ID: 1197268247

View in Genome Browser
Species Human (GRCh38)
Location X:124398844-124398866
Sequence TGCATGGGGGACAAAACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197268247 Original CRISPR TGCATGGGGGACAAAACAGT TGG (reversed) Intronic
901428166 1:9196738-9196760 TGCCAGGGGGAGAAAACATTCGG - Intergenic
908809366 1:67964018-67964040 TTTATGAGGGACAATACAGTGGG + Intergenic
909039783 1:70635472-70635494 TGTATGGGGGACACATCAGGTGG - Intergenic
909364394 1:74802338-74802360 TGGGAAGGGGACAAAACAGTTGG - Intergenic
910091676 1:83471841-83471863 TGTATGAGGGAAAAAAAAGTAGG + Intergenic
915433133 1:155882054-155882076 TTAATGGGGGACAAAAGAGAGGG + Exonic
915701000 1:157796579-157796601 TGCATGTGTGCAAAAACAGTAGG - Intronic
918647123 1:186917833-186917855 TGTATGTGGGGCGAAACAGTGGG + Intronic
1065400298 10:25292560-25292582 TGAATGAGGGAGTAAACAGTTGG + Intronic
1065422211 10:25557558-25557580 TGCATGCCGGACAGGACAGTAGG - Intronic
1067272846 10:44807018-44807040 TGCATGAGGTCCAAAAAAGTTGG - Intergenic
1067707896 10:48624560-48624582 TGGATGGGGTGCAAAACATTGGG - Intronic
1079249012 11:18773577-18773599 GGCATGGGGGTCACAGCAGTGGG + Intronic
1080271485 11:30455259-30455281 GGAATGGGGCAGAAAACAGTAGG - Intronic
1081008551 11:37778739-37778761 TGGATGGAGGAAAAAACAGATGG + Intergenic
1081691754 11:45083104-45083126 ACCCTGGGAGACAAAACAGTGGG - Intergenic
1084628638 11:70330137-70330159 TTCAGAGGGGACAAAAAAGTAGG - Intronic
1085838390 11:79981258-79981280 TGCATGGTGTAGAAAACACTGGG + Intergenic
1086529431 11:87766696-87766718 TGCAATGAGGACAAAGCAGTAGG + Intergenic
1087065182 11:94021315-94021337 TGCACAGGGGACAAATCTGTTGG - Intergenic
1087948930 11:104196150-104196172 TGCATGGGGGAAAGAAGTGTAGG - Intergenic
1088189734 11:107215202-107215224 TGCCTGGGTCATAAAACAGTAGG + Intergenic
1088335702 11:108701226-108701248 TGCAGGAGGAACAGAACAGTTGG + Intronic
1088600447 11:111469745-111469767 GGCAAGGGGGACAGATCAGTAGG - Intronic
1088914761 11:114219142-114219164 AGAATGGGGGAGACAACAGTAGG + Intronic
1089004645 11:115081248-115081270 TGCACTGGGGACAAAACACCAGG + Intergenic
1091614465 12:2038794-2038816 TGCATGGGGAAAAAAACATCAGG - Intronic
1092263477 12:6964267-6964289 TGGATGGGGGACGAATCACTAGG + Intergenic
1093363884 12:18268604-18268626 TGCATAGGAGGCACAACAGTGGG - Intronic
1094265685 12:28556745-28556767 TGCTGGTGGGACAAAACTGTGGG + Intronic
1095587308 12:43863541-43863563 TTCAGGGCTGACAAAACAGTTGG + Intronic
1095669134 12:44837400-44837422 TCCCTGGGGGACAAAACTGCCGG + Intronic
1097556162 12:61140084-61140106 TGCATGGGTGATAAAATAATGGG - Intergenic
1099647402 12:85376521-85376543 TACATGGTGAAAAAAACAGTAGG + Intergenic
1099673238 12:85721898-85721920 TGCATATGGGAAAAAAAAGTAGG - Intergenic
1099692455 12:85975564-85975586 TTCATGGGAGACAAAACAGAAGG - Exonic
1101251764 12:102943939-102943961 TACATGGGTGACAAAATAATCGG + Intronic
1107122418 13:36810042-36810064 TGAAGAGGGGACAAAACAGGAGG - Intergenic
1107791107 13:44003249-44003271 AGGAAGGGGGACAAGACAGTGGG - Intergenic
1110228656 13:73145831-73145853 TTCATGGGGAAAAATACAGTAGG + Intergenic
1110809865 13:79800431-79800453 AGCATGAGTGACAATACAGTAGG - Intergenic
1112198908 13:97256129-97256151 TGCAAGGCTGACAGAACAGTTGG + Intronic
1113581232 13:111430976-111430998 TTCAGGGTGGACAAAACAGTGGG - Intergenic
1115699178 14:35932732-35932754 TGCACGGGGGAGAAAAGCGTGGG - Intergenic
1117961681 14:61169672-61169694 TACATGGGAAACAAAACACTTGG + Intergenic
1127849153 15:62897902-62897924 TGCATGGGGAAGAAAGCAGAAGG + Intergenic
1129243208 15:74264076-74264098 TGCAGGAGGGACAAGAGAGTGGG + Intronic
1129783716 15:78293225-78293247 TGCTTGGGGGACAAACAAGAAGG - Exonic
1130674348 15:85938909-85938931 TGCATGGGGGACCTCGCAGTGGG + Intergenic
1134431063 16:14207068-14207090 TGCATGGGGTACAAATCCATGGG - Intronic
1138664252 16:58550626-58550648 TGCATGGCAGAAAAAATAGTAGG + Intronic
1141581795 16:85004411-85004433 TGCATGGGGGACTGGACTGTTGG - Intronic
1142696400 17:1636182-1636204 TCCATGGGGGACATACAAGTAGG - Intronic
1143086852 17:4422559-4422581 TGCAGGGGGAACAATACATTAGG - Intergenic
1143605634 17:7983729-7983751 TGGATGGGGGATGAAACCGTAGG + Intergenic
1144514594 17:15908506-15908528 TGCATGGGGGACAGAGCACAAGG - Intergenic
1145978529 17:28998036-28998058 TGCCTGGGGGACAAAGGAGTTGG + Intronic
1148766689 17:50043777-50043799 TGCATGGGGGAGGAACCAGGAGG - Intergenic
1149203491 17:54215679-54215701 TGCTTGGGGTACTAAAAAGTTGG + Intergenic
1153260730 18:3221862-3221884 TGCTTGGGGAACATAACACTTGG - Intergenic
1159422932 18:68246969-68246991 TGCATTTGGGGCAAAATAGTGGG - Intergenic
1159482039 18:69001917-69001939 TGCAAGGGGGCCATAACAGGGGG - Intronic
1162979419 19:14228960-14228982 TGCCTGGGGGGAAAAATAGTTGG + Intergenic
928168237 2:28986422-28986444 TGCGTTGGGCATAAAACAGTTGG + Intronic
929171245 2:38935019-38935041 TGAATCAGGGAGAAAACAGTAGG + Intronic
931667072 2:64617364-64617386 TCCAAGGGGGACAAGACAGGAGG - Intergenic
932571995 2:72943090-72943112 AGCCTGGAGGACAAAACAGCGGG - Exonic
933000609 2:76917759-76917781 TGTATCAGGGACAAAAGAGTGGG - Intronic
933377666 2:81500672-81500694 TGCAGGGGAGACAAAAGAATTGG + Intergenic
935627022 2:105180049-105180071 TGTATGGGGGACAGAATAGCAGG + Intergenic
941023629 2:160437057-160437079 TGAATGGGGCACTATACAGTAGG - Intronic
942009512 2:171746102-171746124 TGCATGGGAAACAGAACATTCGG - Intronic
943917941 2:193661887-193661909 TGCAAGAGGGAAAGAACAGTTGG + Intergenic
944690567 2:202154998-202155020 GCCATCGGGGACAAATCAGTCGG + Intronic
945246606 2:207723173-207723195 TCCATGGAGAACAAAGCAGTTGG + Intronic
1169716632 20:8626529-8626551 TGCTTGGGGGAGAAAAAAGCCGG + Intronic
1173516471 20:43668117-43668139 TGCCTGGGAGACAGGACAGTGGG + Intronic
1183035521 22:35138304-35138326 GGCTTGGGAGACAAAACTGTGGG + Intergenic
1183165333 22:36143222-36143244 TGAATGTGGGACAAAACACATGG - Intronic
950425106 3:12920938-12920960 TGCAATGGGGACATCACAGTGGG + Intronic
959874551 3:111366928-111366950 TGCATGATGAACAAAACAGCAGG + Intronic
959983327 3:112543898-112543920 TGAATGGGGAAGAAAACAGCTGG + Intronic
960427509 3:117527053-117527075 TGACTGGGTGAGAAAACAGTCGG + Intergenic
963475733 3:145801354-145801376 TGTATTGGGGAGAAAACACTGGG - Intergenic
963703238 3:148653304-148653326 TGCGTGTGGGACAAAAGAGATGG - Intergenic
966636753 3:182143251-182143273 TGAATAGGGGACATAACAATGGG + Intergenic
967090381 3:186129930-186129952 AGGATGGGGCACAAAACAGGAGG - Intronic
969203492 4:5624146-5624168 TGCCTGGGAGAAAAAGCAGTTGG + Intronic
970254213 4:14150526-14150548 TGCATGGGGAACACAAGAGTAGG - Intergenic
970390611 4:15607682-15607704 TGATTGGTAGACAAAACAGTGGG - Intronic
970963398 4:21898997-21899019 TGGAAAGGGGAGAAAACAGTAGG + Intronic
976768513 4:88623960-88623982 AGCAGGGGGAACAAAACAGTTGG - Intronic
986625005 5:9715567-9715589 TGCATAGGGGACAGGACAGGTGG + Intergenic
988453851 5:31370286-31370308 TGCCTGTGGGAGAAAACAGAGGG - Intergenic
989766731 5:45094721-45094743 TACATGGCTGACAACACAGTAGG - Intergenic
991300710 5:65126601-65126623 TGCAGGGGTGAGAAAACAGTAGG + Intergenic
992653481 5:78885221-78885243 AGAATGGAGGACAAAACAGCAGG - Intronic
995265910 5:110160534-110160556 TGATTGGGGGAAAAATCAGTTGG + Intergenic
996394486 5:122999629-122999651 TGACTAGGGGACAAGACAGTGGG - Intronic
996897046 5:128497407-128497429 TGGATGAGGAACAAAATAGTGGG + Intronic
998616902 5:143751177-143751199 TTCATGGGGAAGAAAAGAGTTGG + Intergenic
999339882 5:150761234-150761256 TGCCAGGTGGGCAAAACAGTGGG - Intergenic
999534882 5:152505283-152505305 TTCTTGGGTGACAAAACACTGGG - Intergenic
1000230789 5:159313346-159313368 GGCATCGGGGAGAAAACAGTTGG + Intergenic
1000247648 5:159462157-159462179 AGCATGGGGAACAAAACACAAGG + Intergenic
1001071533 5:168589332-168589354 GGCATTGGGAACAAAAGAGTTGG + Intergenic
1003915439 6:10782480-10782502 TGAATGGGAGAGAAAACAGAAGG - Intronic
1005867790 6:29949233-29949255 TGCCTGGGGGACACACCTGTTGG + Intergenic
1006709967 6:36059878-36059900 TGCATGGGCGATAAAAGAGGAGG - Intronic
1008109863 6:47479935-47479957 TGCATAGGGGAAAAATCAGTAGG + Intronic
1009279907 6:61735629-61735651 GGAATGGTGTACAAAACAGTTGG - Intronic
1010862319 6:80927759-80927781 TGCATGGAGGTCAAAGGAGTTGG - Intergenic
1014767404 6:125422508-125422530 TGCATGCGTGGGAAAACAGTAGG + Intergenic
1014940940 6:127437802-127437824 TCCAGGGGGGAAAAAAAAGTTGG - Intergenic
1016925795 6:149346420-149346442 TGCATGGGGATCAGATCAGTTGG + Intronic
1018937720 6:168284494-168284516 AGCATGGGGGAGGAAACAGCTGG - Intergenic
1019555141 7:1625558-1625580 GGCATGGGGGAGAGAGCAGTGGG - Intergenic
1021976012 7:26011832-26011854 TCCATTGAGCACAAAACAGTGGG - Intergenic
1026674536 7:72417842-72417864 TGCATGGGGCTCAAAACACAAGG - Intronic
1030787533 7:113681097-113681119 TCCAGGGGGCAAAAAACAGTTGG + Intergenic
1031092058 7:117369769-117369791 TGCATGGTGGGGAAAACAGTGGG + Intronic
1031646371 7:124231017-124231039 TTCAGGGGGGAAAAAACAGGTGG - Intergenic
1032319212 7:130869743-130869765 TGCCTGCGAGAGAAAACAGTAGG + Intergenic
1037122495 8:15305647-15305669 AGAATGGCGGAAAAAACAGTAGG + Intergenic
1040706565 8:50135833-50135855 TACCTGGGAGACAAAACAATCGG - Intronic
1042977367 8:74484831-74484853 TGTATAGGGGATAAAACAGAAGG - Intronic
1043450518 8:80361663-80361685 CTCATGGGGGAAAAAAAAGTTGG + Intergenic
1043653562 8:82631918-82631940 TGGTTGGGGGACAAAGCATTTGG - Intergenic
1046519350 8:115304387-115304409 TCCATGGGGGAAAAATCATTAGG - Intergenic
1048282481 8:133115412-133115434 TGCATGGGGGGAAACTCAGTTGG + Intronic
1048330343 8:133466643-133466665 GGGATGGGGGACAGAGCAGTAGG + Intronic
1049105870 8:140612379-140612401 TGCATGATGGACAAAACACATGG + Intronic
1049108194 8:140626487-140626509 TGCATGTGGGACACAACTGCAGG + Intronic
1049915328 9:311934-311956 TGCCTGTGAGAGAAAACAGTGGG - Exonic
1050974743 9:11923747-11923769 TGAATGGGGTACAATACTGTTGG - Intergenic
1051386413 9:16513877-16513899 TTCATGGGGTTCAAAACATTAGG + Intronic
1051698092 9:19789880-19789902 TGGATGGGGGAGAGAACAGAAGG - Intergenic
1054859487 9:69934005-69934027 TGCATGGAGAACAAGAAAGTTGG + Intergenic
1058195185 9:101965648-101965670 TGCTTGAGGGACATAACAGAAGG - Intergenic
1060764075 9:126280804-126280826 GGCATGGAGGACAAGACACTAGG + Intergenic
1060820299 9:126658031-126658053 TGCTTGGGGGAATAAGCAGTGGG + Intronic
1186220238 X:7342313-7342335 TGCATGGAGGAGAACACAGCAGG + Intronic
1189324320 X:40103783-40103805 TGCATGGCGGAAAAAAAAATTGG - Intronic
1190980389 X:55452376-55452398 TGCCTCGGGGACGAAAGAGTCGG + Exonic
1192077930 X:68018812-68018834 TGCAGAGGGGAGAAAAAAGTGGG + Intergenic
1193263983 X:79445839-79445861 TGCCTGGGTGACAAAATAATTGG + Intergenic
1193573075 X:83168570-83168592 TGTATGGGGGAGAAAAAATTGGG - Intergenic
1197268247 X:124398844-124398866 TGCATGGGGGACAAAACAGTTGG - Intronic
1197859777 X:130958118-130958140 GGCATGGGTGAAAACACAGTTGG - Intergenic