ID: 1197280916

View in Genome Browser
Species Human (GRCh38)
Location X:124534904-124534926
Sequence CCCTAACAACTGTAGCTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197280909_1197280916 23 Left 1197280909 X:124534858-124534880 CCAAGGGATAGAAATTTGTCACA 0: 1
1: 0
2: 2
3: 17
4: 173
Right 1197280916 X:124534904-124534926 CCCTAACAACTGTAGCTACTGGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197280916 Original CRISPR CCCTAACAACTGTAGCTACT GGG Intronic
900640385 1:3685543-3685565 CCCTCACAACAGTGGCTGCTGGG + Intronic
901227150 1:7620336-7620358 GCCTCACAACTGTAGACACTTGG - Intronic
906518960 1:46456229-46456251 CCCAAACAAATGTGGCTGCTGGG - Intergenic
911720174 1:101182340-101182362 CCCTAAAAACAGTGGCTAGTAGG + Intergenic
913209749 1:116572303-116572325 CCCTACCATCTGTAGATACTGGG + Intergenic
916163310 1:161941171-161941193 CCCTATCAACTGAATCTGCTGGG + Intronic
916222917 1:162462360-162462382 CCCTAACAACTGTAGGGGGTAGG + Intergenic
916997319 1:170314875-170314897 CCCTAGAAACTGGAGCTACCAGG + Intergenic
917053388 1:170950564-170950586 CAGTAACAACTGTAGATTCTGGG + Intronic
920267128 1:204732450-204732472 CCCTAACAACAGGAGCTAGCAGG - Intergenic
920978047 1:210804313-210804335 CCCTCACACCTGGAGCTTCTGGG + Intronic
922824746 1:228510124-228510146 CCCTAAAAACTGTTGATATTAGG + Intergenic
1070470255 10:76772316-76772338 CCCTAACAACAGAAGTTTCTGGG + Intergenic
1077703846 11:4465539-4465561 CCCTAACAACAGGAGCTATTAGG + Intergenic
1077935710 11:6783549-6783571 CCCTAAGAACTTGAACTACTCGG + Intergenic
1080229975 11:30009588-30009610 CCATAATCACTGTAGCTGCTTGG + Intergenic
1085010228 11:73134968-73134990 TCCTAGCTACTCTAGCTACTTGG - Intronic
1089079293 11:115762457-115762479 CCCTGACCACTTTATCTACTTGG - Intergenic
1091139557 11:133223363-133223385 CCCAATCAACTGTAGCTTTTGGG + Intronic
1092887074 12:12934272-12934294 CCCTAACAACAGAAGCTATCAGG - Intergenic
1100276451 12:93076146-93076168 CCTTAACAACTAGAGCTCCTTGG - Intergenic
1107446736 13:40476034-40476056 CCCTATCTACAGTAGCAACTGGG + Intergenic
1111422054 13:88024838-88024860 CACAAACACCTGTAGGTACTAGG + Intergenic
1114622895 14:24108461-24108483 GGCTTACACCTGTAGCTACTCGG - Intronic
1121106221 14:91281612-91281634 CCCCAAGAGCTGGAGCTACTGGG - Intronic
1121555211 14:94831370-94831392 CCCTAAAAACTGCAGTTACATGG + Intergenic
1126275089 15:46868482-46868504 CCCAAACAACTGGAGCTGGTTGG + Intergenic
1137852581 16:51761569-51761591 CCCTAACTAATGGAGCCACTTGG + Intergenic
1138175939 16:54898275-54898297 CCCTAAGAAATGCAGCTGCTGGG + Intergenic
1138852808 16:60650275-60650297 TCCCAACAACTGAAGCTAATTGG - Intergenic
1143188999 17:5027844-5027866 GGCTCACACCTGTAGCTACTTGG + Exonic
1146958564 17:36952663-36952685 CCCTAACAAAAGGAGCTAGTGGG - Intronic
1163546662 19:17944745-17944767 CCCTGACCACTGCAGCTTCTGGG - Intergenic
1164323472 19:24171310-24171332 CCGTCACAACTGTAGATAATGGG - Intergenic
926681630 2:15668416-15668438 ATCTAACAACTCTAGTTACTGGG + Intergenic
930053736 2:47236498-47236520 CCTTACCAACTGTAGCTCCATGG - Intergenic
937822170 2:126322959-126322981 CCCTAAAAACTCAATCTACTTGG - Intergenic
941044200 2:160653999-160654021 CCCAAACAATTGCACCTACTTGG - Intergenic
942935538 2:181552230-181552252 CCGTATCAACTGTAGTCACTAGG - Intronic
946723121 2:222632438-222632460 TCTTAACCACTGTAACTACTAGG + Intronic
1174130342 20:48339980-48340002 CCCTGAGAACTGTATCTCCTGGG + Intergenic
949337599 3:2992926-2992948 CCCTAACAAATCTAACTCCTAGG + Intronic
952606950 3:35159028-35159050 CCCTAATAACTATAGCTACATGG + Intergenic
957784005 3:84856891-84856913 CCATAACAACTCTAGGTATTTGG + Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
968421633 4:489699-489721 ACCTGACATGTGTAGCTACTGGG + Intronic
973898541 4:55442078-55442100 CCCTAACCACTGTTACTACATGG + Intronic
979274860 4:118803728-118803750 ACCTAAGAAATGTAGCTAGTAGG - Intronic
980748704 4:137059161-137059183 GCCTAACCACTGTTGCTATTTGG + Intergenic
984434618 4:179693445-179693467 TCCTAAAAACTGTTCCTACTTGG + Intergenic
985566540 5:621170-621192 CCCTAACAACAGAAGCAACCAGG - Intronic
985773035 5:1824967-1824989 CCCTCACAACTGCAGCTCCATGG - Intergenic
990698549 5:58450510-58450532 CCCTAACAACTGTATTTCCAAGG + Intergenic
996494976 5:124144646-124144668 TCCTAGCTACTTTAGCTACTTGG + Intergenic
999762883 5:154716233-154716255 CCTTAACATCTGTAGCAGCTGGG + Intronic
1003620972 6:7699532-7699554 CCCTAACAATAGGAGCTATTGGG + Intergenic
1005952016 6:30638746-30638768 CCCTGCCACTTGTAGCTACTTGG + Intronic
1006389722 6:33751286-33751308 CCCCAACAGCTGAAGATACTGGG + Intergenic
1007553070 6:42745182-42745204 CCCTTACACCTGGAGCTACCCGG - Exonic
1008243508 6:49142659-49142681 TAATAACAACTGTAGCTACCAGG + Intergenic
1011479777 6:87782495-87782517 CCATAACAACTGTATCTTTTAGG - Intergenic
1012780289 6:103548708-103548730 ACCTAACAACTGAAGCTTGTAGG + Intergenic
1013662009 6:112307653-112307675 CCCCAATAACTGCAGCTACTGGG + Intergenic
1013959601 6:115883236-115883258 CACTATCAACTATGGCTACTAGG + Intergenic
1021794854 7:24243911-24243933 CCTTATCAACTGGGGCTACTCGG - Intergenic
1022199497 7:28103050-28103072 CCCTAGCAAGTGTTGCCACTGGG - Intronic
1024677276 7:51647978-51648000 GCCTAGCAACTGTAGCTAACAGG - Intergenic
1026619754 7:71939867-71939889 CCCTAACAATGGGAGCTACCAGG + Intronic
1027388616 7:77682887-77682909 CCCTAGCAAATTGAGCTACTTGG - Intergenic
1030838900 7:114322740-114322762 CACTAACAAATGTGACTACTAGG - Intronic
1031182595 7:118436211-118436233 CCCTAACAACTGTAACCCCAAGG + Intergenic
1041265825 8:56063563-56063585 CCTTAGCAACTGTAACTACAGGG - Intergenic
1041320699 8:56609685-56609707 CCCTAACAACAGGAGCTATCAGG - Intergenic
1047255143 8:123208439-123208461 CCCTGACAACTCAAGCTCCTAGG - Exonic
1061398979 9:130358149-130358171 CTCTGACAACTGAAGCTCCTAGG - Intronic
1185547923 X:960694-960716 CCCCAGCAACTGTACCCACTGGG - Intergenic
1189396654 X:40628997-40629019 CCCCAAAAACTGTTACTACTAGG - Intronic
1190653542 X:52591155-52591177 CCCTAACAAGAGTAGATTCTTGG + Intergenic
1192204232 X:69085682-69085704 CCCTAACTGCTGAAGCTGCTGGG + Intergenic
1197280916 X:124534904-124534926 CCCTAACAACTGTAGCTACTGGG + Intronic