ID: 1197267493

View in Genome Browser
Species Human (GRCh38)
Location X:124390987-124391009
Sequence GTGAACTCTGCTTCATCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197267487_1197267493 1 Left 1197267487 X:124390963-124390985 CCTTCCTTTTGCCCTGGCTCCCA 0: 1
1: 0
2: 4
3: 60
4: 507
Right 1197267493 X:124390987-124391009 GTGAACTCTGCTTCATCTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 196
1197267489_1197267493 -10 Left 1197267489 X:124390974-124390996 CCCTGGCTCCCAAGTGAACTCTG 0: 1
1: 0
2: 1
3: 27
4: 215
Right 1197267493 X:124390987-124391009 GTGAACTCTGCTTCATCTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 196
1197267488_1197267493 -3 Left 1197267488 X:124390967-124390989 CCTTTTGCCCTGGCTCCCAAGTG 0: 1
1: 0
2: 2
3: 24
4: 221
Right 1197267493 X:124390987-124391009 GTGAACTCTGCTTCATCTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 196
1197267485_1197267493 11 Left 1197267485 X:124390953-124390975 CCAAAGGACTCCTTCCTTTTGCC 0: 1
1: 0
2: 0
3: 26
4: 259
Right 1197267493 X:124390987-124391009 GTGAACTCTGCTTCATCTCCAGG 0: 1
1: 0
2: 0
3: 20
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197267493 Original CRISPR GTGAACTCTGCTTCATCTCC AGG Intronic
900392980 1:2441776-2441798 GTGAACCCTGCGGCAGCTCCAGG - Intronic
901695329 1:11003534-11003556 AGGAACTGTGGTTCATCTCCAGG + Intergenic
902571246 1:17348266-17348288 GTGAGCTCAGCTTGATCTCCAGG + Intronic
903594536 1:24484182-24484204 GTGTACTCTGCAACATCTCTTGG + Intergenic
903983894 1:27210706-27210728 GGGAACTTGGCTTCACCTCCTGG - Intergenic
904276911 1:29390837-29390859 GAGTCCTCTGCTTCCTCTCCAGG - Intergenic
908584263 1:65551052-65551074 ATGAAGTCGGCTTCATCTCTAGG - Intronic
910768696 1:90809152-90809174 GTTTGCTCTGCTTCACCTCCTGG + Intergenic
911369728 1:96982617-96982639 GAGAGCTCTACTTCATCTCCAGG - Intergenic
911718272 1:101160536-101160558 ATTAACTCGGCTTCATCTCTGGG + Intergenic
912197242 1:107412631-107412653 ATGAACTCTGATTTTTCTCCAGG - Intronic
913593643 1:120352873-120352895 GCGAACTCTGCTCCGCCTCCCGG - Intergenic
914093612 1:144526112-144526134 GCGAACTCTGCTCCGCCTCCCGG + Intergenic
914304914 1:146407790-146407812 GCGAACTCTGCTCCGCCTCCCGG - Intergenic
914597142 1:149165039-149165061 GCGAACTCTGCTCCGCCTCCCGG + Intergenic
914896861 1:151683207-151683229 GTGAACTCTGCCACATGTCCAGG - Intronic
916245949 1:162688371-162688393 GTTAACTCTACTTCCTCTCATGG + Intronic
917203488 1:172543017-172543039 ATGTACTCTTCTACATCTCCTGG - Intronic
920682001 1:208080375-208080397 GTGAACTGTGCTTCAGGTTCAGG + Intronic
921677608 1:217993665-217993687 GTGAGCTCTACATCATCTGCAGG + Intergenic
1063474748 10:6318452-6318474 GTGAGCTCTCCTTCTTCCCCAGG + Intergenic
1063746802 10:8892897-8892919 TTGAACTCTGCTCCATCTGCAGG + Intergenic
1065124801 10:22564096-22564118 GTGAACTGTGGTTCATGCCCTGG + Intronic
1066319144 10:34282701-34282723 GTGAACTCAGATTCATCCACAGG - Intronic
1067225989 10:44375906-44375928 GTGAACTGTGGTCCATCTCGAGG + Intronic
1067563774 10:47322258-47322280 GTGACATATGCTCCATCTCCTGG - Intergenic
1069592683 10:69651738-69651760 GCGAACTCTGCTCCAGCTTCTGG + Intergenic
1072736180 10:97881221-97881243 ATGGACTCTCCATCATCTCCAGG + Intronic
1075090471 10:119441466-119441488 GTGAGCTGGGATTCATCTCCAGG + Intronic
1075188053 10:120281002-120281024 ATGATCTCAGCTTCACCTCCTGG - Intergenic
1076150692 10:128159828-128159850 GTGATCTCTCCCTCAGCTCCTGG - Intergenic
1076545294 10:131241083-131241105 GAGTTCTCTGCTCCATCTCCGGG - Intronic
1076551986 10:131286303-131286325 GTGAACTCTGATTCATCAGCTGG + Intronic
1079501288 11:21104163-21104185 GTGAACTCTGCTTCAACTGATGG - Intronic
1081643996 11:44777395-44777417 AGCAACTCTGCTTCAGCTCCCGG + Intronic
1082723372 11:56706142-56706164 GTGAATTCTGCTTCTTCTCTGGG - Intergenic
1083885145 11:65569865-65569887 GCGAACTTTGCTTCAGTTCCAGG + Intergenic
1084085711 11:66854173-66854195 GTGACCTCTTCTCCATCTCCAGG + Intronic
1084103670 11:66966567-66966589 GTGGACTCTGCTTGGTCTCTGGG + Intergenic
1085198660 11:74688101-74688123 TTGACCTCTGCTGCCTCTCCAGG + Intergenic
1086913653 11:92502258-92502280 CTATCCTCTGCTTCATCTCCAGG - Intronic
1087916461 11:103817147-103817169 GTTAAATCTGCTTCATCCCTGGG - Intergenic
1088582888 11:111332156-111332178 TTGAACTCAGATTCACCTCCAGG + Intergenic
1089038650 11:115424318-115424340 TTGAACTTTTCTTCATCTCTAGG + Intronic
1089325222 11:117652348-117652370 GTGTCATCTGCTCCATCTCCTGG - Intronic
1091681416 12:2530081-2530103 GAGAACTCAGCTGTATCTCCTGG + Intronic
1091842178 12:3629183-3629205 GTGACTCCTGCTTCATCTCTCGG - Intronic
1093887741 12:24481840-24481862 GTGAAGTCTGGCTCATCTGCTGG + Intergenic
1094321520 12:29189124-29189146 GGGAACTCAGCCGCATCTCCCGG + Intronic
1095962266 12:47843227-47843249 GTGAAGTCTGATTCCTCTCTGGG + Exonic
1096104506 12:48988905-48988927 GTGATCTCTGCTCCAGTTCCTGG - Intergenic
1096683502 12:53272642-53272664 CTGATCTCTGCTGCCTCTCCAGG + Intronic
1098132806 12:67368144-67368166 CTGAACTATGCTACACCTCCTGG + Intergenic
1098678045 12:73315882-73315904 GTGCTCTCTGCTTCATGCCCAGG - Intergenic
1100255772 12:92881343-92881365 GTGATCACTGCTCGATCTCCCGG - Intronic
1100347059 12:93742602-93742624 GGAAACTCAGCTCCATCTCCAGG + Intronic
1102721696 12:115022145-115022167 CTGCTCTCTGCTTCATCTCCTGG + Intergenic
1104016374 12:124965006-124965028 GTGACCTCTGCTTTCCCTCCAGG - Exonic
1104667420 12:130657376-130657398 GTGATCTCTGCTTTATTTCCTGG - Intronic
1105282952 13:18979954-18979976 GTGAACTGTGCCTCATATTCTGG + Intergenic
1106769885 13:32951796-32951818 ATTGACTCTGCTTCCTCTCCTGG - Intergenic
1110631375 13:77711880-77711902 GTCAAGTCGGCTTCATCCCCGGG + Intronic
1111308871 13:86454448-86454470 GTGAACTCTGCTCCCTCCTCTGG - Intergenic
1113306818 13:109088523-109088545 CTGAATTATGCTTCAGCTCCTGG - Intronic
1116483107 14:45415200-45415222 ATCAACTCAGCTTCATCTCTGGG + Intergenic
1117400293 14:55352834-55352856 GTGAACTCTTCTGAATGTCCTGG - Exonic
1117889759 14:60406778-60406800 GTGAAGTCAGCTTCATCCCCAGG - Intronic
1121583765 14:95048998-95049020 ATGGACTCTGCTTCCACTCCGGG + Intergenic
1125227544 15:37411947-37411969 ATCAACTCTGCTTCATCCCAGGG + Intergenic
1125487516 15:40122721-40122743 GTGACCTCTGCTCCTTCACCGGG + Intergenic
1127864331 15:63019606-63019628 GTCAGCTCTGATTCATCTTCAGG - Intergenic
1129989065 15:79945957-79945979 GGGAACCCTGATTCAGCTCCTGG - Intergenic
1133385495 16:5366589-5366611 ATGAACTTTGCTTCCTCTCTGGG - Intergenic
1133408641 16:5549309-5549331 TTGAACTTTGCTTTCTCTCCTGG + Intergenic
1134242154 16:12513999-12514021 GTGAACTCTGCTTTATAACGGGG - Intronic
1136222637 16:28837986-28838008 TTGAACTTGGCTTCATCTCAAGG + Intergenic
1138331408 16:56218725-56218747 GTGATCTCTCACTCATCTCCAGG + Intronic
1140044770 16:71433020-71433042 CTGGACTCTGCTGCTTCTCCTGG + Intergenic
1142549625 17:730634-730656 GTGAACTCTCCATTCTCTCCAGG - Intergenic
1142565540 17:837736-837758 CTGTTCTCTGCTTCAGCTCCAGG - Intronic
1142657156 17:1401706-1401728 GTGAACATTGCTTCAGCTTCTGG + Intergenic
1144392487 17:14807734-14807756 GTGAAATCTGTTTCATGTGCTGG + Intergenic
1146649433 17:34597636-34597658 GTGAACCCAGCCTCAGCTCCTGG + Intronic
1147048260 17:37770998-37771020 ACCAACTCTCCTTCATCTCCCGG + Intergenic
1147684700 17:42280186-42280208 GTGGACATTGCTGCATCTCCAGG - Intergenic
1148888869 17:50793394-50793416 GTGGACTCAGCTGCCTCTCCGGG + Intergenic
1151158422 17:72143894-72143916 GGGAACTCTGCATCCTTTCCAGG - Intergenic
1151262491 17:72927367-72927389 GTGAACACTGGTTCAAATCCAGG - Intronic
1155808138 18:30198034-30198056 ATCAAGTCTGCTTCATCCCCAGG + Intergenic
1155848136 18:30734749-30734771 ATCAACTCAGCTTCATCTCTGGG + Intergenic
1158042864 18:53117733-53117755 GTGATCTCTGTTGCACCTCCTGG + Intronic
1166305646 19:41935717-41935739 CCGCTCTCTGCTTCATCTCCGGG - Intergenic
930200394 2:48547397-48547419 GCGAACTCTGGTCCATCTCTTGG - Intronic
932446436 2:71784648-71784670 GTGAACTCTGCAATATCTCCTGG - Intergenic
932773276 2:74513423-74513445 GTGAACTCTGCGTCCTTCCCGGG - Intergenic
933918956 2:87025542-87025564 GTGAACTCTACCTCACCTCCTGG - Intergenic
934004038 2:87744372-87744394 GTGAACTCTACCTCACCTCCTGG + Intergenic
934078606 2:88448878-88448900 GTGTACTCAGCTTCATTTCTGGG + Intronic
934988708 2:98905690-98905712 ACGATCTCTGCTCCATCTCCTGG + Intronic
939838495 2:147157844-147157866 GGGAAAACTGCTGCATCTCCTGG + Intergenic
939921007 2:148113318-148113340 GTGCATTGTGTTTCATCTCCTGG + Intronic
941392131 2:164927178-164927200 TTGAACTCTGCTTCCTCTGGAGG - Intronic
947225493 2:227836019-227836041 GTCAAGTCTGCTTCATCTCTGGG - Intergenic
948826078 2:240573985-240574007 GTGAGCTCCGCTTCCTCCCCAGG - Intronic
1169549819 20:6691184-6691206 GTGAACTTTGATTCATTTTCTGG + Intergenic
1169932035 20:10843780-10843802 GTGGACTTTGCTTCCACTCCGGG - Intergenic
1173171209 20:40725534-40725556 GACAAACCTGCTTCATCTCCTGG + Intergenic
1174244489 20:49166724-49166746 GTGAACACTGCTTCCTCTTAAGG + Intronic
1175858428 20:62135421-62135443 GTCACCTCTGCATCATGTCCAGG + Intergenic
1177708080 21:24735586-24735608 GTTAACTCTTCTTGATCTTCAGG - Intergenic
1180913228 22:19468033-19468055 GTGGAGGCTGCTTCATCTCTAGG - Intronic
1181358691 22:22318573-22318595 GTGAGCTAAGCTTCAGCTCCAGG + Intergenic
1181421008 22:22799018-22799040 GTGAACTCTCCCTCCCCTCCTGG + Intronic
1181854104 22:25769919-25769941 GTGATCTCGGCTCCACCTCCCGG + Intronic
1182034555 22:27187581-27187603 CTTAACTTTGCTTCCTCTCCAGG - Intergenic
1182042978 22:27252823-27252845 GTGACCTCTGCTACATTTACTGG + Intergenic
1183777336 22:39975080-39975102 GCTAACTCTTGTTCATCTCCAGG + Intergenic
1184955289 22:47881952-47881974 GTGAGCTCAGCTTCATCTTAGGG - Intergenic
949175705 3:1060164-1060186 ATCAAGTCTGCTTCATCTCTGGG - Intergenic
950579770 3:13854573-13854595 GGGCATTCTGCTTGATCTCCCGG + Exonic
952649030 3:35700615-35700637 GTGATTTCTTCTTCAGCTCCAGG - Intronic
952839289 3:37630662-37630684 GTGAACTGTGGCCCATCTCCTGG - Intronic
955977609 3:64493144-64493166 GAGATCTCTGCCTCCTCTCCAGG - Intergenic
958149098 3:89667661-89667683 GTGATCTCAGCTTCCTGTCCTGG - Intergenic
960452973 3:117832770-117832792 CTGAACTCTGCTACACATCCTGG - Intergenic
960822718 3:121751301-121751323 TTGATCTCAGCTTTATCTCCAGG + Intergenic
960996390 3:123343295-123343317 GTGAACTCTGCCTCATCAGTGGG - Intronic
961316790 3:126042253-126042275 GTCAACTCTGCTTCTTCTCAGGG - Intronic
961437411 3:126928901-126928923 GGGAACTCTACTTCCTCTGCTGG + Intronic
961573948 3:127819916-127819938 AGGACCTCTGCATCATCTCCAGG + Intronic
961758352 3:129145546-129145568 GTGGAAGCTGCTTCATCTCTCGG - Intronic
962772344 3:138624495-138624517 CTGAACTCTGTCTCATTTCCAGG - Intronic
962983612 3:140513444-140513466 ATAAACTTGGCTTCATCTCCAGG - Intronic
964154561 3:153569234-153569256 GTCAAGTCGGCTTCATCTCTGGG - Intergenic
965986198 3:174756411-174756433 GTCACCTCTGCTCCATCTACTGG + Intronic
966219540 3:177536798-177536820 TTCAACTCTGTTTCATCTCCTGG - Intergenic
968513764 4:1007079-1007101 GTGAACTGTGGTTCACCTTCAGG - Intergenic
968696110 4:2028848-2028870 ATCAAGTCAGCTTCATCTCCGGG - Intronic
971535885 4:27750886-27750908 GTGGTCTCTGCTTCTTCTCTTGG - Intergenic
971535914 4:27751254-27751276 GTGGTCTCTGCTTCTTCTCTTGG + Intergenic
971746168 4:30584305-30584327 ATCAAGTCAGCTTCATCTCCGGG - Intergenic
972787167 4:42337123-42337145 GTGAAATGTGCTGCTTCTCCTGG - Intergenic
978731841 4:112037091-112037113 GTGTGCTCTGCTTCTCCTCCAGG - Intergenic
980209583 4:129769624-129769646 GTGAATTCTGCTTCTTCTGGTGG - Intergenic
980346513 4:131628479-131628501 GTCAAGTTGGCTTCATCTCCAGG + Intergenic
982065348 4:151649892-151649914 GGGCATTCTTCTTCATCTCCTGG - Exonic
982527999 4:156504132-156504154 GTGCAGTCTGCTTGCTCTCCAGG - Intergenic
983948485 4:173612735-173612757 ATCAAGTCTGCTTCATCTCTGGG - Intergenic
984896644 4:184547376-184547398 ATGAACTCTGCTTCCTCCCAAGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989434826 5:41398549-41398571 TTGAACTATACTTCATCTCAGGG - Intronic
992395301 5:76363953-76363975 GTGCTCTCTGCTTCATCTTTTGG + Intergenic
992543051 5:77783374-77783396 GTGGACTCTGCTTCAAGTCTAGG + Intronic
995001955 5:107143928-107143950 ATTAAATCTCCTTCATCTCCAGG + Intergenic
995002085 5:107145458-107145480 ATTAAATCTCCTTCATCTCCAGG + Intergenic
995552957 5:113298599-113298621 AGGAACTTTGCTCCATCTCCTGG - Intronic
996774925 5:127122642-127122664 GTGACTTCTGCTTTGTCTCCTGG - Intergenic
997804354 5:136900435-136900457 ATGAATTCTGCTTCATCCCTGGG - Intergenic
1000853088 5:166364055-166364077 GGGAATACTGCTTGATCTCCTGG - Intergenic
1003793098 6:9568574-9568596 GGCAACTGTGCTTCATCTACAGG + Intergenic
1004240674 6:13918266-13918288 GGGAAATCTGATACATCTCCAGG + Intergenic
1006163954 6:32053687-32053709 GTGGTCTCTGCTTCATCCTCTGG + Intronic
1009160532 6:60276913-60276935 ATCAACTTGGCTTCATCTCCAGG - Intergenic
1012302874 6:97612019-97612041 ATCAACTCAGCTTCATCTCTAGG - Intergenic
1016746989 6:147591512-147591534 GTGAAATCTGCTTGACCTGCTGG + Intronic
1018127825 6:160698514-160698536 TTGAACTCTACCTCACCTCCTGG + Intergenic
1018148659 6:160918401-160918423 GTGAACTCCACCTCACCTCCTGG - Intergenic
1018610428 6:165642955-165642977 GTGAACTATTCCTCAGCTCCAGG - Intronic
1018706968 6:166470348-166470370 GTCAACTCCTCTTCATTTCCTGG - Intronic
1021221678 7:17981744-17981766 GTGATCTCAGCTACATCTTCTGG + Intergenic
1026499163 7:70928264-70928286 GTGTCCTCTTCTTCCTCTCCTGG - Intergenic
1028304558 7:89246900-89246922 GCCATCTCTGCTTCATGTCCAGG + Intronic
1029156861 7:98523396-98523418 TATAACTCTGCTTCCTCTCCAGG - Intergenic
1030005103 7:105110455-105110477 GTCTGCTCTGCTTCATCTCTAGG + Exonic
1033193635 7:139307699-139307721 GTGACTTCTGCGTCATTTCCTGG - Exonic
1038801648 8:30754756-30754778 GTGACCACTGCTTAATTTCCAGG - Exonic
1039720839 8:40162536-40162558 ATGAACTGTGGTTCATCCCCAGG - Intergenic
1040424561 8:47272621-47272643 CTGAACTCTGGATCATCTCGAGG - Intronic
1040872776 8:52117827-52117849 GTGATGTCTGCCTCATCTCCTGG - Intronic
1041419502 8:57650533-57650555 GTGAACATTGCTTCATTTACAGG + Intergenic
1042006141 8:64182513-64182535 CTGAGCTCTGCTTGGTCTCCTGG + Intergenic
1042908485 8:73799502-73799524 CTGAAATTTGCTTCATTTCCTGG - Intronic
1043465326 8:80500633-80500655 GTGGACTCTGCTGCATGTACGGG + Intronic
1043784835 8:84385862-84385884 GTTCACCATGCTTCATCTCCAGG + Intronic
1043835037 8:85036300-85036322 GTGAACTCTGCCTGAACTCACGG - Intergenic
1043855915 8:85264839-85264861 ATGAATTCTGTTTCATCACCCGG + Intronic
1044896975 8:96902787-96902809 GTTAACTCTCCTTCATGTCCAGG - Intronic
1045894377 8:107196421-107196443 ATGAACTCTGCTTCTCCACCAGG - Intergenic
1046660368 8:116941994-116942016 GTGAAATCTGTTTCATATCAAGG - Intronic
1047134029 8:122055154-122055176 ATGAAGTCAGCTTCATCTCTGGG + Intergenic
1047926512 8:129688014-129688036 GTGGACTTTTCTTCTTCTCCTGG - Intergenic
1048385325 8:133907228-133907250 ATGAAAGCTGCTGCATCTCCAGG + Intergenic
1048910113 8:139127032-139127054 GAGAACTCTGCAACATATCCAGG - Intergenic
1049441597 8:142612211-142612233 CTGAGCTCTGATTCTTCTCCAGG + Exonic
1049677767 8:143900079-143900101 CCCAACTCTGCTTCATCTTCGGG - Intergenic
1050239541 9:3620670-3620692 ATCAACTCAGCTTCATCTCTGGG - Intergenic
1050309843 9:4341369-4341391 ATCAACTCTCCTTCTTCTCCAGG + Intronic
1050625934 9:7503626-7503648 ATGAACTCGGCTTCATCACAAGG - Intergenic
1055334152 9:75215472-75215494 GTGTAATCTGCTTCTCCTCCTGG + Intergenic
1058969779 9:110070174-110070196 GTCAGCTCTGCTTCCTCTCAGGG - Intronic
1061550816 9:131333819-131333841 GAGAGCACTTCTTCATCTCCGGG - Intergenic
1062097012 9:134708719-134708741 TTGCACTCTGCATGATCTCCTGG + Intronic
1185466292 X:356559-356581 GTGAGCTCTGCCTCATCTGGTGG - Intronic
1186399393 X:9242695-9242717 GTGAAGCCTGCCTCAACTCCAGG - Intergenic
1186960246 X:14728704-14728726 TTGAACTCTTCTTCATTTTCAGG + Intronic
1192313514 X:70035014-70035036 GAGCACTCTGCTTCATGTCAGGG + Intronic
1193005494 X:76614188-76614210 GTGAAGTCGGCTCCATCTCAGGG + Intergenic
1194943896 X:100045385-100045407 TTGGAGTCTGCTTCATCTACAGG - Intergenic
1195083699 X:101394256-101394278 GTGATCTCAGCTCCTTCTCCTGG - Intronic
1195964276 X:110416222-110416244 CTGAACTCGGCTTCAAATCCTGG - Intronic
1195964357 X:110416841-110416863 GTGAACTCAGCTTCAAATCCTGG + Intronic
1197249735 X:124202469-124202491 GTCACCTCTGATTCACCTCCAGG + Intronic
1197267493 X:124390987-124391009 GTGAACTCTGCTTCATCTCCAGG + Intronic
1197658554 X:129145016-129145038 GTGAACTGTGCTTCTTCATCAGG - Intergenic
1197990264 X:132310055-132310077 GTGCATTCTGCTTCATATTCAGG - Intergenic
1198496766 X:137201207-137201229 GGGAACTAAGCTGCATCTCCTGG - Intergenic
1199091339 X:143696612-143696634 GTGAACTGTGATTCAGATCCAGG + Intergenic