACTCCCTTGGGGG - Intergenic
1148915674 17:50975869-50975891 GCCCCAGTAAACGTCCCTGGTGG + Intronic
1150010237 17:61496394-61496416 GCCCTTGGAAACTACCCTGGGGG + Intergenic
1152198314 17:78930347-78930369 TGCCCTGGACACTCCCCTGAGGG - Intergenic
1152419102 17:80182560-80182582 GCCCCAGGCCTCTCCCCCGTGGG + Intronic
1152561516 17:81081180-81081202 ACCGCAGGACAGTTCCCTGGAGG + Intronic
1152579872 17:81161125-81161147 GTCCCAGGACACACATCTGGGGG - Intronic
1152928768 17:83099669-83099691 GCCCCAGGCCGCTCCTCAGGTGG - Intergenic
1152948294 17:83210450-83210472 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1152997922 18:425452-425474 GGCCCAGCACACTCCCCTCCTGG - Intronic
1153493062 18:5669757-5669779 GCTCCAGGACACGCCACAGGGGG - Intergenic
1157544113 18:48535990-48536012 GCCCCAGGCCTCCCACCTGGGGG + Intergenic
1163533286 19:17863034-17863056 GCCCTGGGGGACTCCCCTGGAGG + Intronic
1165059487 19:33198137-33198159 GCCCCAGGACACCCTCCTGCTGG + Intronic
1165274181 19:34734000-34734022 GCCCCAGGACACTTCCCGCATGG + Intergenic
1165365480 19:35362545-35362567 TCCCCACCACACTCCCCAGGAGG + Intergenic
1165860278 19:38905718-38905740 GACCCAGGACCCCCACCTGGAGG + Intronic
1166276762 19:41759137-41759159 TCCCCAGGACCTTCCCCAGGTGG + Intronic
1168314146 19:55476753-55476775 GCCCCAGGACCTTCCCGCGGGGG - Exonic
926192876 2:10741673-10741695 GCCCCAGGTCACTTCACTGGTGG - Intronic
930772484 2:55141762-55141784 GCCCCAGGAAACTCTCCCAGTGG + Intergenic
932217837 2:69978267-69978289 CCCCAAGGAGACTCCCCTGGAGG - Intergenic
933903023 2:86862527-86862549 GCCCCAGGGCACTCGCCGGCAGG - Intergenic
934521469 2:95022688-95022710 GCCCCAGGCACCTGCCCTGGTGG - Intergenic
934809974 2:97269692-97269714 GCCCCAGAACACTACCGGGGTGG - Intergenic
934827718 2:97438247-97438269 GCCCCAGAACACTACCGGGGTGG + Intergenic
935777524 2:106486743-106486765 GCCCCAGGGCACTCGCCGGCAGG + Intergenic
936078775 2:109418294-109418316 GCCTCAGGACACTCCATTAGAGG - Intronic
937253585 2:120539723-120539745 GCCCTAGGTCACTCGGCTGGTGG - Intergenic
937901002 2:127019048-127019070 GCCCCAGAGCAATCCCTTGGGGG + Intergenic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
947534728 2:230933508-230933530 GCCACAGGCCAGTCCCCAGGTGG - Intronic
948223820 2:236293468-236293490 GCCCCAGGAGAGACACCTGGGGG - Intergenic
948253744 2:236551314-236551336 GCCTCAGGAGACCCCACTGGTGG + Intergenic
948807550 2:240459553-240459575 GCCCCAGGCCACTGCCCCTGGGG + Intronic
948857578 2:240737187-240737209 GCCACAGGTCACTTCCCAGGGGG + Intronic
948863788 2:240765381-240765403 GGCCCAGGACTCTGCCCTGTCGG - Intronic
948891638 2:240909686-240909708 TCCCCAGGAAACTCATCTGGAGG + Intergenic
948981089 2:241495231-241495253 CGGCCAGGACACTCCTCTGGGGG + Exonic
948993439 2:241565748-241565770 GCCCCAGGAGACTCCCACGAAGG + Intronic
949034753 2:241811314-241811336 GACCCTGGACACTCCCACGGTGG - Exonic
1168765949 20:381601-381623 CACCCAGGACTCTCCCCTGCGGG - Intronic
1169802255 20:9522332-9522354 GCCACAGGACGCTCTACTGGGGG - Intronic
1171414038 20:24965522-24965544 GTGCCAGGCCACTCCCCTGCAGG - Intronic
1173896129 20:46552021-46552043 GCCGCAGGACATTCCCCTTCAGG - Intergenic
1174048204 20:47748600-47748622 ACCCCAGGGCACTGGCCTGGAGG + Intronic
1174576698 20:51542435-51542457 GCCCCAGGCCACGAGCCTGGGGG - Exonic
1175152221 20:56944033-56944055 GCACCAGTACACTCTCCTTGTGG - Intergenic
1176059663 20:63167021-63167043 GCACCCGGCCACTCCCCTGGAGG + Intergenic
1176150576 20:63588840-63588862 GCCCCAGGACCCTGGCCTGGAGG + Exonic
1176200416 20:63857906-63857928 ATCCCAGTACACACCCCTGGGGG - Intergenic
1178387193 21:32162331-32162353 GCCCCTGGCCACTCCCCTAATGG + Intergenic
1178588732 21:33891538-33891560 ACCCCAGAATACTCCCCTGGAGG - Exonic
1179607249 21:42524875-42524897 GCCCCAGGACAACCTCCTGGGGG + Intronic
1179818011 21:43920500-43920522 GCTCCAGGACAGCCTCCTGGGGG + Intronic
1179967385 21:44815378-44815400 GCCCCAGGACACGCACCTTCAGG - Intronic
1180247610 21:46558387-46558409 GCCCCAGGCACCTCACCTGGAGG - Exonic
1181473894 22:23157006-23157028 GGCCCTGGTCACACCCCTGGGGG + Intronic
1183485298 22:38085038-38085060 GCTCCAGGACTCTCCCTGGGGGG - Exonic
1185060902 22:48606210-48606232 GCCCCAGGACAAATTCCTGGAGG - Intronic
1185348059 22:50319300-50319322 GCCCCGGGCAACTCCCCTGCCGG + Intronic
1185368017 22:50445817-50445839 GGGCCAAGACCCTCCCCTGGTGG - Exonic
951659374 3:25045481-25045503 GAAACAGGACACTCCTCTGGAGG - Intergenic
952819150 3:37471047-37471069 GCCCCAGGAGACTTCACTGAAGG - Exonic
953137269 3:40192007-40192029 GCTCAAGGTCACTCCCCAGGAGG - Intronic
953719368 3:45341871-45341893 GCCCCAGGTCACTGCCCTGGAGG + Intergenic
954126830 3:48536263-48536285 GACCCAGGACTGTCCCCTCGGGG - Exonic
954274214 3:49531959-49531981 GCCACGGGGCACTCCACTGGTGG - Exonic
955412457 3:58664737-58664759 TCCCCAGGCCACACCCTTGGGGG + Intronic
958925173 3:100149696-100149718 TCCCCAGGAGACTCACCTCGAGG + Intronic
960269520 3:115658820-115658842 GCCCCAGGTCTCTCCGCGGGAGG + Intronic
960953476 3:123014564-123014586 GCCCCTGGACACTTCCCTGCAGG - Intronic
961389471 3:126543809-126543831 GCCTCTGGACACAGCCCTGGGGG - Intronic
961437269 3:126928005-126928027 TCCTGAGGACACTGCCCTGGGGG + Intronic
961479072 3:127167883-127167905 GCCCCTGGCCATTTCCCTGGTGG + Intergenic
965600419 3:170448632-170448654 GGCCCAGCACCCTCCCTTGGAGG - Intronic
968620306 4:1600954-1600976 GCCCCAGGGCCCAGCCCTGGAGG + Intergenic
968886965 4:3340294-3340316 GTCCCATGGCAGTCCCCTGGGGG + Intronic
969336884 4:6516254-6516276 TCCCCAGAACCCTGCCCTGGGGG + Intronic
969492838 4:7509771-7509793 GCCCCAGAACACAGCCCCGGTGG - Intronic
969511023 4:7618075-7618097 GCCCCATGACACCCCCTCGGAGG + Intronic
969712879 4:8854203-8854225 GCCCCTGAGCACTTCCCTGGAGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
979683493 4:123486066-123486088 GCTCCAAGACCCTCTCCTGGTGG - Intergenic
982321049 4:154077912-154077934 GCCCCAAGTCACTCCCAGGGTGG + Intergenic
984140785 4:176002001-176002023 GCCCCAGGACCCAAGCCTGGGGG - Intronic
985574683 5:668515-668537 GCCCCTGCACACTCTCCAGGGGG + Intronic
985832301 5:2242713-2242735 GCCCCAGGGTCCTGCCCTGGAGG + Intergenic
985954334 5:3252046-3252068 GCCACAGGACAGTGCTCTGGGGG - Intergenic
988738575 5:34047105-34047127 GCCCCAGGCAACCTCCCTGGAGG + Intronic
989195719 5:38714342-38714364 CCCCCAGGACACCACCCTGTGGG + Intergenic
992085908 5:73278280-73278302 GCCCCAGGCCCCTCCCTCGGTGG + Intergenic
998332932 5:141345506-141345528 GACCGAGGACACTCTCCAGGGGG + Exonic
999132436 5:149294755-149294777 GGCCCAGAGCACTCCACTGGAGG + Intronic
1001398705 5:171434125-171434147 GCCCCAGGCCACTGCCTTGCGGG - Intronic
1002062019 5:176630633-176630655 GGCCCGGGACGCGCCCCTGGGGG + Intergenic
1002194292 5:177493854-177493876 GCCCCAGGAGGCTCCTCAGGTGG + Intronic
1002742461 5:181443605-181443627 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1006439482 6:34045114-34045136 GACCTAGGTGACTCCCCTGGCGG + Intronic
1006512793 6:34530595-34530617 GCCCCAGGAAGCTCCACAGGAGG - Intronic
1007122662 6:39396340-39396362 CCCCCATGCCACTCCCATGGAGG - Intronic
1007713318 6:43838531-43838553 GCCCCAGGTCACTTTCCTGCTGG + Intergenic
1009750121 6:67871353-67871375 GCCCCAGGTCACTCCCCTCCAGG + Intergenic
1009750392 6:67873008-67873030 GCCCCAGGTCACTCCCCTCCAGG - Intergenic
1010444608 6:75936097-75936119 GCCTCAGGACAGTGCCCTAGCGG + Intronic
1011664656 6:89622488-89622510 TCCCCATGAGAATCCCCTGGAGG - Intronic
1017824596 6:158071945-158071967 GCCCCAGGTCAATTCCATGGAGG - Intronic
1018081449 6:160262483-160262505 GCCCCAGACTCCTCCCCTGGAGG - Intronic
1018765538 6:166929979-166930001 GCCCCAGGTGACTCGCCTGTGGG + Intronic
1019247597 6:170719344-170719366 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1019273037 7:161240-161262 GCCCCAGGTCACACCCGTGAGGG + Intergenic
1019432853 7:1007424-1007446 GGCTGAGGACACTCCCCTGTGGG + Intronic
1019556023 7:1631835-1631857 GGACCTGGACACTTCCCTGGGGG - Intergenic
1021690011 7:23222517-23222539 TCCCAAGGACCCTCTCCTGGAGG + Intergenic
1022106503 7:27200761-27200783 GTCCCAGGACATTCCACTGGAGG + Intergenic
1024576783 7:50770958-50770980 GCCCTAGGACCCAGCCCTGGGGG + Intronic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1026330906 7:69351755-69351777 GCCCAAGAACACCCACCTGGAGG + Intergenic
1026457427 7:70584792-70584814 GCCCCAGCACACGCCCTTCGTGG - Intronic
1029438532 7:100575256-100575278 GCCCCCGGGCAGTGCCCTGGAGG + Exonic
1029560612 7:101300290-101300312 GCCTGAGGACAGTCCGCTGGCGG + Intergenic
1029561119 7:101303391-101303413 CCCTCAGGACAGTCCGCTGGTGG + Intergenic
1029562023 7:101308986-101309008 GCCTGAGGACAGTCCACTGGCGG + Intergenic
1029872928 7:103714752-103714774 GCCCCAGGACACTTCCCTCCTGG - Intronic
1034203923 7:149299497-149299519 GCCCTAGGACACTCCTGGGGTGG + Intergenic
1035305738 7:157930152-157930174 GCCCCAAGACACCCCTCTGTGGG - Intronic
1035500540 8:88592-88614 GGCCCAGGACTGACCCCTGGAGG - Intergenic
1035729782 8:1845890-1845912 GCAGCAGGACACTCCTCTGCTGG + Intronic
1035731735 8:1858241-1858263 TCCCCAGGTGAGTCCCCTGGGGG + Intronic
1035732480 8:1862631-1862653 GCTCCTGGACACCCCCGTGGGGG + Intronic
1037709954 8:21347633-21347655 CCCCCATGTCCCTCCCCTGGGGG - Intergenic
1038420712 8:27432355-27432377 GCCCAGAGACACTCACCTGGGGG - Exonic
1038689251 8:29746310-29746332 GACCCAGGATACTCCCTTGAAGG - Intergenic
1042767385 8:72338790-72338812 GCAGCAGGACAGTCCCCAGGTGG + Intergenic
1048451361 8:134536577-134536599 GCCCCAGGAGAATTCCCTGCTGG - Intronic
1048461212 8:134623298-134623320 ATCCCTGGACACTCCCCTGTGGG + Intronic
1048581368 8:135732082-135732104 GCCCCAGGCCCCGCTCCTGGTGG + Intergenic
1049641506 8:143718070-143718092 GGCCCAGGCCACTCACCTGGAGG - Exonic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1051636177 9:19182861-19182883 GCCCCAGGACTCTCTCCTGTGGG + Intergenic
1052987186 9:34496318-34496340 GCCCCCTGACCCTACCCTGGAGG + Intronic
1056808339 9:89745537-89745559 ACACCAGTCCACTCCCCTGGGGG + Intergenic
1057129280 9:92641981-92642003 GGCCAAGGACTCTCTCCTGGGGG + Intronic
1057753340 9:97809894-97809916 GCCCCTGGGCAATCCCCTGCAGG - Intergenic
1060799475 9:126534577-126534599 GCCCCAGGAAACTCATTTGGAGG + Intergenic
1061498662 9:130990116-130990138 TCCCCAGGACTGTCCCCTGCTGG + Intergenic
1061507022 9:131037137-131037159 GCCCCAGGACTCTCTGGTGGAGG - Intronic
1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG + Intergenic
1061999669 9:134209644-134209666 GGCCCAGGACCCACCCCTTGTGG - Intergenic
1062413204 9:136434895-136434917 GGCACAGGACACATCCCTGGGGG + Intronic
1062527755 9:136985173-136985195 GCCCCGGGTCACACCCCTGCTGG + Exonic
1186216935 X:7310707-7310729 GGCCCAGGACAGAGCCCTGGAGG - Intronic
1186333934 X:8565968-8565990 GCCACTGGTCTCTCCCCTGGAGG - Intronic
1186381969 X:9070182-9070204 GCCCCATGACACCCCCATGGTGG + Intronic
1189479347 X:41380982-41381004 TCCCCAGGACATGGCCCTGGGGG + Intergenic
1192203403 X:69081320-69081342 GTCCCAGGAGGCTTCCCTGGGGG - Intergenic
1192473504 X:71419769-71419791 GCCCCATTTCACCCCCCTGGGGG - Intronic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262813 X:124334798-124334820 GCCCCAGGGCACTCCCCTGGGGG + Intronic
1197345554 X:125322837-125322859 GCCCCAGGTAACCCCTCTGGAGG + Intergenic
1198311624 X:135430335-135430357 GCCCAAGGTCACACACCTGGTGG + Intergenic