ID: 1197275910

View in Genome Browser
Species Human (GRCh38)
Location X:124478772-124478794
Sequence TCTACTAAGTGGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 301}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197275907_1197275910 6 Left 1197275907 X:124478743-124478765 CCTTAAAGAAATTCATTAAACGT 0: 1
1: 0
2: 0
3: 18
4: 258
Right 1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG 0: 1
1: 0
2: 2
3: 27
4: 301
1197275906_1197275910 11 Left 1197275906 X:124478738-124478760 CCTCTCCTTAAAGAAATTCATTA 0: 1
1: 0
2: 2
3: 31
4: 322
Right 1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG 0: 1
1: 0
2: 2
3: 27
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197275910 Original CRISPR TCTACTAAGTGGAAGGAAGA AGG Intronic
900893473 1:5466410-5466432 TCTACTAATAGCAAGGAAAAAGG + Intergenic
901404173 1:9034930-9034952 TCTAGTAAATGGATGGCAGATGG - Intergenic
901957031 1:12793720-12793742 TTTACTCAGTGGAAGGTAAAGGG + Intronic
901965036 1:12859502-12859524 TTTACTCAGTGGAAGGTAAAGGG + Intronic
902020889 1:13344800-13344822 TTTACTCAGTGGAAGGTAAAGGG - Intronic
903844205 1:26267788-26267810 TCTACTATGGGGAAGGCAGAGGG - Intronic
904889905 1:33771969-33771991 TCATCCAAGAGGAAGGAAGAAGG + Intronic
904967836 1:34392534-34392556 TGTACTTAGTGGCAGGAATAGGG + Intergenic
904975373 1:34452093-34452115 TCTCCTGAGTGGAGGGAGGATGG - Intergenic
905490723 1:38341595-38341617 TCTATTAAGGGGAATAAAGATGG + Intergenic
905743811 1:40395776-40395798 TCTACTAGGAGAAAGGAAGGAGG - Intronic
906313106 1:44767951-44767973 ACTCTTAAGTAGAAGGAAGATGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
909170995 1:72295259-72295281 TGTACTTAGTGGAAAGAATAAGG + Intergenic
909980095 1:82089151-82089173 TCAACCATGTGGCAGGAAGAAGG + Intergenic
910259150 1:85279150-85279172 TGTGCTAAGGGGAAAGAAGATGG + Intergenic
911421685 1:97650095-97650117 TCCCCTAAGTGGAGGGAGGAGGG - Intronic
912212699 1:107572176-107572198 TGTATTAACTGGAGGGAAGATGG - Exonic
912956788 1:114159614-114159636 TCTACCAAATGGATGGAAGCTGG - Intergenic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
914384054 1:147150421-147150443 TCTACTTACTGGTAGGAATAGGG + Intergenic
914451695 1:147798451-147798473 TATAGTAAGTGGAATCAAGATGG + Intergenic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
917213237 1:172651775-172651797 GCTAGTAAAAGGAAGGAAGAGGG + Intergenic
917891687 1:179444948-179444970 TCTAAAGAGTGAAAGGAAGAGGG - Exonic
918212077 1:182359982-182360004 TCTGCTGAGCGCAAGGAAGAGGG + Intergenic
918899070 1:190389293-190389315 TCTACTAAGAGGAAGAAATGGGG - Intronic
919173372 1:193987390-193987412 TCATTTAATTGGAAGGAAGATGG + Intergenic
919415811 1:197307842-197307864 GCTAGTAAGTGGAAGGACCAGGG - Intronic
921251852 1:213305566-213305588 TTCACTCAGTGGAAGGGAGATGG + Intergenic
922360362 1:224816019-224816041 TTTACTTGGTGGAAGGCAGAAGG + Intergenic
922596311 1:226816119-226816141 GCTCCTCAGAGGAAGGAAGATGG - Intergenic
923593985 1:235345997-235346019 TGTACTGAGAGGAAGAAAGAGGG + Intergenic
923824980 1:237490170-237490192 ACTACTAAGTGGGAGGAAGGGGG + Intronic
924206045 1:241712409-241712431 TCTGCTAAGAGGAAGGAAAAAGG + Intronic
1062825295 10:563397-563419 TCTACTAATTTTAAGGAAGGGGG - Intronic
1062942912 10:1438220-1438242 TCTCCTCAGTGGACGGAAGCAGG + Intronic
1063565145 10:7166511-7166533 TCTACTAAGTGGCAGGCACTTGG + Intronic
1063868647 10:10394604-10394626 TATACTCAGTGGAAGGCACACGG - Intergenic
1064744212 10:18463184-18463206 TCTTCTAACAGGAGGGAAGAAGG - Intronic
1065029250 10:21568334-21568356 TGTACTTAGTGGGAGGAATAGGG + Intronic
1065316710 10:24470930-24470952 TCTACGAAGTTTAAGAAAGAAGG + Intronic
1065489638 10:26269854-26269876 TTTACTAAGTGGCAGGCAGCAGG + Intronic
1068572429 10:58645053-58645075 ACTACAAAGTGTAAGAAAGAGGG - Intronic
1068920601 10:62479239-62479261 TCTTCTACGTGGGAGGAATATGG - Intronic
1069080094 10:64079454-64079476 TTGACTAAGTGGAGAGAAGAGGG + Intergenic
1069175350 10:65283309-65283331 TCTAATAAGTGGAGGGAGGCAGG - Intergenic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1070613408 10:77950128-77950150 TCTGCTAAGGGGAAGGGAGAGGG - Intergenic
1071427877 10:85577473-85577495 TTTTCTAAGTGGACGGATGATGG + Intergenic
1072262688 10:93696140-93696162 TCTAAAAGGTGGAAGGAAGAAGG + Intronic
1073458338 10:103651139-103651161 TCTGCATAGTGGAAAGAAGAAGG + Intronic
1074984117 10:118642217-118642239 ACTGCTAAGAGGAAGGGAGATGG + Intergenic
1075122638 10:119675615-119675637 TCTGCACAGTGTAAGGAAGAAGG + Intronic
1077900685 11:6485441-6485463 TAAACCAAGTGGAAGGAATATGG - Intronic
1079657447 11:23000533-23000555 TCTATTAGGCGGGAGGAAGAGGG + Intergenic
1081282514 11:41227163-41227185 TATGGTAAGTGGAAGGAATAAGG - Intronic
1081637482 11:44730066-44730088 TCCACTGAATGGAAGGCAGAAGG - Intronic
1081662398 11:44896087-44896109 TCTACTCAGTGGATGGTAGATGG + Intronic
1081662552 11:44896889-44896911 TCTACTGAGTGGATGGTAGGTGG + Intronic
1083885068 11:65569383-65569405 GGTTCTACGTGGAAGGAAGAGGG + Intergenic
1085618533 11:78020424-78020446 TCTGCTGACTGGAAGGGAGAAGG + Intronic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1087119931 11:94563109-94563131 TCTGCCCAGTGGATGGAAGAGGG + Intronic
1087370647 11:97279642-97279664 TCTCCTAAGCATAAGGAAGAAGG - Intergenic
1087423547 11:97963542-97963564 TTTAATAAGCGAAAGGAAGAAGG + Intergenic
1090083384 11:123629526-123629548 TCAACTAAGGGGGAGGAAGTGGG + Exonic
1093384355 12:18533121-18533143 TATACTCAGTGGGAGGAACAAGG + Intronic
1093634061 12:21443228-21443250 AATTCTAAGTGGAAGGAAAATGG - Intronic
1094248214 12:28327469-28327491 TTTACATAGTGCAAGGAAGATGG - Intronic
1095512652 12:42969915-42969937 TAAAATGAGTGGAAGGAAGAAGG + Intergenic
1095696076 12:45145407-45145429 TCTATTAACTGGAGAGAAGATGG + Intergenic
1095798050 12:46241917-46241939 TCTACAAAATGGAAGGAAATAGG + Intronic
1097966961 12:65591525-65591547 TTTACCAAGTGGAGGAAAGAGGG - Intergenic
1098455957 12:70672973-70672995 TCTTCTAGGTAGAAGGGAGAAGG + Intronic
1099051680 12:77788679-77788701 TCTACATAATAGAAGGAAGAAGG - Intergenic
1099205947 12:79727009-79727031 TGTACTTAATGGAAGGAATAGGG - Intergenic
1099351217 12:81571293-81571315 TCTTGGGAGTGGAAGGAAGAAGG + Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101244554 12:102873222-102873244 ACTACTAACTGCAAAGAAGATGG - Intronic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1102122611 12:110454261-110454283 TCTGCAAAGTGGAGGGAAAAGGG - Intronic
1102768899 12:115456315-115456337 GCTACTAAGTGGAAGGATTCTGG - Intergenic
1103481770 12:121254722-121254744 TTTGCCAAGTGGCAGGAAGAAGG + Intronic
1105561433 13:21495832-21495854 TCTCCTAAAAAGAAGGAAGAAGG - Intronic
1106402776 13:29445551-29445573 TATACCAAGTGCAGGGAAGATGG - Intronic
1106580586 13:31014714-31014736 TTTACTGGGTGGAAGGAAGGAGG - Intergenic
1107356497 13:39572807-39572829 TCTCCTAAGTGGAAGGATTCTGG + Intronic
1108100378 13:46947995-46948017 TCTACTGAGTGGTTGTAAGAAGG - Intergenic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1111196079 13:84875599-84875621 TCTATTAAGTGGGAGGAGAACGG + Intergenic
1111973200 13:94938758-94938780 TGTACTAAGTGAAAAAAAGATGG - Intergenic
1113442464 13:110339949-110339971 TACACTGATTGGAAGGAAGAAGG + Intronic
1116611768 14:47083424-47083446 TATACTTAGTGAAAGGAATAGGG + Intronic
1118850546 14:69579888-69579910 TCTACTGAGAGGAAGGAGAATGG - Intergenic
1120060323 14:79975209-79975231 TCTAATAAGTCAAAGGAGGAAGG - Intergenic
1121149632 14:91620284-91620306 ACTACTTTGTGGAAGGAAGTTGG - Intronic
1122357146 14:101130102-101130124 CCTCCTGAGTGGAAGGAAGGAGG - Intergenic
1125080084 15:35662450-35662472 TCAACTTAGAGGAAGGAGGATGG + Intergenic
1126104479 15:45138583-45138605 TTTACTAAGGGGAAGGGAGTGGG + Intronic
1126119186 15:45236183-45236205 CCTATTAAGTGGGAGGAAAATGG - Intergenic
1126266402 15:46759316-46759338 TCTATAAAGTGGAAGGCACATGG + Intergenic
1127381761 15:58436742-58436764 ACTTCCAAGTGGAGGGAAGAAGG + Intronic
1127416161 15:58759387-58759409 TATAATAACTGGAAGGGAGACGG - Intergenic
1127852135 15:62923156-62923178 TAAACAAAGTGGAAGGAAGGTGG - Intergenic
1127894655 15:63286084-63286106 TCTACAGAGTGGAAGGTACAAGG + Intronic
1127979067 15:64021104-64021126 TCTACTGAGGGGAAAGATGAAGG - Intronic
1128095838 15:64954778-64954800 ACAACTAAGGAGAAGGAAGAAGG - Intronic
1129409522 15:75341499-75341521 TGTACTTAGTGGGAGGAATAGGG - Intronic
1135616201 16:23913155-23913177 TCTACATACTGGATGGAAGATGG - Intronic
1135961968 16:27002544-27002566 TGTACTTAGTGGAAAGAAAAGGG - Intergenic
1138737436 16:59266625-59266647 CCTACTAAGTAGATGAAAGATGG + Intergenic
1140692307 16:77496338-77496360 TCTACTCAGGAGCAGGAAGAAGG + Intergenic
1140917605 16:79508082-79508104 TCCACCACGGGGAAGGAAGAAGG + Intergenic
1141062810 16:80889973-80889995 TTTACTAAGTGGAAGGTACAGGG - Intergenic
1143268557 17:5658768-5658790 TCTGCTGAATGGCAGGAAGATGG + Intergenic
1143986608 17:10919948-10919970 TCTACCAAGTGTAAGTATGAGGG - Intergenic
1145239954 17:21235339-21235361 TCTACTAACTGTAAAGAACACGG - Intergenic
1146875678 17:36408510-36408532 TGTACTTAGTGGGAGGAATAGGG + Intronic
1147063709 17:37904359-37904381 TGTACTTAGTGGGAGGAATAGGG - Intergenic
1147398921 17:40167309-40167331 TCTCCTAAATGTAAGGTAGAAGG + Intronic
1147419178 17:40313598-40313620 TGAACTAATTTGAAGGAAGAAGG - Intronic
1148253048 17:46102722-46102744 TTTGTTAAATGGAAGGAAGAAGG - Intronic
1150153934 17:62834837-62834859 TGTACTTAATGGAAGGAATAGGG - Intergenic
1150223913 17:63512471-63512493 TCTATAAAATGGAAGGAAGTAGG - Intronic
1151335683 17:73438268-73438290 TCTACAAAGTGGCAGGAAGGTGG - Intronic
1152011158 17:77719117-77719139 TCCACTAAATGGAAGAAAAAGGG - Intergenic
1152167395 17:78718944-78718966 CCTACTAGGTGGAAGGCAGCGGG + Intronic
1153153888 18:2127363-2127385 TCTGCTAAAAGGAAGGAGGAAGG - Intergenic
1153385776 18:4493770-4493792 ACAACTAAGTGGATGGCAGATGG - Intergenic
1154100135 18:11465113-11465135 TGTACTTAGTGGGAGGAATAGGG + Intergenic
1155280519 18:24234982-24235004 TATAGTAAGTGGAGGGAACAAGG + Intronic
1155577407 18:27263283-27263305 TCTACTAAATGGTAGAAGGAAGG + Intergenic
1155581626 18:27314623-27314645 TATTGTAAGAGGAAGGAAGAAGG + Intergenic
1156544059 18:37946226-37946248 TTTTCTAAGTGGGAGGAAGAAGG - Intergenic
1156544731 18:37953257-37953279 TCTCCTAGGTGGAAGAAAGATGG - Intergenic
1157125723 18:44953978-44954000 TGCACTAAGTGGAAGGAGGCAGG + Intronic
1157888350 18:51390191-51390213 TATACTAAATGGAAGGAAAGGGG + Intergenic
1158740673 18:60138786-60138808 TCTACGAGGTTGGAGGAAGAGGG + Intergenic
1159518566 18:69489038-69489060 TCTACTAAATGGAAGATAGGTGG + Intronic
1160038838 18:75325347-75325369 TTTACTTAGTGGGAGGAAAAGGG - Intergenic
1160296888 18:77646756-77646778 TATGCTCAGTGGGAGGAAGAGGG + Intergenic
1162911239 19:13848926-13848948 TTTTCCAAGTGGAAGGTAGAGGG - Intergenic
1165664772 19:37618838-37618860 TGTACTTAGTGGGAGGAACAGGG - Intronic
1167270324 19:48502382-48502404 GCTACTAAGGGGAAGGGGGAAGG - Intronic
925715684 2:6782424-6782446 ACAAGTAAGTGGAAGGAATAAGG - Intergenic
928174828 2:29026517-29026539 TTTTCTAGGTGGAGGGAAGATGG + Intronic
929027256 2:37616465-37616487 GCTACCAAGAGGAAGGGAGAAGG + Intergenic
929428313 2:41866254-41866276 TAGACTAAGTGGGAGGAAGAAGG - Intergenic
931903180 2:66813947-66813969 TGTACTTAGTGGGAGGAATAGGG + Intergenic
933630594 2:84651780-84651802 TGTACTTAATGGAAGGAATAGGG + Intronic
933787331 2:85853860-85853882 TCTTCTGCGTGGAAGGAAGCAGG + Intronic
934663823 2:96156939-96156961 TCAAATAAGGGGAAGAAAGATGG - Intergenic
935429366 2:102958016-102958038 TGCACTAAGTGGAAGAAAGGTGG - Intergenic
935624225 2:105156015-105156037 TCTGAAAAGGGGAAGGAAGAAGG + Intergenic
936711442 2:115136055-115136077 TTTAAGAAGTGGAAGGAACAGGG + Intronic
936975041 2:118210461-118210483 TGTACTCAGAGGAAGGAATAAGG - Intergenic
937126017 2:119475465-119475487 TCTACAGAGTGGAAGGCAGGGGG - Intronic
938825529 2:135001528-135001550 TCTCCTATTTGAAAGGAAGATGG + Intronic
939595019 2:144112339-144112361 TCTAATAAGTGGAGACAAGAAGG + Intronic
940015061 2:149095670-149095692 TCAAGTAAGTGAAAGGGAGAGGG + Intronic
940950594 2:159668677-159668699 TAAACTAAGTAGAAGGAAGAAGG - Intergenic
942062960 2:172244742-172244764 ACTGCCAAGTTGAAGGAAGAGGG - Intergenic
942455293 2:176134128-176134150 TCTAGTCAGTGTAAGAAAGAAGG - Intergenic
946525750 2:220518153-220518175 TGTTCTAAGGGGAAGGAAGATGG - Intergenic
946989429 2:225311523-225311545 TCTTATAAGTGGGAGGCAGAGGG + Intergenic
1169489965 20:6063058-6063080 TCTTATAAGAGGGAGGAAGAGGG + Intergenic
1170664906 20:18378390-18378412 TTTTCTGAATGGAAGGAAGAGGG - Intergenic
1171244994 20:23603767-23603789 GCTACTTAGGGGCAGGAAGACGG - Intronic
1172941081 20:38655185-38655207 TCTTCTGAGAGGAAGGAGGATGG + Intergenic
1173671616 20:44803060-44803082 TCTGCTAAGTGGAATGAAAATGG - Intronic
1173694723 20:44999229-44999251 TTTTCTAAGTGGAAAGAACAAGG + Intronic
1174239853 20:49124700-49124722 CCTACTAAATGAAAGGAAGCGGG + Intronic
1176897108 21:14393074-14393096 ACCACTGAGTGGAATGAAGAAGG - Intergenic
1177598289 21:23275639-23275661 TGTACAAGGTGGTAGGAAGAAGG - Intergenic
1181824326 22:25502097-25502119 TGTACTTAGTGGGAAGAAGAGGG + Intergenic
1182262571 22:29085328-29085350 TGTAGTAAGGGGAATGAAGAGGG - Intronic
1183235354 22:36612751-36612773 TCTGCTAAGTGGTAGCAAGCTGG - Intronic
1183998012 22:41650606-41650628 TCTTCTAAGGAGCAGGAAGATGG - Intronic
1184046971 22:41977685-41977707 TCTTCAGGGTGGAAGGAAGAGGG + Intronic
1185215549 22:49598111-49598133 TCTACCTAGAGGCAGGAAGATGG - Intronic
949200060 3:1366555-1366577 GCTACTTTGTGGAAAGAAGAGGG - Intronic
949285636 3:2400514-2400536 TCCACCAAGTGGCAGGAGGAAGG - Intronic
952022782 3:29042537-29042559 TCTGAAAAATGGAAGGAAGAAGG - Intergenic
952085559 3:29816186-29816208 TCTGTTAACTGGAAAGAAGAGGG - Intronic
952885133 3:38007338-38007360 TCAACTATGTGCAAGGAAGGTGG + Intergenic
954237795 3:49270288-49270310 GCTAATAAGAGGAAGGAATATGG - Exonic
954940733 3:54369940-54369962 TCTACTATATGGAAGAAACACGG - Intronic
955219480 3:57011881-57011903 TGCACTATGAGGAAGGAAGAAGG + Intronic
955265578 3:57440517-57440539 ACTACTAAGGGGAAGAGAGAGGG + Intronic
955591107 3:60536721-60536743 TCTCCGAAGTGGGAGGGAGATGG + Intronic
956088931 3:65643447-65643469 TGTACTTAGTGGGAGGAATAGGG - Intronic
956630872 3:71315506-71315528 ACTACTAAGTGGAAGGAATAAGG + Intronic
959392006 3:105786913-105786935 TCTAATAAATGGAAGTAAAATGG - Intronic
960332112 3:116373410-116373432 TCTAGGAACTGGAAAGAAGAAGG + Intronic
960332473 3:116378771-116378793 TCCACTAATTGGGAGGAAGGTGG - Intronic
960624652 3:119670072-119670094 TCCACAAAGTAGAAGGCAGAAGG + Intronic
961108969 3:124267660-124267682 TCTCCTAAGAGGAAGGAAGGAGG - Intronic
961437119 3:126926992-126927014 TATACAAAGTGCAATGAAGAGGG + Intronic
963563055 3:146891514-146891536 TATACTTAGTGGAAGGCATAAGG - Intergenic
963637089 3:147811554-147811576 TTTACTAGGTGGATTGAAGAAGG + Intergenic
964538827 3:157756721-157756743 TTTACAAAGTGGAAGGAAGCAGG + Intergenic
964640658 3:158906786-158906808 TGTGATAATTGGAAGGAAGAAGG - Intergenic
964670387 3:159219006-159219028 CCTTCTAAGAGGAAGGCAGAGGG - Intronic
965032486 3:163391098-163391120 CCTGCTAAGTGGTAGGAATAAGG - Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
972426058 4:38934160-38934182 AGTACTAATTGGAAAGAAGAGGG + Intronic
973023293 4:45232391-45232413 TGTACTCAGTGGAAGGATGGAGG - Intergenic
974030771 4:56774303-56774325 AGTTATAAGTGGAAGGAAGAAGG - Intergenic
974855757 4:67458963-67458985 TGTACTTAGTGGAGGGAATAGGG - Intergenic
975265427 4:72359962-72359984 TCAAATAAGAGGAAGGCAGAAGG + Intronic
975565154 4:75746369-75746391 TCTAGTAACTGAAAGGAAGAAGG + Intronic
978135153 4:105248817-105248839 GCCACTTAGAGGAAGGAAGAAGG - Intronic
978406481 4:108384802-108384824 TGTACTTAGTGGGAGGAACAGGG - Intergenic
979426155 4:120570488-120570510 TCTACTAATGTGAAGGAGGAGGG - Intergenic
979743666 4:124181878-124181900 TCTACTATCTGGATGGAAGGAGG + Intergenic
982977710 4:162087656-162087678 TCTACAAAGTCGAATGACGATGG - Intronic
984058472 4:174960823-174960845 TATACTATGTGCAAGGAAGTAGG + Intronic
985654753 5:1124526-1124548 TATCCCAAGTGGAAGGAAAATGG + Intergenic
986061772 5:4198460-4198482 CCTACTCATTGGAAGGAAAAGGG + Intergenic
986134170 5:4958814-4958836 TCTGTGAAATGGAAGGAAGAAGG + Intergenic
987331598 5:16862115-16862137 TCTGCTGAGTGGTGGGAAGAGGG - Intronic
987389187 5:17360215-17360237 TTTACAAAGGGTAAGGAAGAAGG - Intergenic
988111003 5:26819276-26819298 TCTACTATGTGTGAGGAAGAAGG + Intergenic
988330469 5:29832086-29832108 TCTACTAAGAAAATGGAAGAAGG + Intergenic
988518435 5:31924849-31924871 TCTACTAGGCAGAAGGAATAAGG - Intronic
990441688 5:55852532-55852554 TCCACTAAGTAGGAGGAATAAGG - Intronic
990444664 5:55882922-55882944 TCTGCTATATGGAACGAAGATGG - Intronic
990527160 5:56639232-56639254 CCTTCTAGGTGGAAGGAAGGAGG - Intergenic
990530516 5:56669162-56669184 TGTCCTAGGTGCAAGGAAGAAGG - Intergenic
992039263 5:72813277-72813299 TATACTTAGTGGGAGGAATAGGG + Intergenic
992208128 5:74451168-74451190 TGTACTTAGTGGGAGGAATAGGG - Intergenic
992946552 5:81817082-81817104 TGTACTTAGTGAAAGGAATAGGG - Intergenic
994445650 5:99870171-99870193 ACTACAAAGTGGAAGCATGAAGG + Intergenic
998298400 5:140994152-140994174 TCAACGAAGGGGAAGGAAGCTGG + Intronic
999200752 5:149814583-149814605 ACTACTGAGTGGAAGGAAGCTGG - Intronic
999645712 5:153715141-153715163 TCTGCAAAATGGAAGTAAGATGG + Intronic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000221729 5:159221052-159221074 TCTCCTAAGTGGAAGAGAGAAGG - Intergenic
1003331116 6:5129540-5129562 TCTTCTAAGAGGAAGGCAGAGGG - Intronic
1003339911 6:5209984-5210006 TCTTCTACCAGGAAGGAAGAAGG + Intronic
1005680056 6:28197666-28197688 TGTACTTAGTAGAAGGAACAGGG + Intergenic
1005719913 6:28590931-28590953 TCAACAAAGTGGAAAGAAGGTGG - Intronic
1007244337 6:40449520-40449542 TCTACTGATTGGAATGTAGATGG + Intronic
1007788609 6:44296626-44296648 TCCACTAAGAGGAAGGGAGGAGG - Intronic
1007793202 6:44325783-44325805 ACTATGAAGGGGAAGGAAGAAGG + Intronic
1008601489 6:53100499-53100521 TCTGCTAAGGGGTAGGAAGGGGG - Exonic
1008955699 6:57213619-57213641 TATACTTAGAGGAAGGAATAGGG - Intronic
1010075571 6:71793115-71793137 GCTACTTAGTGGAAGAAACAAGG - Intergenic
1010506512 6:76666705-76666727 TCAAACAAGTGGAAGAAAGAAGG + Intergenic
1010941299 6:81921025-81921047 TGTACTTAGTGAAAGGAAGAGGG - Intergenic
1012071264 6:94619909-94619931 TCTACTAAGTGGTAGGCACGGGG - Intergenic
1012385664 6:98679083-98679105 TATACTAAGGGGAATGAACATGG - Intergenic
1014096180 6:117464618-117464640 TATACTTAGAGGAAGGAATAAGG + Intronic
1014903198 6:126993832-126993854 GCTACAAAGTTGAAGGAAGGTGG + Intergenic
1017131796 6:151114277-151114299 TCTATAAAGTGAAAGGAATAAGG + Intergenic
1017822691 6:158060686-158060708 GCTGCTAATTTGAAGGAAGAAGG + Intronic
1020940472 7:14527934-14527956 TCTGCTATATGGAAGTAAGATGG + Intronic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1022128022 7:27376698-27376720 GCTACTTAATGGAGGGAAGATGG - Intergenic
1022505732 7:30907833-30907855 TCTGCTAAGTGCAGGGCAGAGGG - Intergenic
1022564123 7:31380061-31380083 TTTAATAAGTGGAAAGAATATGG + Intergenic
1022711570 7:32855615-32855637 CCAGCTGAGTGGAAGGAAGAGGG - Intergenic
1022913085 7:34919343-34919365 CCAGCTGAGTGGAAGGAAGAGGG + Intergenic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1024927469 7:54632572-54632594 TATACTAAGCAGAAGGAATAGGG + Intergenic
1028703559 7:93812309-93812331 TCAACTAAGAGGAATGAGGAAGG - Intronic
1032644346 7:133805816-133805838 TTTTATAAGTTGAAGGAAGAAGG + Intronic
1034676396 7:152895465-152895487 TCTACTGATGGTAAGGAAGAAGG + Intergenic
1038915902 8:32022566-32022588 TCTACTAACAGCAAGGGAGAGGG + Intronic
1039243492 8:35582491-35582513 ACAACTGAGTGGAAGGAAGAAGG - Intronic
1040662664 8:49594212-49594234 TCTACTAAGTGGGAAAGAGATGG + Intergenic
1040963055 8:53055025-53055047 TGTACTGAGTGGGAAGAAGAGGG + Intergenic
1041654958 8:60339809-60339831 TCTACATTGTGGAAGGAATATGG - Intergenic
1041864932 8:62561256-62561278 TCTAAAAAGTGGAGAGAAGATGG - Intronic
1041870436 8:62627972-62627994 TTTACTGAGTGCCAGGAAGAAGG - Intronic
1042737789 8:72008180-72008202 TCTACTAGGAGGAAAGAAGGGGG + Intronic
1043276987 8:78410262-78410284 TCTAGTAAGTGAAAGGGAGAAGG + Intergenic
1043624353 8:82237290-82237312 TCTATTTATTGGAAGGAAAAAGG - Intergenic
1045103303 8:98866820-98866842 TGTCCTAAGTGGAAGGGAGTGGG + Intronic
1045394756 8:101749863-101749885 TGTACTATGTGGAAGTAAAAGGG - Intronic
1045771119 8:105741869-105741891 ACTACTAAAATGAAGGAAGAAGG + Intronic
1046148479 8:110192725-110192747 TCTACTAATTAAAAAGAAGAAGG - Intergenic
1046341303 8:112859834-112859856 TTTATTAAGTAGAAGAAAGATGG - Intronic
1046905340 8:119566359-119566381 TTTAATAAGGGGAGGGAAGAGGG - Intronic
1047219050 8:122903982-122904004 CCTGAAAAGTGGAAGGAAGAAGG + Intronic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1048899631 8:139024984-139025006 TCTACAAACAGGGAGGAAGATGG + Intergenic
1049442410 8:142615379-142615401 ACTTCTAAGGGGATGGAAGAGGG + Intergenic
1051269007 9:15336766-15336788 CCTAATACTTGGAAGGAAGATGG - Intergenic
1051467713 9:17399592-17399614 TTTATAAAATGGAAGGAAGATGG - Intronic
1052167556 9:25351797-25351819 GCTACTAAGAGGAGGGAGGAAGG - Intergenic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1053922255 9:43007290-43007312 TCTAGAAGGTGGAAGGCAGAAGG + Intergenic
1054707062 9:68473465-68473487 GCTACTAAGTGGTAAAAAGAAGG - Intronic
1055086928 9:72323896-72323918 GCTTCTAAGAGGAAGGTAGAAGG - Intergenic
1055360219 9:75481624-75481646 TCTTTGAAGTGGAAGAAAGATGG + Intergenic
1055689273 9:78811730-78811752 TCTCCTAAGTACAAGGGAGAGGG + Intergenic
1056732720 9:89179739-89179761 TCTCCTAACTGAGAGGAAGAAGG - Intergenic
1056875968 9:90331059-90331081 CCTAGGAAGTGGCAGGAAGATGG + Intergenic
1058124465 9:101175874-101175896 TGTACTTAGTGAAAGGAATAGGG - Intronic
1058222833 9:102324289-102324311 TTTAACAAGTGGAAGAAAGAGGG + Intergenic
1058788210 9:108413021-108413043 TCCACGAAGTGGAATGTAGAAGG + Intergenic
1186349680 X:8729693-8729715 TTTAATAATTAGAAGGAAGATGG - Intronic
1187295818 X:17999548-17999570 GCTACAAAGTGGAAGGAACCTGG - Intergenic
1187857681 X:23652786-23652808 TCCACTAAGTTGAAGGCAGATGG - Intergenic
1189032831 X:37467460-37467482 TCCACTTATTGTAAGGAAGAAGG + Intronic
1189394182 X:40605414-40605436 TATACTAGGAGGAAGCAAGAAGG - Intronic
1189876714 X:45443969-45443991 TCTCCTAAGAGGGAGCAAGAAGG - Intergenic
1189960867 X:46323687-46323709 TCTACTCAGTTGGAGGAAGTTGG + Intergenic
1190742566 X:53299538-53299560 TGTTTTAAGTGGAAGGAAGTTGG + Intronic
1192722319 X:73712055-73712077 TCAACTAAAGGGAAGGAGGATGG + Intergenic
1193049618 X:77086215-77086237 GCAACTAAGTGGGGGGAAGAAGG - Intergenic
1193882777 X:86944866-86944888 TGAACAAAGTGGAAGGCAGATGG - Intergenic
1194606544 X:95985816-95985838 ACTATCAAGTGGAAGCAAGATGG - Intergenic
1195712782 X:107787846-107787868 TCAACTATGTGAAAGGAACAAGG - Intronic
1196002555 X:110802344-110802366 TGGACTAAGTGGATGGAAGCAGG - Intergenic
1196097980 X:111819821-111819843 TCTGCTATGTGCAAGGAAGTAGG - Intronic
1197249751 X:124202661-124202683 ACCACTAAGTGTATGGAAGAAGG + Intronic
1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG + Intronic
1197713749 X:129690684-129690706 TTTCCAGAGTGGAAGGAAGAGGG - Intergenic
1198178522 X:134181130-134181152 TTTACAAAGTGGAAGGGAGCTGG - Intergenic
1198220623 X:134598060-134598082 TGTACTTAGTGAAAGGAATAGGG + Intronic
1198385526 X:136125585-136125607 TATACAAAGTGGCAGGGAGAAGG + Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199512232 X:148635205-148635227 TCTAATAAAAGGAAGGCAGAAGG + Intronic
1199830105 X:151540608-151540630 TGTACTTAGTGGAAGGAATAGGG + Intergenic
1201416667 Y:13754103-13754125 TGTAATAATTAGAAGGAAGATGG + Intergenic
1201903213 Y:19064223-19064245 TTTACTAAGGGGAAGGGAAAGGG + Intergenic