ID: 1197280689

View in Genome Browser
Species Human (GRCh38)
Location X:124532121-124532143
Sequence GCCACCTTGTTAACTGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197280689_1197280693 3 Left 1197280689 X:124532121-124532143 CCTCCACCAGTTAACAAGGTGGC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1197280693 X:124532147-124532169 TACAACAATAACACCTACCTAGG 0: 1
1: 0
2: 0
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197280689 Original CRISPR GCCACCTTGTTAACTGGTGG AGG (reversed) Intronic
900920379 1:5666453-5666475 GCCCCCTTGTTGACCCGTGGTGG - Intergenic
902396599 1:16135262-16135284 GCCACCTTGCTAGCTTGGGGTGG - Intronic
902918887 1:19655085-19655107 GCCAGCTTGTTGATGGGTGGTGG - Exonic
910091352 1:83468202-83468224 GGCACTTTGTTAACTGCTTGTGG + Intergenic
910591320 1:88930157-88930179 GCCTCATTGTTTACTGGTAGTGG + Intergenic
913228479 1:116721130-116721152 GCCACCATACTAAGTGGTGGGGG + Intergenic
917599914 1:176563536-176563558 GCTTCCCTGCTAACTGGTGGAGG + Intronic
920934456 1:210418215-210418237 GCCGCCTTCTTTGCTGGTGGTGG + Exonic
924801180 1:247330776-247330798 CCCACCTTGTGAGCTGTTGGAGG - Intronic
1063390361 10:5646228-5646250 GCCACCTGGTAATGTGGTGGGGG + Intronic
1064300292 10:14117314-14117336 GCCACCTCATTAGCTGTTGGAGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1070306106 10:75240072-75240094 GCCACCATGTCCCCTGGTGGAGG - Intergenic
1071214717 10:83387470-83387492 GCCACTTTGTTATCTGTTGTTGG + Intergenic
1078461438 11:11518042-11518064 GCCACCTTGGAGACTGCTGGAGG - Intronic
1079118515 11:17657207-17657229 GCAACCTTGTTTACTGCTGTTGG + Intergenic
1081869601 11:46377297-46377319 ACCATTTAGTTAACTGGTGGAGG - Intronic
1083624990 11:64067743-64067765 CCCAGCTTGTGAACTGGGGGTGG + Intronic
1084414526 11:69023654-69023676 GCCACTTTCTTAACAGGAGGGGG + Intergenic
1088985691 11:114905754-114905776 GAATCCTTGTTAACTGTTGGTGG + Intergenic
1089593230 11:119558546-119558568 GACACTTTGTGAACTGATGGGGG + Intergenic
1093479479 12:19590091-19590113 GCCACCATGTTTACTGGCTGAGG - Intronic
1095042483 12:37457634-37457656 GACATCTTGCTAACTGTTGGTGG - Intergenic
1097322177 12:58238062-58238084 GGCACCATGTTAAGTGTTGGGGG + Intergenic
1107400187 13:40061944-40061966 GCCACCTTGTTAACAGGCACTGG - Intergenic
1110238481 13:73241330-73241352 GCCAGCTTGGTAACTGTGGGTGG + Intergenic
1112173259 13:96994823-96994845 GCCACCTTGCTAAGCGCTGGAGG - Intergenic
1113177340 13:107579827-107579849 CCCACCTTTTAAACTGTTGGTGG + Intronic
1113393275 13:109918433-109918455 GCCTCCCTGTTCCCTGGTGGCGG + Intergenic
1202941017 14_KI270725v1_random:145364-145386 GACATCTTGCTAACTGTTGGTGG - Intergenic
1126292452 15:47097881-47097903 GACATCTTGATAACTGTTGGTGG + Intergenic
1130903846 15:88226392-88226414 GCCACCTTGTGGACTGCTCGTGG - Intronic
1141741423 16:85895666-85895688 ACCCACCTGTTAACTGGTGGGGG + Intergenic
1142324387 16:89405093-89405115 GACACCAGGTTAACTGGTGTGGG - Intronic
1146568027 17:33929945-33929967 TCCACTTTGCTAACTGGTGGTGG + Intronic
1148238061 17:45982655-45982677 GCCACCTAGCGAGCTGGTGGCGG + Intronic
1151322262 17:73359176-73359198 GCCACCTGGTTTGTTGGTGGGGG + Intronic
1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG + Intronic
1152486798 17:80599791-80599813 GGCCCCTTGTTAGGTGGTGGTGG + Intronic
1153106853 18:1537623-1537645 GACACCTTGTACACTGTTGGTGG - Intergenic
1153275348 18:3361904-3361926 CCCACCTTGTTGAGGGGTGGGGG + Intergenic
1155012816 18:21798171-21798193 GCCACCTTGGAAACTGCTGCTGG - Exonic
1156259989 18:35437351-35437373 ACAACCATGTTGACTGGTGGAGG + Intergenic
1159069448 18:63606871-63606893 GTCACATTATTAAGTGGTGGTGG - Intergenic
1160895098 19:1398821-1398843 GCCACCTTGCTACCTGGGGAGGG - Exonic
1166952424 19:46438442-46438464 GCCACCTTGTGAACATGTGAGGG + Intergenic
927662439 2:25004222-25004244 GCCACCTTGTTAGGTAGAGGAGG + Intergenic
927671754 2:25074244-25074266 GCAACGGTGGTAACTGGTGGAGG - Intronic
928275595 2:29897579-29897601 GCCACACTGCTGACTGGTGGAGG - Intronic
928677371 2:33662734-33662756 GCCTCATTGTTTACTGGTAGTGG + Intergenic
931349993 2:61479139-61479161 GCAAACCTGTTAACTGGTGGGGG + Intronic
933675390 2:85051742-85051764 GCAACCTTATTAATTGGGGGTGG - Intronic
933913762 2:86967797-86967819 ACCACTTTCTTAATTGGTGGTGG - Intronic
934009231 2:87802101-87802123 ACCACTTTCTTAATTGGTGGTGG + Intronic
934926361 2:98384316-98384338 GCCACCTTAGTATCTGGTGATGG - Intronic
935772815 2:106442810-106442832 ACCACTTTCTTAATTGGTGGTGG + Intronic
935907254 2:107853119-107853141 ACCACTTTCTTAATTGGTGGTGG - Intronic
935993654 2:108745278-108745300 ACCACTTTCTTAATTGGTGGTGG - Intronic
936129045 2:109818259-109818281 ACCACTTTCTTAATTGGTGGTGG - Intronic
936215652 2:110553226-110553248 ACCACTTTCTTAATTGGTGGTGG + Intronic
936424789 2:112407799-112407821 ACCACTTTCTTAATTGGTGGTGG + Intronic
937299056 2:120827417-120827439 GCCTCCTTGTGCACTGCTGGTGG + Intronic
940378874 2:152990362-152990384 GCCATCTTGTCACCTGATGGAGG - Intergenic
947625082 2:231614063-231614085 GCCACCTGGTTGACTAGGGGAGG - Intergenic
948151730 2:235749736-235749758 GCCACACTGTTAACTGATGCCGG - Intronic
1169061785 20:2665648-2665670 GCCACCTTTTTGGCTGGTTGAGG - Intergenic
1171536912 20:25900702-25900724 GACATCTTGCTAACTGTTGGTGG - Intergenic
1171839858 20:30195974-30195996 GACATCTTGCTAACTGTTGGTGG - Intergenic
1172215128 20:33230330-33230352 GCTACCTGGTTCACTGGTGAAGG + Intergenic
1175035589 20:55997666-55997688 ACCACTTTATTAACTGGTGGTGG - Exonic
1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG + Intergenic
1175195658 20:57241626-57241648 GCCTCCTTGTTAGGTGCTGGGGG + Intronic
1176582144 21:8541579-8541601 GACATCTTGCTAACTGTTGGTGG + Intergenic
1176864041 21:14032800-14032822 GCCTCCTTGTAAACTGTTAGTGG + Intergenic
1179608945 21:42536633-42536655 GCCACATTGTAATGTGGTGGAGG + Intronic
1179887346 21:44319808-44319830 GCCACCTTGGTAGCGGGTGGAGG - Intronic
1180264979 22:10518627-10518649 GACATCTTGCTAACTGTTGGTGG + Intergenic
1183717452 22:39541940-39541962 GCCACCATGCTAACTGGGGGCGG - Intergenic
1184820996 22:46909241-46909263 GGGGCCTTGTTAAATGGTGGGGG + Intronic
952210707 3:31226598-31226620 GCCACCCAGTGAAGTGGTGGGGG + Intergenic
953351444 3:42219373-42219395 GCTACCTTGTTAACTGGATCTGG - Intronic
957012007 3:75017205-75017227 GACACCTTCAAAACTGGTGGTGG + Intergenic
961198148 3:125021028-125021050 GCCACCGTGTTCACTGATGGTGG - Exonic
962866705 3:139453229-139453251 GCCCCCTTGGTATCTGGGGGTGG + Intronic
963809199 3:149758186-149758208 GCCTCATTGTTTACTGGTAGTGG - Intergenic
965455467 3:168894500-168894522 GTCTCCTTGCTATCTGGTGGAGG - Intergenic
966729356 3:183137502-183137524 GCCACCTTGTTAATTCATCGTGG - Intronic
967556506 3:190864477-190864499 GTCACCTTGTTAAGTGCTGTGGG - Intronic
967752010 3:193125852-193125874 GCAACCTTATTATCTGGTGCAGG + Intergenic
969620150 4:8274828-8274850 GCCACCTTGTAAACTGCTCTGGG - Intronic
979276257 4:118817380-118817402 GCCACATTGTTGACAGGTGGAGG + Exonic
988536513 5:32073822-32073844 GGCTCCTTGTGAGCTGGTGGAGG - Exonic
992179172 5:74180098-74180120 GCTAACTAGTTAACTAGTGGTGG + Intergenic
1012817104 6:104037972-104037994 GCCACATTCTTAACTGGAGAAGG + Intergenic
1016449394 6:144166173-144166195 GAAACCTTATTAATTGGTGGTGG + Intronic
1016657876 6:146543083-146543105 GGAACCTTGTACACTGGTGGTGG + Intergenic
1019756533 7:2774851-2774873 GCCACCTTCTTACCTGGGGTTGG + Intronic
1023345747 7:39269499-39269521 TCCAGCTTGTCAGCTGGTGGAGG - Intronic
1025288380 7:57687413-57687435 GACACCTTGCTAACTGTTGGTGG - Intergenic
1027195014 7:76024026-76024048 GCCTTCTTTTTAAGTGGTGGTGG - Intronic
1027308198 7:76924649-76924671 GGCACTTTGTTAACTGGTTGTGG + Intergenic
1027646457 7:80806953-80806975 ACCAGCTTGCTAACTGGTAGGGG - Intronic
1046952612 8:120032585-120032607 GTGACCTTGTTGGCTGGTGGGGG + Intronic
1049127703 8:140807051-140807073 GCTTCCTTGTAATCTGGTGGTGG - Intronic
1049802691 8:144525517-144525539 GCCTCCTTGTTATCCTGTGGGGG + Intronic
1057913331 9:99036758-99036780 ACCACCTTGATTACTGATGGAGG + Intronic
1060303253 9:122388681-122388703 GCCTCCTTGGCATCTGGTGGTGG + Intronic
1060326552 9:122621711-122621733 GAAACCTTGTTCACTGTTGGTGG + Intergenic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1203612161 Un_KI270749v1:19595-19617 GACATCTTGCTAACTGTTGGTGG + Intergenic
1189576254 X:42356893-42356915 GCCAACTTGCTAACGGTTGGTGG - Intergenic
1189823985 X:44898595-44898617 GCCTCCTTGCTAATGGGTGGTGG + Intronic
1196763566 X:119222770-119222792 ATCACCTTGTTAACTGCTGATGG - Intergenic
1197280689 X:124532121-124532143 GCCACCTTGTTAACTGGTGGAGG - Intronic
1198765822 X:140078305-140078327 GCCTCATTGTTTACTGGTAGTGG + Intergenic
1201968636 Y:19766980-19767002 GGCACCTGCTTAACTTGTGGAGG + Intergenic