ID: 1197276775

View in Genome Browser
Species Human (GRCh38)
Location X:124488682-124488704
Sequence ACACTCATTCTATAATTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197276775_1197276778 10 Left 1197276775 X:124488682-124488704 CCTCTAAATTATAGAATGAGTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1197276778 X:124488715-124488737 AGCTGTAATCACTGTGGCATAGG 0: 1
1: 0
2: 1
3: 20
4: 159
1197276775_1197276776 4 Left 1197276775 X:124488682-124488704 CCTCTAAATTATAGAATGAGTGT 0: 1
1: 0
2: 0
3: 17
4: 195
Right 1197276776 X:124488709-124488731 GAGCCTAGCTGTAATCACTGTGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197276775 Original CRISPR ACACTCATTCTATAATTTAG AGG (reversed) Intronic
900812169 1:4814311-4814333 AAACTGATTCTAAAATTTACTGG + Intergenic
902522865 1:17031136-17031158 ACACTCTTTCTAAGATTTACAGG - Intronic
902640383 1:17762917-17762939 ACACTCATTCCATTATTGCGCGG - Intronic
908833031 1:68199949-68199971 ACATTCTTCCTCTAATTTAGAGG - Intronic
910477953 1:87627071-87627093 ATTCTATTTCTATAATTTAGAGG - Intergenic
910683474 1:89891422-89891444 ACAATAATTCTATAATGGAGTGG - Intronic
911906787 1:103579654-103579676 ACACTTATTCAACAATTAAGTGG - Intergenic
916574177 1:166052429-166052451 AGACACATTCTAGAATTTGGGGG + Intergenic
920610526 1:207432445-207432467 ACTCTCATTCTAAAATGTGGGGG - Intergenic
921452200 1:215322610-215322632 ACTCTGATTCCATAATATAGAGG - Intergenic
921960471 1:221028556-221028578 ACACTAATTCTAAAAATTACAGG - Intergenic
922095989 1:222443144-222443166 ACAATCATTCTCGAATTTATGGG + Intergenic
922114959 1:222604292-222604314 AAACTCACTTTTTAATTTAGTGG + Intergenic
923756923 1:236799870-236799892 AAACTTATTGTATAATTTATTGG - Intronic
924078686 1:240369391-240369413 ATAATAATTCTATATTTTAGGGG - Intronic
924103357 1:240626652-240626674 ATAGTCATTAAATAATTTAGTGG - Intergenic
1063548205 10:7002394-7002416 ACACTCATTCGTTTATTTACTGG - Intergenic
1064639226 10:17398443-17398465 ACATTAATTCTATGTTTTAGAGG - Intronic
1065256908 10:23879294-23879316 ACACTCAATCTCTAAGTCAGAGG - Intronic
1065477631 10:26157969-26157991 ACAGCCATTCTACAATTTACAGG + Intronic
1065981145 10:30898754-30898776 ACACTCAATATATAATTTCCTGG + Intronic
1068267061 10:54665086-54665108 ACACTGTTTCTCTAATTCAGAGG + Intronic
1069414556 10:68186520-68186542 ACCCTAATTTTATAATTTAGGGG - Intronic
1070032152 10:72687380-72687402 ACATTCATTTTATAACTTAGTGG - Intergenic
1073187634 10:101626200-101626222 ACTCCCACTCTATAGTTTAGTGG - Intronic
1073856459 10:107680787-107680809 AAACTCATACTAAAATTTATTGG + Intergenic
1076240941 10:128907003-128907025 ACAGTCACTCATTAATTTAGGGG + Intergenic
1077822977 11:5768970-5768992 AACCTAATTCTATAATGTAGAGG - Intronic
1079895172 11:26110444-26110466 AACCTTATTCTATAATTTGGGGG - Intergenic
1079954281 11:26843195-26843217 ACAATCATTCTAAAACTTGGTGG + Intergenic
1080711651 11:34753710-34753732 ACAGACATTATTTAATTTAGTGG + Intergenic
1080720714 11:34845837-34845859 GTACTCATTCTATAATTTTTGGG + Intergenic
1080774691 11:35374463-35374485 ACACTCGTTCTTTAAATTTGGGG - Intronic
1080928192 11:36780470-36780492 ATTCTAATTCTATAATTTTGGGG - Intergenic
1085678267 11:78545985-78546007 CAAATCATTCTAAAATTTAGCGG + Intronic
1086139879 11:83485355-83485377 ACAGTCATTTTATAAGTTATTGG + Intronic
1086370788 11:86153687-86153709 CTACTCAATCTTTAATTTAGAGG + Intergenic
1086549733 11:88042061-88042083 ACACAAATTCTAAAATTTAAAGG + Intergenic
1089018383 11:115186250-115186272 AAACTGATCCCATAATTTAGGGG + Intronic
1091425771 12:388378-388400 GCAATAATTCTAAAATTTAGAGG - Intronic
1093593518 12:20935305-20935327 ACACTCATTCTATGAGTATGAGG - Intergenic
1095447373 12:42295730-42295752 ATAATTATTCTATAATCTAGAGG + Intronic
1097618827 12:61915371-61915393 ACACTCTTTCTCCAATTTATTGG + Intronic
1099471862 12:83060016-83060038 AAATTGATTCTATAATTTGGTGG + Intronic
1100056849 12:90522519-90522541 ACACTCATTATATATTTAAGTGG - Intergenic
1107274116 13:38657476-38657498 ACACTCATTTTAAAAGTGAGGGG - Intergenic
1109169716 13:59080378-59080400 ACACACCTTCAATAATTTAATGG + Intergenic
1109486584 13:63029838-63029860 ACTCTCATTCTCTAATCTTGAGG + Intergenic
1110100883 13:71599857-71599879 ACACACATAAGATAATTTAGAGG + Intronic
1111233577 13:85377617-85377639 ACACACATTATATGATTTAAGGG - Intergenic
1111267732 13:85840416-85840438 TCACTCATTGTATAATTGATGGG - Intergenic
1111387650 13:87548139-87548161 ATACGCATGCTATAATTTATAGG + Intergenic
1111974571 13:94952060-94952082 ACTCTCATTGTCTACTTTAGTGG + Intergenic
1112652933 13:101418156-101418178 ACACTCATCCTATAATGCATAGG + Intergenic
1112936181 13:104802282-104802304 AAACTCATTCTAACTTTTAGGGG - Intergenic
1115635511 14:35287021-35287043 ACTCTAGTTCTATAATTTATGGG - Intronic
1116533524 14:46002323-46002345 ACACTTATTCTATAATCTCTAGG + Intergenic
1117387532 14:55231024-55231046 ACAATCATTCTAAAAGTGAGTGG - Intergenic
1119042629 14:71288843-71288865 TCACTCATTCATTAATTTATTGG + Intergenic
1120588749 14:86349266-86349288 ACACTTATTATATAAATCAGAGG - Intergenic
1122496950 14:102163936-102163958 ACACCGATTCTATAATTTAAAGG - Intronic
1124193740 15:27602161-27602183 ACACTTATACTAAAATTAAGTGG + Intergenic
1124792923 15:32747030-32747052 TCACTCATTCTCCAATATAGTGG - Intergenic
1126614949 15:50568271-50568293 ACACTCATTCTATACTGTGCTGG + Intronic
1127250924 15:57237020-57237042 ACACTTGGTCTTTAATTTAGAGG + Intronic
1127898204 15:63321444-63321466 CCAGTCATTCTATAATGAAGAGG + Exonic
1129129468 15:73480490-73480512 AAAATTATTCTGTAATTTAGGGG - Intronic
1130553805 15:84909057-84909079 TCAGTAATTCTATAATTTGGAGG - Intronic
1133737213 16:8625152-8625174 ACAGACATTAAATAATTTAGGGG + Intronic
1138045199 16:53715256-53715278 ACACTCACTCCTTAATTAAGTGG - Intronic
1138579933 16:57934083-57934105 ACACTTACTCTATAGTTTAATGG + Intronic
1139202257 16:64989988-64990010 CCACTCATCCTTTAATATAGAGG - Intronic
1140887675 16:79259066-79259088 ACACTCATTCTGGGGTTTAGGGG - Intergenic
1140971063 16:80013122-80013144 TCACTAATTAGATAATTTAGTGG - Intergenic
1142698109 17:1644548-1644570 ACACTCATTTTACAATGAAGGGG + Intronic
1143984786 17:10902949-10902971 ATACTCAATTTATAGTTTAGGGG + Intergenic
1145356312 17:22157643-22157665 ACTCTCATTCTCTAATCTTGAGG - Intergenic
1149138198 17:53395792-53395814 ACACTTATTCTGTAAATTAATGG + Intergenic
1149746600 17:59105189-59105211 AAACTGATTTTATAATTTAGAGG + Intronic
1155754987 18:29481585-29481607 ACACTGATGATTTAATTTAGTGG - Intergenic
1156114994 18:33776892-33776914 ACACTAATACTTTAATTCAGAGG + Intergenic
1159011743 18:63064517-63064539 AAAAACATTCTGTAATTTAGTGG + Intergenic
1159774026 18:72583416-72583438 ACACTCATGCTATACTTTGGGGG + Intronic
1160064735 18:75564173-75564195 ACAGGCTTTCTATAATTTATGGG + Intergenic
1162252222 19:9455197-9455219 AAACTCATTCAGTAATTTAAAGG - Intergenic
1162665895 19:12211389-12211411 ACACTCATCCTAAAATTCACAGG - Intergenic
1164992942 19:32697649-32697671 ACTGTCATTCTATCATTTACTGG + Intronic
1167407226 19:49320036-49320058 ACACACATACTAAAATTTATGGG + Intronic
925070447 2:962874-962896 ACGCTCATTCTCTAATTTAAGGG - Intronic
925658358 2:6175045-6175067 ACACTTATTCGATAAATTAGTGG + Intergenic
925819841 2:7789448-7789470 AAAGTCATTCTAGAATTGAGAGG + Intergenic
926520595 2:13908550-13908572 AAAATCATTCTATAAGTTAATGG + Intergenic
928771328 2:34705096-34705118 ACATTCAGACTTTAATTTAGTGG - Intergenic
929182577 2:39059003-39059025 ACATTCTTTCTATTATCTAGGGG + Intronic
930326824 2:49930368-49930390 ACACACACTCTGTATTTTAGAGG - Intronic
931095689 2:58938273-58938295 ACACTCATCTCATAAGTTAGTGG + Intergenic
932731524 2:74225286-74225308 ACAGTTATTCTTTAAATTAGTGG + Intronic
932798959 2:74722578-74722600 ACTCTCATTCTATCATTTTGTGG - Intergenic
936600849 2:113892796-113892818 TCATTCATTATATAAATTAGGGG + Intronic
941768387 2:169324326-169324348 ACATTCATTCTTGAGTTTAGTGG - Intronic
941815644 2:169793176-169793198 ACAATTATTAGATAATTTAGAGG + Intronic
942891731 2:180998237-180998259 ACCCTCATGCTATAAATTGGTGG + Intronic
944316186 2:198287865-198287887 ACACTCATTATATGCTTTGGAGG + Intronic
944362495 2:198874395-198874417 GCACTCATTCTAAGATCTAGTGG - Intergenic
1170148893 20:13207115-13207137 ACAATCACTCTATAACTTAGTGG + Intergenic
1172455200 20:35066018-35066040 ACACTCAATCTTTACTTTACTGG + Intronic
1177045587 21:16164628-16164650 ATAGTTATTCTTTAATTTAGAGG + Intergenic
1177495335 21:21882386-21882408 ACAGTTATTTTATAATGTAGTGG - Intergenic
1177829360 21:26120128-26120150 AAACTCACTCCAAAATTTAGTGG - Intronic
1178336883 21:31751135-31751157 ACACTCATTCTATATGTTATTGG - Intergenic
1179966072 21:44806633-44806655 ACATTCAGGCTATAATTTTGGGG + Exonic
1182156689 22:28080231-28080253 ACACTAATTCTATTTTTTAGAGG + Intronic
949385668 3:3499592-3499614 ACTCACATCCTATATTTTAGAGG + Intergenic
950247789 3:11437812-11437834 AGATTCATGCTAAAATTTAGGGG - Intronic
950847994 3:16033384-16033406 ACACTCAGTGTAAAATTTATTGG + Intergenic
954904590 3:54049478-54049500 TCACTCATTCTGAAATTTGGTGG - Intergenic
956085334 3:65602596-65602618 AAAAACATTCTATAATTTTGTGG + Intronic
956293018 3:67681472-67681494 AATCTCATTCTATTATTTTGGGG + Intergenic
957596901 3:82278497-82278519 ACACACATTTTAAAATTTAAAGG - Intergenic
959472721 3:106772634-106772656 ACACTTATTCTATGATTCATTGG - Intergenic
960409344 3:117303211-117303233 ACACTGATTCTGAAATTCAGTGG + Intergenic
965247575 3:166293645-166293667 ACACTCATTATCTAATGTAATGG + Intergenic
965319173 3:167230561-167230583 ACATTCATTCAAGAATCTAGGGG + Intergenic
966259633 3:177960532-177960554 CCATTCATTCTATAATTTGAAGG - Intergenic
967423188 3:189296900-189296922 ACACTGTTTCTATCATTTAGTGG - Intronic
967718719 3:192792327-192792349 ACAGTATTTCTGTAATTTAGAGG - Intergenic
970065096 4:12084522-12084544 ACACTCATTCTATCACTTCCGGG - Intergenic
970389257 4:15591022-15591044 ACAATCATTCAATAATTTGCTGG - Intronic
970558555 4:17260064-17260086 TCACTCATTCTATAAAGGAGAGG - Intergenic
970681832 4:18517582-18517604 ATACTCAATCTATATTTTAATGG + Intergenic
970995820 4:22266708-22266730 CCACTGATCATATAATTTAGTGG + Intergenic
971001011 4:22322505-22322527 TGATTCATTCTATAATTGAGGGG - Intergenic
971125613 4:23750727-23750749 ACAGTCATGATATAAATTAGTGG - Intergenic
972458546 4:39277707-39277729 GCAATGATTTTATAATTTAGAGG + Intronic
972998943 4:44921024-44921046 AGACACATTATATAATATAGAGG - Intergenic
973224351 4:47765918-47765940 ACACTTTTTCTATAGTTTTGTGG + Intronic
974373007 4:61042063-61042085 ACACACATTCTATTACTTTGTGG - Intergenic
975700470 4:77061317-77061339 TCTCTCATTCTTTATTTTAGAGG - Intronic
976662758 4:87557153-87557175 AGAATTATCCTATAATTTAGAGG + Intergenic
977495808 4:97773980-97774002 ACACACACCCTATATTTTAGAGG - Intronic
977761318 4:100740391-100740413 ACATTCAGTTTATAATTTAAAGG - Intronic
978967027 4:114752691-114752713 ACATCCATTCTATGATTTACAGG + Intergenic
979348186 4:119613849-119613871 ACACCCATTCTACTATTTGGTGG + Intronic
980666697 4:135949059-135949081 CCACTTATTATATAATTCAGTGG + Intergenic
982459640 4:155652701-155652723 ACTCTCATTGTTAAATTTAGGGG - Intergenic
982765817 4:159347404-159347426 TCACTGATTCTATAACTTAGAGG + Intronic
985259293 4:188100285-188100307 ACAATAATTTTATAAATTAGGGG + Intronic
986156575 5:5182620-5182642 TCAGTCATTCTATATTTTTGAGG + Intronic
993874291 5:93288328-93288350 ACACTCACTATATAATGTTGGGG + Intergenic
994260836 5:97656683-97656705 ACACTCATTTTATGTTATAGTGG + Intergenic
994609893 5:102022711-102022733 ACACTTATTCTAAAATTGAAGGG - Intergenic
995705180 5:114981394-114981416 TCACACTTTCTGTAATTTAGGGG + Intergenic
996204225 5:120711330-120711352 ACACTGAGTCTATAATCTGGTGG - Intergenic
996691173 5:126341767-126341789 ACCCTAATTCTATAACCTAGAGG - Intergenic
996919495 5:128750907-128750929 ACAGTTATTTTATAAATTAGAGG + Intronic
998866647 5:146511198-146511220 AGACTCGGTCTATAATTCAGAGG - Exonic
999884975 5:155912081-155912103 TCACTCATTCTCCACTTTAGTGG + Intronic
1000723842 5:164743232-164743254 ACTCTCATTCTATATTATAAGGG - Intergenic
1000764586 5:165271200-165271222 ACATTAATTCTACAATTCAGAGG + Intergenic
1002653567 5:180723497-180723519 ACCCTCATTCTTTATTTTTGGGG + Intergenic
1003587315 6:7404137-7404159 ACACTTATTCACTAATATAGTGG - Intronic
1005334494 6:24780555-24780577 TTAGTCCTTCTATAATTTAGGGG - Intronic
1006029980 6:31171352-31171374 ACACACATTCAATAAATTTGAGG - Intronic
1009276393 6:61686831-61686853 ATACTAATTATATAATTTAAGGG - Intronic
1009367247 6:62865047-62865069 ATACTCTTTCTAACATTTAGTGG - Intergenic
1013255582 6:108381109-108381131 ACACTCATTTTATATTTCATGGG + Intronic
1013498574 6:110723450-110723472 ACACTCATTCCAAAACTTAGTGG - Intronic
1014762603 6:125373772-125373794 ACACTCTTTCTACAGTTTAGCGG - Intergenic
1015098226 6:129442873-129442895 ACACAAAATATATAATTTAGTGG - Intronic
1016118155 6:140313758-140313780 TCACTCATGCTATGCTTTAGCGG - Intergenic
1017593187 6:155999070-155999092 ACACTCAGTTTACAAATTAGAGG - Intergenic
1020412175 7:7904542-7904564 ACATTCATTCTCAAATTTATTGG - Intronic
1021090688 7:16479139-16479161 ACCATTATTCTCTAATTTAGAGG + Intronic
1022270311 7:28800697-28800719 GCACTCTTTCTGAAATTTAGTGG - Intronic
1022451673 7:30521941-30521963 AACCACATTCTATTATTTAGAGG + Intronic
1023489414 7:40722301-40722323 ACGCTTATACTATAATGTAGGGG + Intronic
1024964113 7:55006310-55006332 ACACTCATTCTATGTATTTGTGG - Intergenic
1024966252 7:55024487-55024509 AGACTCAAGTTATAATTTAGGGG + Intronic
1028612012 7:92722211-92722233 TCACCCATTCTTTCATTTAGAGG + Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1030248714 7:107416523-107416545 ACACTAATTCTTAAATTTAGTGG + Intronic
1031723865 7:125211269-125211291 AAACACTTTCTATCATTTAGAGG + Intergenic
1034049258 7:147964787-147964809 AAACTTACTCTGTAATTTAGAGG - Intronic
1034324152 7:150214858-150214880 AAACTCATTCTAGAACTCAGTGG + Intergenic
1034487971 7:151377854-151377876 ACACTCAATCTTGAATTTCGGGG - Exonic
1034769042 7:153754377-153754399 AAACTCATTCTAGAACTCAGTGG - Intergenic
1034887084 7:154806178-154806200 CTTCTCATTCTGTAATTTAGAGG - Intronic
1037001717 8:13727684-13727706 ACTGTCATTTTATAATGTAGAGG + Intergenic
1038113532 8:24527009-24527031 ACAGTCATTTTATATTTTTGAGG + Intergenic
1039930252 8:41980124-41980146 ACTCTGATTTTATAATTTATAGG - Intronic
1042744742 8:72095799-72095821 ACCCCCATTTTAGAATTTAGCGG + Intronic
1045498042 8:102724914-102724936 AAAACCATTCTAAAATTTAGTGG - Intergenic
1045824740 8:106383853-106383875 TTTCTCATTCTATAATTTTGTGG - Intronic
1046549562 8:115697175-115697197 ACACTCATTCTAGAATGAACTGG + Intronic
1048930428 8:139310985-139311007 CTACTCATTCTATAATAGAGGGG + Intergenic
1052154322 9:25165852-25165874 TTATTCATTCTATAATTGAGGGG + Intergenic
1055937455 9:81616198-81616220 ACACTCATTCTCTAAATTTAAGG + Intronic
1057454508 9:95195609-95195631 AGACTTATTCTAGAATTTATAGG - Intronic
1186380171 X:9049484-9049506 ACAATGATTCTAAAATTTGGGGG - Intronic
1186389312 X:9143031-9143053 ACACATATTTTATAATTTAAAGG + Intronic
1186945115 X:14557624-14557646 ACCTTCTTTTTATAATTTAGTGG + Intronic
1188247772 X:27855399-27855421 ACACTCAATCTTTTAATTAGTGG + Intergenic
1188389890 X:29607085-29607107 ACACTAATTTTATCATGTAGAGG + Intronic
1189287517 X:39861998-39862020 ACACACAATCTATAATAAAGAGG - Intergenic
1189549967 X:42082849-42082871 AGATTAATTCTATAATTTATTGG + Intergenic
1190656867 X:52620305-52620327 ACACTCATTATTACATTTAGGGG - Intergenic
1192388424 X:70698324-70698346 ACATTCATTCTATTTTTTTGAGG - Intronic
1193215397 X:78857552-78857574 ACACTCATTTTTTGATTAAGTGG - Intergenic
1194102635 X:89725180-89725202 AAACTCATTCTAAAGTTTATAGG - Intergenic
1194866122 X:99070086-99070108 ACACTCAATCTATCAGTTTGTGG + Intergenic
1196317274 X:114242815-114242837 ATATTCATTTTATGATTTAGAGG - Intergenic
1197155828 X:123269297-123269319 ACAACAATTCTATAAGTTAGGGG - Intronic
1197276775 X:124488682-124488704 ACACTCATTCTATAATTTAGAGG - Intronic