ID: 1197264059

View in Genome Browser
Species Human (GRCh38)
Location X:124347313-124347335
Sequence CTACATCAGCAGATCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 161}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197264059_1197264072 16 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264072 X:124347352-124347374 AGTGGGGGGTGGGGAGGGGCAGG 0: 1
1: 3
2: 74
3: 593
4: 5295
1197264059_1197264069 10 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264069 X:124347346-124347368 AAAAGTAGTGGGGGGTGGGGAGG 0: 1
1: 2
2: 17
3: 185
4: 1498
1197264059_1197264060 -2 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264060 X:124347334-124347356 AGCATCCTTTAGAAAAGTAGTGG 0: 1
1: 0
2: 0
3: 20
4: 185
1197264059_1197264064 2 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264064 X:124347338-124347360 TCCTTTAGAAAAGTAGTGGGGGG 0: 1
1: 0
2: 1
3: 14
4: 172
1197264059_1197264073 17 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264073 X:124347353-124347375 GTGGGGGGTGGGGAGGGGCAGGG 0: 1
1: 7
2: 82
3: 1558
4: 14028
1197264059_1197264071 12 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264071 X:124347348-124347370 AAGTAGTGGGGGGTGGGGAGGGG 0: 1
1: 0
2: 16
3: 209
4: 2041
1197264059_1197264066 5 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264066 X:124347341-124347363 TTTAGAAAAGTAGTGGGGGGTGG 0: 1
1: 0
2: 1
3: 42
4: 493
1197264059_1197264068 7 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264068 X:124347343-124347365 TAGAAAAGTAGTGGGGGGTGGGG 0: 1
1: 0
2: 4
3: 48
4: 546
1197264059_1197264061 -1 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264061 X:124347335-124347357 GCATCCTTTAGAAAAGTAGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
1197264059_1197264062 0 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264062 X:124347336-124347358 CATCCTTTAGAAAAGTAGTGGGG 0: 1
1: 0
2: 1
3: 12
4: 195
1197264059_1197264074 18 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264074 X:124347354-124347376 TGGGGGGTGGGGAGGGGCAGGGG 0: 1
1: 3
2: 63
3: 769
4: 5838
1197264059_1197264067 6 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264067 X:124347342-124347364 TTAGAAAAGTAGTGGGGGGTGGG 0: 1
1: 0
2: 3
3: 46
4: 412
1197264059_1197264063 1 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264063 X:124347337-124347359 ATCCTTTAGAAAAGTAGTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 173
1197264059_1197264070 11 Left 1197264059 X:124347313-124347335 CCTCTCTGGATCTGCTGATGTAG 0: 1
1: 0
2: 1
3: 7
4: 161
Right 1197264070 X:124347347-124347369 AAAGTAGTGGGGGGTGGGGAGGG 0: 1
1: 1
2: 15
3: 160
4: 1625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197264059 Original CRISPR CTACATCAGCAGATCCAGAG AGG (reversed) Intronic
900851612 1:5147403-5147425 CTAGATGAGCAGATAAAGAGTGG - Intergenic
903377892 1:22877878-22877900 CTACTTCAGCAGGTCTGGAGTGG - Intronic
904035984 1:27558752-27558774 CTTCATCAGCATCTCCAGGGTGG + Exonic
905956634 1:42002627-42002649 TTCCATCAGCAGATCCAGTGGGG + Intronic
906200671 1:43958234-43958256 TTTCATCAGCACATCCTGAGGGG - Exonic
906643619 1:47457359-47457381 CTACAGCAGCAGAGCAGGAGAGG - Intergenic
913158877 1:116127830-116127852 CTCATTCAGCAGGTCCAGAGTGG - Intronic
915512069 1:156391932-156391954 CTTCATCACCAAAGCCAGAGTGG - Intergenic
918167997 1:181969245-181969267 ATACATCCCCAGATCCAGAACGG - Intergenic
923200174 1:231703813-231703835 CTACATCAGAAGTTTCAGGGTGG + Intronic
923918105 1:238530812-238530834 CTACAGCAGCTGCTCCAGATGGG + Intergenic
924501292 1:244640841-244640863 CCAGAGCAGCAGAACCAGAGGGG + Intronic
924685970 1:246290121-246290143 CTACATTAGCATATGAAGAGAGG + Intronic
1063391562 10:5652969-5652991 CTGCAACAGCTGATCGAGAGCGG - Exonic
1063573189 10:7235951-7235973 CAACATCAACAGCTCCAGATAGG + Intronic
1065153086 10:22842217-22842239 CTTATTCAGCAGATCCAAAGTGG - Intergenic
1065771623 10:29083518-29083540 CTACAGCTGCAGAGCCAGCGAGG - Intergenic
1069415350 10:68195695-68195717 CTGAGTCAGTAGATCCAGAGTGG - Intronic
1070827105 10:79397702-79397724 CTGCAGAACCAGATCCAGAGTGG - Intronic
1071894513 10:90051267-90051289 CATCATCAGCAGGTCCAGACTGG + Intergenic
1073736566 10:106354518-106354540 CTACCACTGCACATCCAGAGAGG - Intergenic
1074108563 10:110406750-110406772 CTCCACCAGGAGCTCCAGAGAGG + Intergenic
1075453749 10:122571296-122571318 TTCCATCAGCAGATTCTGAGGGG - Intronic
1076977524 11:186082-186104 CTAAATTATCAGGTCCAGAGAGG - Intronic
1078100900 11:8329639-8329661 CTACACCAGGAGGCCCAGAGGGG + Intergenic
1079145082 11:17843873-17843895 CTAAAACATCAGAACCAGAGGGG + Intronic
1079603800 11:22341902-22341924 CTAGAACGGCAGAGCCAGAGAGG - Intronic
1080105231 11:28504681-28504703 CTACAGCAGCAGAGCCAGCGTGG + Intergenic
1081111512 11:39139581-39139603 CTATATTAGCAGATCTAGAAAGG - Intergenic
1087115479 11:94520229-94520251 CTACATCAGATGTTACAGAGAGG - Intergenic
1087499745 11:98934674-98934696 CTATTTCAGCAAATCCTGAGAGG - Intergenic
1090531421 11:127594821-127594843 CTGATTCAGCATATCCAGAGTGG + Intergenic
1092039317 12:5370110-5370132 GCACATCACCAGATTCAGAGAGG + Intergenic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1096571181 12:52524180-52524202 CCAGCTCTGCAGATCCAGAGTGG - Intergenic
1097252555 12:57644387-57644409 TTACATCATAAGATACAGAGAGG - Intergenic
1097802313 12:63928038-63928060 CTACAGCAGCATATCCTGAGTGG - Intronic
1099561102 12:84174452-84174474 CTACAGCAGCTGCTCCAGATGGG + Intergenic
1101489555 12:105198476-105198498 CTACATCTGCAGAACTACAGGGG + Intronic
1104722158 12:131050581-131050603 TTACATGGGCAGATCAAGAGAGG + Intronic
1105459774 13:20573082-20573104 CTAAATTACCAGGTCCAGAGAGG + Intronic
1106759471 13:32853907-32853929 CTATATCAGCAGTTGCAGAATGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1112240579 13:97677741-97677763 CTACATAAACAATTCCAGAGAGG + Intergenic
1112578945 13:100662113-100662135 ATACATCAGCATATCCTCAGTGG - Intronic
1112641230 13:101277873-101277895 CCACATGAGCAGAGGCAGAGAGG - Intronic
1113094199 13:106646460-106646482 CCTCAGCAGCAGATGCAGAGAGG + Intergenic
1113525361 13:110970488-110970510 CTACATCAGGGGATCCATTGGGG + Intergenic
1116948851 14:50860133-50860155 CTAGAACAGCAGCTCCAGATAGG + Intronic
1118324069 14:64769698-64769720 CTTCATGAGCAGTTCCACAGAGG + Exonic
1120059094 14:79960705-79960727 CTACATAAGCTGATACAGATAGG - Intergenic
1121148215 14:91605131-91605153 CTAAATAAGCAGATCCACGGAGG + Intronic
1122714295 14:103684670-103684692 CTACTCCAGCAGCTGCAGAGGGG + Intronic
1126702519 15:51380856-51380878 CACCATCAGCAGATCCTTAGAGG - Intronic
1127533471 15:59867547-59867569 CTGCCTGAGGAGATCCAGAGTGG - Intergenic
1128742059 15:70090588-70090610 TTAGATGAGAAGATCCAGAGCGG + Intronic
1130151278 15:81313552-81313574 GAAAATCAGCAGGTCCAGAGAGG - Intronic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1134473222 16:14547209-14547231 CTTCATCTGAAGAGCCAGAGGGG + Intronic
1137576727 16:49604885-49604907 CCACATCACCAGATCCTGGGAGG + Intronic
1137881631 16:52054993-52055015 ATAAATCAGCAGATCTAGTGTGG + Intronic
1139253894 16:65522296-65522318 CTACACAGCCAGATCCAGAGTGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141278015 16:82605672-82605694 TTACTTTAGCAGGTCCAGAGTGG - Intergenic
1142442726 16:90110606-90110628 CTAAATTATCAGGTCCAGAGAGG + Intergenic
1142464974 17:130792-130814 CTAAATTATCAGGTCCAGAGAGG - Intergenic
1144235149 17:13253558-13253580 ATACATCAGCCTTTCCAGAGGGG + Intergenic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148188234 17:45660125-45660147 CCACATCAGCAGGTCTAGGGTGG + Intergenic
1148618180 17:49015333-49015355 CTAAACCAGCATCTCCAGAGAGG + Intronic
1149656404 17:58311688-58311710 CTCGATCTGCACATCCAGAGGGG + Exonic
1149680607 17:58504520-58504542 GCACATCAGCATTTCCAGAGAGG - Intronic
1152507146 17:80757299-80757321 CGACCTCAGCACATCCAGTGAGG + Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1156535379 18:37859247-37859269 CTCCATCAAAAGATCTAGAGTGG - Intergenic
1157105522 18:44771150-44771172 CTGCATCAGTAGATCTGGAGTGG - Intronic
1157722510 18:49936320-49936342 CTCCATGAGCAGATGCAGGGAGG + Exonic
1157957720 18:52117251-52117273 TTAAATCAGCATATCCAAAGTGG + Intergenic
1160507903 18:79437470-79437492 CGGCATCGGCAGATCCAGACCGG - Intronic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
1168605321 19:57754475-57754497 CAACATCAGCAGATCCACTCTGG + Exonic
924986341 2:273547-273569 CTAGAGCAGCACAGCCAGAGCGG + Intronic
926333222 2:11842652-11842674 CAACTTCACCAGATCCAAAGGGG - Intergenic
927214767 2:20662055-20662077 CATCATCACCAGACCCAGAGAGG + Intergenic
927282164 2:21318345-21318367 CTACATCAGCAGAGTTGGAGGGG - Intergenic
928081441 2:28316005-28316027 CTAACTCTGAAGATCCAGAGTGG - Intronic
929061247 2:37926193-37926215 CTTCATCAGCAGACCCTTAGAGG - Intronic
930247985 2:49004199-49004221 CCACCTCAGCAGAGCCTGAGAGG - Intronic
930626843 2:53708030-53708052 CCACATCAGTAGATCTAGGGTGG - Intronic
935061417 2:99611518-99611540 CTCCATCAGCAAAGCCTGAGTGG - Intronic
935186617 2:100739979-100740001 CTACTTCATCACATCCAGCGAGG - Intergenic
936694844 2:114933803-114933825 CTGATTCAGTAGATCCAGAGAGG + Intronic
943097155 2:183443270-183443292 CTAGATCTACAGATCAAGAGTGG + Intergenic
945089045 2:206161448-206161470 CCTCATCATCAGATCCAAAGAGG - Exonic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1172526755 20:35604427-35604449 CTGAATCGGCAGATCCAGAGTGG + Intergenic
1173557618 20:43977766-43977788 CCCCATCAGCAGCTCCAGGGGGG + Intronic
1174066355 20:47868485-47868507 CAACAGCGGCAGCTCCAGAGAGG + Intergenic
1179339148 21:40488011-40488033 CTGGTTCAGGAGATCCAGAGAGG + Intronic
1183365878 22:37406595-37406617 CTAATTGAGCAGATGCAGAGCGG - Intronic
1183578620 22:38708682-38708704 CTACTTCAGGAGAAGCAGAGAGG + Intronic
1184708730 22:46234550-46234572 CAAGATCAGGAGACCCAGAGTGG - Intronic
1184968892 22:48001287-48001309 TTGCATCATCAGGTCCAGAGAGG + Intergenic
1185332114 22:50256534-50256556 ATAGATGGGCAGATCCAGAGGGG + Intronic
954674595 3:52308840-52308862 CTGCATCTGTGGATCCAGAGAGG + Intergenic
957848030 3:85764657-85764679 ATGCATCAGCATATCAAGAGTGG + Intronic
959094462 3:101938584-101938606 CTACAGCAGCAGGGTCAGAGGGG - Intergenic
959678989 3:109071154-109071176 TAACATCAGGAGATCCAGAAAGG - Intronic
960149541 3:114236857-114236879 CGACATCAGCAGATTCACACTGG - Exonic
961410776 3:126718799-126718821 CTGCACCAACAGAACCAGAGGGG - Intronic
963942681 3:151110847-151110869 CAACAGCAGCAGATCCCAAGAGG - Intronic
966639738 3:182176617-182176639 CTCCAGCTGGAGATCCAGAGGGG - Intergenic
966772337 3:183515162-183515184 CTAAGTCAAAAGATCCAGAGAGG + Intronic
966855502 3:184191216-184191238 CGAGATCAGCAGACACAGAGAGG - Exonic
967602382 3:191405257-191405279 CTGCACCAGCAAATCCACAGGGG - Intergenic
967937490 3:194740524-194740546 ATACATAAGCAAATCAAGAGAGG - Intergenic
968019011 3:195367211-195367233 CTAATTCAGCAGATCTAGGGTGG + Intronic
968106108 3:196002434-196002456 TTGCAGCTGCAGATCCAGAGAGG - Intergenic
968362999 3:198161566-198161588 CTAAATTATCAGGTCCAGAGAGG + Intergenic
971419787 4:26464876-26464898 CTCCAACAGCAGATCCAGCCTGG + Intergenic
971636912 4:29072930-29072952 GTACCACAGCAGATCCTGAGGGG - Intergenic
975746871 4:77483527-77483549 CTACTGGAGAAGATCCAGAGAGG - Intergenic
979361066 4:119765453-119765475 CCACCCCAGCAGGTCCAGAGGGG + Intergenic
983884767 4:172968167-172968189 AGACAGCAGCAGATCCAGTGTGG + Intronic
985142575 4:186857397-186857419 CTACTTCAGCAAATCCAGGATGG - Intergenic
985506163 5:281738-281760 CTACAGCTGGAGATCCGGAGAGG + Intronic
993138722 5:84003019-84003041 CTACAACAGCAGTGGCAGAGGGG - Intronic
999650024 5:153756225-153756247 ATCCCACAGCAGATCCAGAGGGG + Intronic
999658085 5:153830041-153830063 CCAAATCAGCAGGTCCTGAGTGG - Intergenic
1000395802 5:160773552-160773574 GTATATTAGCAGCTCCAGAGCGG + Intronic
1003635897 6:7831240-7831262 CAAAATAGGCAGATCCAGAGAGG + Intronic
1004996837 6:21201580-21201602 CTATGTCAGTAGATCCTGAGTGG + Intronic
1005019849 6:21407202-21407224 ATTCAACAGGAGATCCAGAGAGG - Intergenic
1006375902 6:33671458-33671480 CCACCTCAGCAGGACCAGAGGGG + Intronic
1010065577 6:71679201-71679223 CTGCATCAACATATCAAGAGTGG + Intergenic
1011087207 6:83555119-83555141 CTACATTAGCCAATCCAAAGTGG + Intronic
1013548515 6:111184088-111184110 CTACATCATCAGCTTCAGATTGG - Intronic
1014045609 6:116882184-116882206 ATACATCAGCAGAGGCAGGGAGG - Intronic
1015593232 6:134842518-134842540 CTGGATCAGCAGATCCAGGCAGG + Intergenic
1017283608 6:152649765-152649787 CTATATCAGCAGTTACAGAAAGG + Intergenic
1018174811 6:161169326-161169348 CTACATCAGCACAGCGAGAGGGG + Intronic
1019252683 7:27145-27167 CTAAATTATCAGGTCCAGAGAGG - Intergenic
1020513783 7:9090964-9090986 CTACAGCAGCAGTGGCAGAGGGG - Intergenic
1029288944 7:99487114-99487136 CGACATCAGGTGATCCATAGTGG + Exonic
1030772001 7:113486671-113486693 CTATTTCAGCAGATGTAGAGAGG + Intergenic
1031169959 7:118280968-118280990 CTACACCAGCAGTTCCTGAAAGG + Intergenic
1031505631 7:122578551-122578573 CTGACTCAGCAGATCTAGAGTGG + Intronic
1032458818 7:132094279-132094301 CCACAGCAGCAAATCCAGAGGGG - Intergenic
1040906481 8:52474429-52474451 CAACTACAGCATATCCAGAGAGG + Intergenic
1042193345 8:66210362-66210384 CTACATCAGCTGGGGCAGAGGGG - Intergenic
1043422646 8:80114705-80114727 CTACATCAACAGAGGCACAGGGG - Intronic
1044577497 8:93786570-93786592 CTAATTCAGCAGGTCTAGAGTGG - Intronic
1047016727 8:120731470-120731492 TTTCATCAGCTGACCCAGAGAGG - Intronic
1048281555 8:133109276-133109298 CTGACTCAGCAGGTCCAGAGTGG - Intronic
1048637091 8:136308886-136308908 GTAAATCAGCAGATTCAGAAAGG - Intergenic
1049878937 8:145048490-145048512 ATACATCAGCAGATTCACATTGG + Intergenic
1055689748 9:78816684-78816706 CCACATCAGCTGATGCTGAGTGG + Intergenic
1056914773 9:90736599-90736621 CTACATCATCAGAAACAGATTGG + Intergenic
1057156585 9:92846892-92846914 GTACATCAGCAGATTCACACAGG - Exonic
1058109372 9:101015476-101015498 CTACATCAGAAGATGCACACTGG + Intergenic
1058421058 9:104833870-104833892 CTCAATCAGCAGATCCAGAGGGG + Intronic
1059035457 9:110749301-110749323 ATACAACAGCAGAACAAGAGAGG + Intronic
1059332807 9:113546782-113546804 CTACAGCAGCAGCTCCAGCTGGG - Intronic
1062090099 9:134671567-134671589 CTGAGTCAGCAGAGCCAGAGAGG + Intronic
1062747686 9:138225229-138225251 CTAAATTATCAGGTCCAGAGAGG + Intergenic
1187983835 X:24788742-24788764 CCTCATCATCAGATCCAAAGAGG + Intronic
1197264059 X:124347313-124347335 CTACATCAGCAGATCCAGAGAGG - Intronic
1198252465 X:134893167-134893189 GTACTTCATCAGAGCCAGAGAGG + Intronic
1199320587 X:146433535-146433557 CTTCACCAGCAGAGGCAGAGTGG - Intergenic