ID: 1197280046

View in Genome Browser
Species Human (GRCh38)
Location X:124524560-124524582
Sequence CACCTCAGATTTAAGATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197280042_1197280046 3 Left 1197280042 X:124524534-124524556 CCCTCTTTGGCCTCCTAGTCTAC 0: 1
1: 0
2: 0
3: 20
4: 324
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280045_1197280046 -10 Left 1197280045 X:124524547-124524569 CCTAGTCTACTTGCACCTCAGAT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280040_1197280046 20 Left 1197280040 X:124524517-124524539 CCTTCTACATTTGACTACCCTCT 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280037_1197280046 30 Left 1197280037 X:124524507-124524529 CCCGACCAAGCCTTCTACATTTG 0: 1
1: 0
2: 1
3: 13
4: 141
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280044_1197280046 -7 Left 1197280044 X:124524544-124524566 CCTCCTAGTCTACTTGCACCTCA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280043_1197280046 2 Left 1197280043 X:124524535-124524557 CCTCTTTGGCCTCCTAGTCTACT 0: 1
1: 0
2: 2
3: 59
4: 1148
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280038_1197280046 29 Left 1197280038 X:124524508-124524530 CCGACCAAGCCTTCTACATTTGA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122
1197280039_1197280046 25 Left 1197280039 X:124524512-124524534 CCAAGCCTTCTACATTTGACTAC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG 0: 1
1: 0
2: 2
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197280046 Original CRISPR CACCTCAGATTTAAGATCTC TGG Intronic
905257131 1:36692089-36692111 CTCCTCAGACTGAAGGTCTCTGG + Intergenic
907641515 1:56195298-56195320 CACCTCTGCTATAAGCTCTCAGG + Intergenic
910278796 1:85475800-85475822 CACCTCAGAGGTAAGAGTTCAGG - Intronic
912947090 1:114094368-114094390 CAACAGAGATTTAACATCTCTGG + Intronic
915884617 1:159709478-159709500 CAGCTCAGATTTCTTATCTCAGG - Intergenic
916681720 1:167110882-167110904 AACCTCAGCTTTAAGCTATCAGG + Intronic
921223557 1:212993967-212993989 AAATTCAGTTTTAAGATCTCTGG - Exonic
923633108 1:235668114-235668136 AACCTCAGATTGAAAATATCTGG - Intronic
923653171 1:235892572-235892594 TACCTCAAATTTCAGAGCTCTGG - Intergenic
1064075446 10:12265041-12265063 CACCTTAGATTTAAGAGTTCAGG - Intergenic
1066692227 10:38041676-38041698 CATTTCAGATTTTAGATTTCTGG + Intronic
1067000490 10:42606953-42606975 CATTTCAGATTTTAGATTTCTGG - Intronic
1070118470 10:73552126-73552148 CACTTCAGCTATATGATCTCGGG + Intronic
1071172260 10:82880174-82880196 CATCACATATTTAAGATCCCTGG - Intronic
1071798917 10:89036080-89036102 CACCTCTGAATTAAAATCTCAGG - Intergenic
1072770555 10:98134095-98134117 CACCCCAATTTTAAGAACTCTGG + Intergenic
1074468332 10:113704718-113704740 CCCCTCAGCTTTAAGTTCTTTGG + Intronic
1075758317 10:124834215-124834237 CACCTCACCTTTCAGAACTCTGG + Intronic
1076107826 10:127837630-127837652 TACCTCAGAGCTAAGAACTCGGG - Intergenic
1079347008 11:19661904-19661926 CACCTCAAATTCAAGAGCCCTGG - Intronic
1079532917 11:21476973-21476995 CACCACAGGCTAAAGATCTCTGG + Intronic
1079675874 11:23225784-23225806 CACATCAGATTGAAAATATCAGG + Intergenic
1080340469 11:31257751-31257773 CACCTGGCATTTAGGATCTCAGG - Intronic
1082721212 11:56679388-56679410 CACCGCAGATTAAAGGGCTCTGG + Intergenic
1090179186 11:124679506-124679528 CAACTCAAATTTAAGATTACAGG - Intronic
1090512314 11:127388349-127388371 TACCTCTGATCTCAGATCTCGGG + Intergenic
1091422618 12:356259-356281 CACCTGAAATTTAAGAGATCTGG + Intronic
1091985032 12:4903939-4903961 CATCTCTGATTTAAGAACTTAGG + Intergenic
1092703105 12:11255408-11255430 TACCTCACCTTTAAGATCTCAGG - Intergenic
1094262508 12:28517310-28517332 CACTTCTGAATTCAGATCTCAGG - Intronic
1095222118 12:39628103-39628125 CACATCAGAGTTGAGATGTCAGG - Intronic
1095920555 12:47525976-47525998 AACCTCATATATAAGAGCTCTGG - Intergenic
1098031877 12:66263476-66263498 CATTTCAGATTTCAGATCTTTGG + Intergenic
1098560658 12:71867848-71867870 CATTTCAGATTTAAGATTTTTGG + Intronic
1109047009 13:57425678-57425700 CACCTCAGCTCCAAGTTCTCTGG - Intergenic
1109135959 13:58651263-58651285 CAACTCAGATTTCAAATTTCAGG + Intergenic
1111190260 13:84797818-84797840 CACATCAAATTTAAAATCTCTGG - Intergenic
1116967876 14:51032941-51032963 CACTTCAGATTTCAGATTTTTGG + Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1124692436 15:31836023-31836045 CATTTCAGATTTCAGATCTTTGG + Intronic
1126020676 15:44398061-44398083 CAGATCAGATTTCAGTTCTCAGG + Intronic
1134052722 16:11148095-11148117 GACCTCAGATTCATGATTTCTGG + Intronic
1134222234 16:12363863-12363885 TACCTCAGATTTCAGATTTTTGG - Intronic
1134616292 16:15653628-15653650 CACCTCTGATTTTAAAACTCTGG - Intronic
1140720415 16:77766474-77766496 CACCTCAGATGCAAAATTTCAGG + Intergenic
1141947755 16:87322312-87322334 CACCTCCGTTTCAACATCTCTGG - Intronic
1142687516 17:1586198-1586220 AACTTCAGAGTTAAGGTCTCCGG - Intronic
1144257019 17:13478647-13478669 GAACTCAGATTTAAGAACTTTGG - Intergenic
1155628363 18:27862340-27862362 TACCTCAGGTTCAAGTTCTCAGG + Intergenic
1157041093 18:44039853-44039875 CATTTCAGATTTACCATCTCTGG + Intergenic
1167263151 19:48470081-48470103 TCCCTCAGATCTAAGAGCTCAGG + Intronic
925634121 2:5925964-5925986 CAGCTCAGATTTAAGATGTTTGG - Intergenic
926079055 2:9968923-9968945 GATGTCATATTTAAGATCTCAGG - Intronic
926257769 2:11223627-11223649 CACATCAGCTTTATGATCTTGGG - Intronic
928442070 2:31300713-31300735 CATCTCAATTTCAAGATCTCAGG - Intergenic
928916556 2:36477987-36478009 GACTTCAGATTGAAGATCTGGGG - Intronic
933805307 2:85994824-85994846 CTCCTCAGATTTCACATCTGGGG - Intergenic
934785915 2:97005651-97005673 CACCTCAGAAACAAAATCTCTGG + Intronic
937063030 2:118994291-118994313 CACCTCAGATGGAAGCTCCCAGG + Intronic
937675105 2:124581602-124581624 AACTTCAGATTTAAGTTTTCAGG + Intronic
940599994 2:155846558-155846580 CACAACAGATTCAAGATCTTTGG + Intergenic
943036736 2:182756097-182756119 CATTTCAGATTTAAGATTTTTGG - Intronic
944178886 2:196864663-196864685 GACCACAAATTTAAGGTCTCTGG + Intronic
944365260 2:198911852-198911874 CACCTCAGATTTATGGTCCAAGG + Intergenic
947463024 2:230319525-230319547 GACCTCAGCCTTGAGATCTCAGG + Intergenic
1170293422 20:14796937-14796959 TATCTCAGATCTAAGATGTCTGG + Intronic
1170352061 20:15452519-15452541 CACTTCAGATCTAACATCACGGG - Intronic
1173719831 20:45246598-45246620 CATTTCAGATTTCAGATTTCTGG - Intergenic
1175795669 20:61769263-61769285 CACCTAAGACTTAACAACTCTGG - Intronic
1176699444 21:10025488-10025510 CATTTCAGATTTCAGATATCTGG - Intergenic
1178899443 21:36587609-36587631 AAACTCAGATTTAATATCTTTGG - Intergenic
1179309744 21:40185211-40185233 CACCTGAGAATTGAGATCTATGG + Intronic
1183402273 22:37611550-37611572 CAACTCAGATTTAAGTATTCTGG - Intronic
950555034 3:13690177-13690199 CACCCCAGATTTCAGATCTGGGG - Intergenic
956504044 3:69918589-69918611 CACATCAGGGTTCAGATCTCTGG + Intronic
956528402 3:70189813-70189835 CACATTAGATTTAGCATCTCTGG + Intergenic
957127772 3:76184422-76184444 CAGCCCAGATTTAAGACCTGGGG + Intronic
958154794 3:89742943-89742965 CAACTCAGATGTAAGATTTGGGG + Intergenic
961383792 3:126512905-126512927 CACTTCAGATTTCTGATCTCTGG + Intronic
963764413 3:149319397-149319419 GACCTCATATTTAAGTTCTTTGG + Exonic
964936909 3:162100748-162100770 CATTTCAGATTTAAGATTTTAGG - Intergenic
968285684 3:197507430-197507452 CAAGTCAGGTTTAAGAGCTCAGG - Intergenic
969097956 4:4748272-4748294 CACCTTAGCCTTAAGAGCTCTGG - Intergenic
976239519 4:82940144-82940166 CACCTTAGATATAAGTTCTCTGG - Intronic
976608986 4:87009806-87009828 CACCTGTGATGTAAAATCTCAGG + Intronic
977165959 4:93697381-93697403 CACATCAAGTTTAAGAACTCAGG + Intronic
980371854 4:131884127-131884149 CATTTCAGATTTCAGATATCTGG - Intergenic
980560726 4:134470877-134470899 CACATCAGAGTTGAGATCTCAGG + Intergenic
983059612 4:163143038-163143060 CACCTCATAGTAAAGGTCTCAGG - Intronic
983497081 4:168454856-168454878 CATCTCAAATTTAGGATTTCTGG - Intronic
984009405 4:174352718-174352740 CATTTCAGATTTCAGATCTTTGG - Intergenic
985189117 4:187352312-187352334 CACCTCAAACTTAACATTTCAGG - Intergenic
985837826 5:2283505-2283527 CACCTCAACTTTTACATCTCTGG - Intergenic
991126249 5:63072898-63072920 CACTTCAGATTTCAGATTTTTGG + Intergenic
995067962 5:107883561-107883583 CTCCTTAGCTTTCAGATCTCAGG + Intronic
995164000 5:109015924-109015946 CATCTCAGATTTACCTTCTCTGG + Intronic
995802292 5:116010842-116010864 CACCTCAGAAACAAGATCCCTGG - Exonic
997195673 5:131977648-131977670 AACGTCTGATTTAACATCTCTGG - Intronic
1000243698 5:159431802-159431824 CACCTCAGCTTTAACTTGTCAGG - Intergenic
1002538563 5:179891681-179891703 CACATCAGATTCAGGATCCCTGG + Intronic
1010419610 6:75657385-75657407 AACCTCAGATTTTAGATCTCGGG + Intronic
1012443125 6:99280805-99280827 CATCTCACAATTAAGACCTCAGG + Exonic
1014067157 6:117140552-117140574 CAACACAGATTTAAACTCTCAGG + Intergenic
1019102577 6:169642959-169642981 CATCTCAGATTTCAGATTTTTGG - Intronic
1019449743 7:1091262-1091284 AACCTCAGCTTTATGAGCTCGGG - Intronic
1020370499 7:7427159-7427181 CAGCTCAGATTTTAGAGATCAGG + Intronic
1020890372 7:13870668-13870690 CAGATCAGTTTTAAGATCTATGG + Intergenic
1021139219 7:17003334-17003356 CAGCTTAGATATAAAATCTCTGG + Intergenic
1021329509 7:19318309-19318331 CATCTCAGATTTCAGATTTTTGG - Intergenic
1024452878 7:49568644-49568666 CACCTCTGTTTTAAGTTCTTTGG - Intergenic
1031164973 7:118216952-118216974 GAACTCAAATTCAAGATCTCAGG - Intronic
1037295907 8:17399937-17399959 CACCTGAGATTAAATTTCTCAGG + Intronic
1039055244 8:33531151-33531173 CAATTCAGATTTAAGATTTCAGG + Intergenic
1042974220 8:74447425-74447447 CACTTCAGATTTCAGTTTTCCGG - Intronic
1043760684 8:84063717-84063739 CACCTCAGGCTCAAGTTCTCTGG - Intergenic
1048594988 8:135857183-135857205 AACCTCAGATTAAAAATATCTGG + Intergenic
1050226224 9:3459085-3459107 GAGCTCAGAGTAAAGATCTCTGG + Intronic
1052321050 9:27167985-27168007 CATCTCAGATTTCAGATTTTTGG - Intronic
1052677052 9:31640325-31640347 AACATAAGATTTAAGATCACAGG - Intergenic
1053636557 9:40011685-40011707 CATTTCAGATTTCAGATATCTGG - Intergenic
1053769438 9:41452933-41452955 CATTTCAGATTTCAGATATCTGG + Intergenic
1054317419 9:63608759-63608781 CATTTCAGATTTCAGATATCTGG - Intergenic
1054548103 9:66364434-66364456 CATTTCAGATTTCAGATATCTGG + Intergenic
1056049210 9:82750555-82750577 CACCTTACATTTCAGACCTCAGG - Intergenic
1056955889 9:91080781-91080803 GACCTCAGTTTTCATATCTCTGG - Intergenic
1057299830 9:93871388-93871410 CACCTCAGAATTCAGACCTCAGG + Intergenic
1057555645 9:96085608-96085630 CACCTCACATTCAAGGCCTCCGG + Intergenic
1058535486 9:105955681-105955703 TACCTCAGATTAAAGATTTAGGG - Intergenic
1060680797 9:125562291-125562313 CACTTCATATTTAAGAACTGGGG - Intronic
1191205473 X:57828715-57828737 CATTTCAGATTTAAGATATTTGG - Intergenic
1193540157 X:82761436-82761458 CAGCTCAGTTTTAAGATCTCAGG + Intergenic
1195158965 X:102153081-102153103 CATTTCAGATTTCAGATTTCTGG - Intergenic
1195699081 X:107688919-107688941 CATTTCAGATTTAAGATTTTTGG + Intergenic
1197280046 X:124524560-124524582 CACCTCAGATTTAAGATCTCTGG + Intronic
1197346907 X:125335214-125335236 CATTTCAGATTTCAAATCTCTGG - Intergenic
1198059381 X:133029513-133029535 CAGCACAAATTTAAGTTCTCTGG + Intronic