ID: 1197288335

View in Genome Browser
Species Human (GRCh38)
Location X:124623727-124623749
Sequence TTTTTAAAGGGCAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 408}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197288335 Original CRISPR TTTTTAAAGGGCAATGAGGA AGG (reversed) Intronic
901471019 1:9456501-9456523 TTTTGAAAGGCCAAAGAAGAGGG + Intergenic
902160456 1:14526159-14526181 TTGCTAAATGACAATGAGGAGGG - Intergenic
902170089 1:14603247-14603269 TTTTCAAATGGCAGAGAGGATGG + Intronic
902201219 1:14835237-14835259 GCCTTAAAGGGCAGTGAGGAAGG + Intronic
902884401 1:19394227-19394249 CTTTGAGAGGGCAAGGAGGACGG - Intronic
904087196 1:27917146-27917168 TTTTTAAAGAGGAAGGAGGAAGG - Intergenic
905003525 1:34692589-34692611 TTTTTAAAAGGCAAAGAAAATGG + Intergenic
905520882 1:38598743-38598765 CTTGCAAAGGGCAATGAGGGTGG + Intergenic
905527765 1:38652122-38652144 TTTTTCAAGGGTAGTGAGTAGGG + Intergenic
905750856 1:40462372-40462394 TTTTTAAAGTGCAAGGAATATGG + Intronic
906307448 1:44728734-44728756 TTTTTAATTGGCAAAGAGGCCGG + Intergenic
908558190 1:65278977-65278999 TTTTTAAACTGCCATGGGGAAGG - Intronic
908945974 1:69497663-69497685 TTTTTTTAGGGCAATCAGGGGGG - Intergenic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
911207692 1:95108902-95108924 TTTTAAAAGATCAGTGAGGAAGG - Intergenic
911933886 1:103941578-103941600 TTTGTGATGGGCAATGAGGGAGG - Intergenic
913562812 1:120040058-120040080 TTTTAAAAAGGCTATGAGGAAGG - Intronic
913635310 1:120753549-120753571 TTTTAAAAAGGCTATGAGGAAGG + Intergenic
914283408 1:146199441-146199463 TTTTAAAAAGGCTATGAGGAAGG - Intronic
914406287 1:147376828-147376850 TTTTAAAAAGACAATGAGGCCGG - Intergenic
914544438 1:148650160-148650182 TTTTAAAAAGGCTATGAGGAAGG - Intronic
914622192 1:149420845-149420867 TTTTAAAAAGGCTATGAGGAAGG + Intergenic
914743560 1:150484940-150484962 TTTTTAAATGGCATTCAGAAAGG - Intergenic
914770300 1:150678001-150678023 TTTTTAAAGAGAAATGTGGCTGG + Intronic
915389416 1:155527913-155527935 TATTTAAAGGTCATGGAGGAAGG - Intronic
915828136 1:159100875-159100897 AATCTAAAGGGCACTGAGGATGG + Intronic
915843421 1:159236907-159236929 TTTTTAAAGGGTAAAGGGGCTGG + Intergenic
916832024 1:168502925-168502947 TTTTCAGATGGCACTGAGGAAGG + Intergenic
916951664 1:169786427-169786449 TTTTTAAAACGCAAAGAGGGTGG + Intronic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
918892883 1:190298390-190298412 TTTTTAAAGATCTTTGAGGAGGG + Intronic
919110472 1:193212966-193212988 TTTTAATAAGGAAATGAGGAAGG - Intronic
919171140 1:193955765-193955787 TATTTAAATGGCAATCAGCAAGG - Intergenic
919243772 1:194950557-194950579 TTTTTAAAAATCAAGGAGGAGGG + Intergenic
920572979 1:207032006-207032028 TTTGTAAAGGGATATGAGGTTGG - Intronic
920973434 1:210762829-210762851 TTTTTAAAAATCAAGGAGGAGGG + Intronic
921250214 1:213290424-213290446 TTTTTAAAAGGCGGGGAGGAAGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921468320 1:215518797-215518819 TTTTTAGATGTCAATCAGGAAGG - Intergenic
923889810 1:238200910-238200932 TCATTACAGGGCAAAGAGGAAGG - Intergenic
924513350 1:244746746-244746768 TTCTTAAAGGGCAATGAATGGGG - Intergenic
924580345 1:245317918-245317940 TTTTTCAAGGCCATTGAAGACGG - Intronic
924834830 1:247637769-247637791 ATTTTAAGTGGCAATTAGGATGG - Intergenic
1063268562 10:4481562-4481584 CTTGTAAAGGGCAATGATAAGGG - Intergenic
1063366548 10:5494254-5494276 TTTTAATGGGGCAAGGAGGAGGG - Intergenic
1063999796 10:11654064-11654086 TTTGAAATGTGCAATGAGGAAGG + Intergenic
1064879942 10:20040082-20040104 TGGTTAAAGGTTAATGAGGAAGG - Intronic
1065030286 10:21579101-21579123 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1065926943 10:30443085-30443107 TTTTTAATGGCCAATAAGTAGGG - Intronic
1066574312 10:36808967-36808989 TTGGAAAAGGGCAATGAGGCAGG - Intergenic
1067773384 10:49143871-49143893 TATTTAAAGGCTAATGAGGCTGG + Intergenic
1068870971 10:61944069-61944091 TTTGAAAAGGACAAAGAGGAGGG - Intronic
1069714451 10:70511729-70511751 ATTTTAAAAGGCATTGAGGGCGG + Intronic
1070070227 10:73081211-73081233 TTTTAAAAAGACAAAGAGGAGGG + Intronic
1070371129 10:75783076-75783098 CTTTTAAATAGCAATGATGAAGG + Intronic
1073967467 10:109007812-109007834 TTTTAAGAGGGAAATGTGGAAGG + Intergenic
1075695051 10:124428029-124428051 TATTTAAAAGGCAATGATGTCGG + Intergenic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1076112070 10:127867776-127867798 CTTTGAAAGGGCAATGAAGAAGG + Intergenic
1077674864 11:4187129-4187151 TCTTTAAAAGGGAATGGGGAGGG - Intergenic
1077974056 11:7227339-7227361 AATTAAAAGGGCAATGGGGAAGG + Intergenic
1078923366 11:15851860-15851882 TTTTTAAAGGACACAGCGGAGGG - Intergenic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1080581381 11:33646789-33646811 TTTTTAAAGGAAAAAGAGGGAGG - Intronic
1080892447 11:36421171-36421193 CTTTTAAATGTCAAGGAGGAAGG - Intronic
1081837557 11:46168905-46168927 TTTTAAAAGTTTAATGAGGAGGG + Intergenic
1081984531 11:47291988-47292010 TTCTTGAGGAGCAATGAGGAGGG + Intronic
1082131743 11:48498336-48498358 TTTTTAGAAGGCCATGAGAAGGG - Intergenic
1082245338 11:49915219-49915241 TTTTTAGAAGGCCATGAGAAGGG + Intergenic
1082565201 11:54668955-54668977 TTTTTAGAAGGCCATGAGAAGGG - Intergenic
1084311806 11:68321325-68321347 TTTGAAAAGGACAATGAGGTGGG - Intronic
1085974209 11:81633376-81633398 TTTTTAAAGGTAAATGAGACTGG + Intergenic
1087741661 11:101894895-101894917 TTTTTAAAATGCACTTAGGACGG - Exonic
1088787587 11:113196596-113196618 TTTTCAAAGCCCCATGAGGATGG + Intronic
1089263781 11:117242554-117242576 TTTTAAAAAGGCAGTGAGGCCGG + Intronic
1089850799 11:121494818-121494840 TTTTAAAACGGCAGAGAGGAAGG - Intronic
1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG + Intergenic
1090107462 11:123868309-123868331 TTTTTAAAGTGCACTGCGGATGG + Intergenic
1090725657 11:129524967-129524989 TTGTTGAAGGCCAATGATGAAGG + Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1093328906 12:17811700-17811722 TTTTTAAAGGGCAATTTCGTCGG + Intergenic
1094353231 12:29549756-29549778 TGTGTACAGGGCACTGAGGAGGG + Intronic
1094876417 12:34649359-34649381 TTTTTATGGGGCAATTTGGAAGG + Intergenic
1095046207 12:37509786-37509808 TTTTTATGGGGCAAGAAGGAAGG - Intergenic
1095132119 12:38555802-38555824 TTTCTAAAGGACAGTGATGAAGG - Intergenic
1095617586 12:44210316-44210338 TTTTAAAAATCCAATGAGGATGG - Intronic
1096298797 12:50407495-50407517 TTTTAAAAGAGGAATGAAGATGG + Intronic
1097933201 12:65213792-65213814 TTTTGAAAGGGGAGTGAGGAAGG + Intronic
1098056071 12:66506824-66506846 TATGTAAAAGGGAATGAGGAAGG + Intronic
1098322498 12:69260208-69260230 TTTTTAAATGGAAATGAGACAGG - Intronic
1098462007 12:70742385-70742407 ATTTTCAAGGGCAAGGAGTAGGG + Intronic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100305811 12:93349123-93349145 ATTTTAAATGGCAATGGCGAGGG + Intergenic
1100897550 12:99201072-99201094 TGTTCAAAGGGCAATAAGGAGGG + Intronic
1101856535 12:108448174-108448196 TTTTTAAAGGAGAAAGAGCAAGG - Intergenic
1102995588 12:117347582-117347604 GTTTTAAAGGGCAACAAGGAAGG + Intronic
1103448216 12:121008792-121008814 TTTTGAAAGGGAGATGAGGCAGG - Intronic
1104832559 12:131763828-131763850 TTTTTAAAGAAAAATGAGGCCGG + Intronic
1105573826 13:21630247-21630269 TATTTAAAAGGCAAGAAGGAAGG - Intergenic
1106466037 13:30015435-30015457 TTCTCAAGGGGCAACGAGGAGGG + Intergenic
1106794471 13:33190197-33190219 CTTTGGAAGGCCAATGAGGAAGG + Intronic
1107944328 13:45404168-45404190 CTTTTAAAGGTCCATGAGGTGGG - Intronic
1108085960 13:46794140-46794162 TTTTTGGAGGGGAAGGAGGAAGG - Intronic
1109135217 13:58640921-58640943 CTTTCAGAGGGCAATGAGGGAGG - Intergenic
1109434306 13:62278795-62278817 TATTGAAATAGCAATGAGGATGG - Intergenic
1110067281 13:71124636-71124658 TTGGTAAAGAGCAATGAAGAGGG + Intergenic
1110299159 13:73905774-73905796 TTTTTAAATGTTCATGAGGATGG + Intronic
1110437132 13:75487676-75487698 TTTTTCCTGGGCAATCAGGATGG - Intergenic
1110594874 13:77309116-77309138 TGTTTAAAGGGCAAGAAGGAAGG - Intronic
1110939927 13:81337336-81337358 TTTTTAAAGGTCAAGAATGAAGG + Intergenic
1113983069 13:114292788-114292810 TTTTTAAAGGAAAATGTAGAGGG - Intronic
1115100520 14:29692746-29692768 TTTTGAAAGGGCAAAGGGGAAGG - Intronic
1115914462 14:38295897-38295919 TAATTAAAGAGCAAAGAGGAAGG + Intergenic
1116966809 14:51023301-51023323 ATTCAAAAAGGCAATGAGGAGGG + Intronic
1117291403 14:54337239-54337261 TTGCTGGAGGGCAATGAGGAAGG + Intergenic
1117432139 14:55677992-55678014 TTTTTAAAGGGCCATGTTGCTGG - Intronic
1117448039 14:55823636-55823658 TTTCTAAAGGGCTAAGAGGTGGG - Intergenic
1117572302 14:57059686-57059708 TTTTTTCAGGGCACTGAGGGTGG + Intergenic
1117589917 14:57256620-57256642 TTCTTGAAGGGCAATCTGGATGG - Intronic
1117699840 14:58401597-58401619 TTTTTAAAATGCAATGAGCCTGG - Intronic
1118583388 14:67327408-67327430 TTTTCAGAGGCCAAGGAGGACGG + Intronic
1118977434 14:70689798-70689820 TTTTTGGAGGGCAAGGTGGAAGG + Intergenic
1119125119 14:72118141-72118163 TTTTTAAATGGCAGTGAGGGTGG - Intronic
1119125260 14:72119456-72119478 ATTTGAAAGGTCAATGATGAAGG + Intronic
1120933212 14:89869244-89869266 TTTTTAAAGTGTGAGGAGGAGGG - Intronic
1121059685 14:90895208-90895230 TTTTAAAAGGGTAATGAGGCTGG + Intronic
1121219399 14:92274601-92274623 TCTGTAAAGGGCACTGGGGAGGG - Intergenic
1121361626 14:93266595-93266617 TTTTTAATGGGAGAAGAGGATGG - Intronic
1121689721 14:95868659-95868681 CTCTTAATGGACAATGAGGAAGG - Intergenic
1121894690 14:97636026-97636048 TTTTTAAAAAGGAATGAGAAAGG - Intergenic
1124593968 15:31078481-31078503 TTTTTGAAGGCTACTGAGGAAGG - Intronic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1126136880 15:45401480-45401502 TTTTTTAACGGCAATTAAGAGGG + Intronic
1126288908 15:47048756-47048778 TTTTTATGGGGCAAGAAGGAAGG + Intergenic
1126323517 15:47450053-47450075 TTTTTAAAAGGCAATTAGAATGG - Intronic
1127016366 15:54692995-54693017 TTTTGATAGGGCAATGAAAAGGG - Intergenic
1127744599 15:61953737-61953759 TTTTTAAAGAGAAATAAGAAAGG - Intronic
1127859909 15:62985278-62985300 TTTGTGAAGGGTAATGAGGTGGG - Intergenic
1128268522 15:66288945-66288967 TTTGCAAAGGGCTAAGAGGACGG - Intergenic
1129091725 15:73157897-73157919 TTTTAAAAGAACAATGAGAAGGG - Intronic
1129430567 15:75498416-75498438 TTACTATAGGGCAATGAGGCTGG + Intronic
1130095950 15:80856330-80856352 TGTTTAAGGGGAAATGTGGACGG + Intronic
1130150448 15:81307556-81307578 TTTTTGAAGGTCAATTTGGAAGG + Intronic
1130654042 15:85779454-85779476 GTATTAAAATGCAATGAGGAGGG + Intronic
1130783804 15:87073470-87073492 TTTTTAAAGGGAAAGGAGCATGG - Intergenic
1130923897 15:88371017-88371039 GTTTCAAAAGGCAAAGAGGAAGG - Intergenic
1131850038 15:96530658-96530680 TATTTCAAGGGCAATGAGAGTGG + Intergenic
1132099251 15:99011738-99011760 TATTTGAAGGGCATTGTGGATGG - Intergenic
1133468302 16:6049308-6049330 TTTTTAAAGGAGACTGAGGTGGG - Intronic
1133518443 16:6532523-6532545 TATTTAAAGGGTACAGAGGAAGG - Intronic
1133724102 16:8521549-8521571 TCTCTAAAGGGCAAAGATGAAGG + Intergenic
1134863441 16:17582740-17582762 TTATTAAAGTAGAATGAGGATGG + Intergenic
1135184484 16:20303449-20303471 TTTTTAAAGGCAAAAAAGGAGGG + Intergenic
1136159129 16:28406718-28406740 CTTTTAAAAGGCAATCAGGCTGG - Intergenic
1136203958 16:28708565-28708587 CTTTTAAAAGGCAATCAGGCTGG + Intronic
1137498888 16:48995354-48995376 TTAATAAAGAGGAATGAGGAGGG + Intergenic
1138704934 16:58905768-58905790 ATTTTAATGGACAATGGGGAAGG + Intergenic
1138999702 16:62494636-62494658 TGTGAAAAAGGCAATGAGGATGG + Intergenic
1139744550 16:69063688-69063710 TTTTTAATGAGTAGTGAGGATGG + Intronic
1140162302 16:72510138-72510160 TTTTTAAGGTGCAATTAGTACGG + Intergenic
1140276890 16:73517420-73517442 TTTGCAAAGGTCAATGAGAAGGG - Intergenic
1140332600 16:74072412-74072434 TTTCCAAAGGGAAATGAGAAGGG + Intergenic
1140643432 16:77003386-77003408 TATTTATTGGGCAATGAGCATGG - Intergenic
1140949088 16:79798496-79798518 TTTTTCCAGGGCAATGAAGAAGG - Intergenic
1141753936 16:85978832-85978854 TTTTCCAAGGGCAAGGAGAAAGG - Intergenic
1143233743 17:5380014-5380036 TTTTTACAGGGCAAAGACAAGGG - Intronic
1143611825 17:8022296-8022318 CTCTGAAAAGGCAATGAGGAGGG + Intergenic
1144319216 17:14097245-14097267 TTTGAAAAAGGCAGTGAGGACGG - Intronic
1144429400 17:15177286-15177308 TTCATAAAGGGCAATGGTGAGGG - Intergenic
1146116466 17:30144864-30144886 TATTTAAAGGGGAATGAGAGGGG - Intronic
1146497750 17:33338030-33338052 TTCTGGAAGGGCAAAGAGGATGG + Intronic
1146622810 17:34412910-34412932 TTTCTAAAAGGCAATGCTGAAGG - Intergenic
1146673883 17:34759805-34759827 TTTCTGGAGGGCAATGAGGAAGG - Intergenic
1146876671 17:36418938-36418960 TTTTTGAAGGGCATTGTGGTTGG + Intronic
1147062713 17:37893923-37893945 TTTTTGAAGGGCATTGTGGTTGG - Intergenic
1148151538 17:45399294-45399316 TTTTTAAAATGAAATGAGGCTGG + Intronic
1148357914 17:46988496-46988518 TTTTAAAAAGGCAATGATGCAGG + Intronic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1151076757 17:71282278-71282300 TTTGGAAAGGGAAATCAGGAGGG - Intergenic
1151593985 17:75065601-75065623 TTTTTCCATGGCAATGAGGTGGG + Exonic
1153350391 18:4074397-4074419 TTTTTAGAAGGAAATGAGGGAGG + Intronic
1155402970 18:25458904-25458926 TTATGAAAGGGCAAGGAAGAGGG - Intergenic
1155870234 18:31018129-31018151 ATTTTAAAGGGAAATGAAAATGG - Exonic
1155875532 18:31082296-31082318 ATTTTAAAGGGCAATGAAAATGG - Exonic
1156125356 18:33898448-33898470 TTTTTCAAGGGCTATGTGGAAGG - Intronic
1156333166 18:36144632-36144654 TTGTTAAACCACAATGAGGAAGG - Intronic
1156852829 18:41747885-41747907 TTTTTAAAGTACATTAAGGATGG - Intergenic
1157078080 18:44489908-44489930 TTTTTAAGAGGCAGGGAGGAAGG - Intergenic
1157154835 18:45255296-45255318 TTTAAAAGGAGCAATGAGGATGG - Intronic
1157158454 18:45290044-45290066 CTTTTAAAGGCCAATGAGAGAGG - Intronic
1158315989 18:56211668-56211690 TTCCTAAAGGGAAATGAGAATGG + Intergenic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1159068377 18:63594427-63594449 ATTTTAAAGGGCAATGGGACAGG + Exonic
1159133357 18:64306893-64306915 CTTTTAAAGATCAAAGAGGAAGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1161666588 19:5580728-5580750 TTCTTAAAGGGCAGAGGGGAGGG + Intergenic
1161884303 19:6981880-6981902 TTCTTAGAGGGGAATTAGGATGG - Intergenic
1164518404 19:28956625-28956647 TGGTTAAAGGATAATGAGGAAGG + Intergenic
1164961724 19:32437127-32437149 GTTTTAAATGGCACTGAGGAGGG + Intronic
1166217326 19:41344226-41344248 CTTTTGAAGGCCAAGGAGGATGG - Intronic
1166413682 19:42576187-42576209 TTTTGAAAGGCCAAGGTGGAAGG + Intergenic
1166672878 19:44722190-44722212 TTGTTTGAGGCCAATGAGGAGGG + Intergenic
1166829078 19:45627747-45627769 TTTTTAATTTGCAATGAGGTGGG - Intronic
1167256780 19:48435213-48435235 TTTTTACAAGCCAAGGAGGAAGG - Intronic
925364220 2:3300453-3300475 TTTTTAGGGAGCAATGATGAAGG - Intronic
925486386 2:4336964-4336986 TTCTTAAAAAGCAGTGAGGATGG + Intergenic
925735588 2:6960462-6960484 TTTTAAAAAGGCAATGAGAGTGG + Intronic
926778314 2:16444113-16444135 ATTTAAAAGAGCAAGGAGGAAGG - Intergenic
927435709 2:23064495-23064517 TTTATAAAGGGAAATGATCATGG - Intergenic
928017840 2:27674990-27675012 CTTTTAAAAATCAATGAGGATGG - Intronic
928099142 2:28424856-28424878 TTTTTAAAAAGCAGTGAGTATGG - Intergenic
928150396 2:28823065-28823087 ATGTAAAAGGGCAATGATGATGG - Intronic
928349923 2:30540972-30540994 TTTTTTAAAGGTAATGAGGCTGG + Intronic
928553535 2:32398284-32398306 CTTTTAAATGCCAATCAGGAGGG + Intronic
929808125 2:45165477-45165499 TTTTTAAAAGGCAGAGAGGTTGG - Intergenic
931121433 2:59224782-59224804 ATATTAAAGGACAATGAAGAAGG - Intergenic
931649620 2:64455455-64455477 ATTTTAAAAAGCAATGAGAAAGG - Intronic
932010257 2:67970451-67970473 CTTTTAAAGGGAAAGGAGGCTGG + Intergenic
932357605 2:71079113-71079135 TTTTTGAAAGGTTATGAGGATGG + Intronic
934962113 2:98685322-98685344 TTTTTAAATATGAATGAGGAAGG + Intronic
935387980 2:102521384-102521406 TAATTCGAGGGCAATGAGGAAGG - Intronic
937349147 2:121149435-121149457 TTTTTAAAGGGTGATGGGAAAGG + Intergenic
937759009 2:125577135-125577157 TTTTTAAAGGGAAATAAAAAAGG + Intergenic
938300807 2:130210603-130210625 TTTATACACAGCAATGAGGAAGG - Intergenic
938455916 2:131463871-131463893 TTTATACACAGCAATGAGGAAGG + Intergenic
938761656 2:134431556-134431578 TCTTCAAAGGGCAGCGAGGATGG + Intronic
938790915 2:134674925-134674947 TTTTTAAAGGAACATGAAGAGGG - Intronic
939496630 2:142934238-142934260 CTTTTTAAGGGCAATGTGGATGG + Intronic
940323666 2:152402655-152402677 TTTTAAAAAGTCAAAGAGGAAGG - Intronic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
940640086 2:156335054-156335076 GTTTTTAATGGCAATGAGGGAGG - Intronic
940713610 2:157192378-157192400 TTTTGACAGGACAATGAGCATGG + Intergenic
941882827 2:170499166-170499188 GTTTTATAAGGCAATCAGGATGG - Intronic
941943072 2:171064224-171064246 TTATTAAAGGGGAAGGAGAAGGG + Intronic
942560196 2:177211810-177211832 TTTTTAAATGAAAATGGGGATGG - Intergenic
942631812 2:177958185-177958207 TTTTTAAAATGCATTGAGGCCGG - Intronic
943143601 2:184014748-184014770 TTTTGGCAGGGCAATGAGAAAGG - Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946286609 2:218708643-218708665 TGTTTAAAGGTTAATAAGGAAGG + Intergenic
946690094 2:222303048-222303070 TTTTTTAAAGGCAGTGAGGGAGG + Intronic
946810875 2:223524148-223524170 TTTTCAAAAGACAATGTGGATGG - Intergenic
946939833 2:224759063-224759085 TTTTAAAAGGCCAATCTGGAAGG - Intergenic
946981856 2:225226811-225226833 TTTTTAAAGGGCGATCAGGGTGG + Intergenic
947319153 2:228897242-228897264 TTATCAAGAGGCAATGAGGAAGG - Intronic
947382621 2:229559952-229559974 TTTTAAAAGGGCCATAATGATGG - Intronic
1169475747 20:5929831-5929853 TTTGTAAAGGGCAGTGATGGGGG + Intergenic
1170448585 20:16457381-16457403 TTATTAAACAGCAATGAGTATGG - Intronic
1170583093 20:17713420-17713442 TTTGTCAGGGGCTATGAGGAGGG + Intronic
1170992469 20:21315792-21315814 TTTTAAAAGGGCAAAGAGGCCGG - Intronic
1171540766 20:25953387-25953409 TTTTTATGGGGCAAGAAGGAAGG - Intergenic
1171800305 20:29606942-29606964 TTTTTATGGGGCAAGAAGGAAGG + Intergenic
1171843793 20:30249766-30249788 TTTTTATGGGGCAAGAAGGAAGG - Intergenic
1174531407 20:51217496-51217518 TTCTACTAGGGCAATGAGGAAGG - Intergenic
1174625488 20:51911042-51911064 ATTTTAAAAGGAAATGAGGGTGG - Intergenic
1174980475 20:55388719-55388741 TTTATAAAGGAGAATCAGGACGG - Intergenic
1175029096 20:55934425-55934447 TTCTTTAAGGGCAAAGATGATGG - Intergenic
1175145025 20:56889390-56889412 TTTTTAATAGGAAAGGAGGATGG + Intergenic
1175765063 20:61586752-61586774 TTTTCCAAGGGCAAACAGGATGG - Intronic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1177300522 21:19238856-19238878 TTTTTAAAGTGAAAGAAGGATGG - Intergenic
1177846292 21:26291349-26291371 TCTTTAAAATGCAATGAGGGAGG - Intergenic
1178210731 21:30528799-30528821 TTTTTAAAGGTCAAATAGTAAGG - Intergenic
1179204122 21:39257554-39257576 TTTAAAAAAGGCCATGAGGAAGG + Intronic
1181871874 22:25905847-25905869 TCTTTAAAGGGCATGGATGACGG + Intronic
1181962293 22:26631092-26631114 TTTTTAAAGACCAATGTGGTCGG + Intergenic
1182758225 22:32698625-32698647 TCTGTAAAGGGCAATGATGGTGG + Intronic
1183324502 22:37184043-37184065 TTTGGGGAGGGCAATGAGGAGGG + Intronic
1183413396 22:37668609-37668631 CTTTTAAAGGACATAGAGGAGGG + Intergenic
1184270387 22:43377999-43378021 CTTTTCAAGGGCCAGGAGGAAGG - Intergenic
1184367234 22:44059735-44059757 TTTTTAAAGGAAAATGTGTACGG - Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
950545897 3:13637725-13637747 ATCATCAAGGGCAATGAGGAGGG + Exonic
950915435 3:16640286-16640308 TTTTAAAAGGGAAATATGGAGGG - Intronic
951402976 3:22257684-22257706 TATTTAAAAGGCATTGTGGAGGG - Intronic
952022226 3:29037343-29037365 TTTTGAAAGAGCAATGTTGAAGG + Intergenic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
955049578 3:55397023-55397045 TTTTAAAAGGACAATGAAGATGG + Intergenic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
956538688 3:70309066-70309088 TTTTTAAGGGGGAGTGAGGGAGG + Intergenic
956981650 3:74645678-74645700 GTTTTAAAAGGCTATGAGAAAGG + Intergenic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957369329 3:79271856-79271878 ATTTTAAAGGTCAATAATGAAGG - Intronic
957999362 3:87731909-87731931 TTTTGAAATGGAAATGAGGAGGG + Intergenic
959207592 3:103330484-103330506 TGTTTAAATGGGAATAAGGATGG - Intergenic
960642479 3:119840181-119840203 TTTTTAAAAAGCCATGTGGAGGG - Intronic
962873546 3:139518734-139518756 ATTTAAAAGGGTAATTAGGAGGG + Intronic
962915234 3:139895342-139895364 TATGTACATGGCAATGAGGATGG - Intergenic
963918754 3:150885802-150885824 GTTTAACGGGGCAATGAGGAAGG - Intronic
964151365 3:153528548-153528570 TTTTTAAGGGAGAATTAGGAAGG - Intergenic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
964662886 3:159140279-159140301 TTTTTAAATAGCAATGATAAAGG + Intronic
965475388 3:169149278-169149300 TTTGTAAAGGGCAAGGAGGTGGG - Intronic
965685957 3:171302789-171302811 TTATAAAAGGGCAATGAGAGAGG - Intronic
966471086 3:180289649-180289671 ATTTTAAAAAGCAATGAGAAAGG - Intergenic
966793690 3:183695215-183695237 TTTTAAAAGGGCAAATAGGCTGG + Intergenic
967717551 3:192780204-192780226 TCTTTAAAGAGCTATGAAGAAGG - Intergenic
970237362 4:13972376-13972398 TCTTTAAAGAGCAAAGGGGAAGG + Intergenic
970636387 4:18014117-18014139 ATTTTAAAGGCGACTGAGGATGG + Intronic
973370516 4:49243287-49243309 TATTTAAAGGGCAATAATGTGGG + Intergenic
973390509 4:49552129-49552151 TATTTAAAGGGCAATAATGTGGG - Intergenic
973829083 4:54740052-54740074 TTTATATTGGGCAGTGAGGAAGG - Exonic
975332531 4:73133706-73133728 TTTTTAAAAGGCTATGTAGATGG + Intronic
975491380 4:74992553-74992575 TTTTTTAAGGCCAATGGGGCAGG + Intronic
977290881 4:95162979-95163001 TTTACAAAGAGCAAAGAGGAAGG + Exonic
978124899 4:105123773-105123795 TTTTTAAACAGCATTGAGGGTGG - Intergenic
979206933 4:118049030-118049052 TTTTTAAATTGCACTGAGGTTGG - Intronic
980091513 4:128447762-128447784 TTTATAAACAGAAATGAGGAAGG + Intergenic
980308897 4:131101190-131101212 TTTTGCTAGGGCAGTGAGGAAGG + Intergenic
980702823 4:136454960-136454982 TTCTAATAGGGCAATGTGGAGGG + Intergenic
982161451 4:152574019-152574041 TTTTTAAATGCAAATGAAGAGGG + Intergenic
982678620 4:158403853-158403875 TTTTTAGAGGCCAAGGGGGAGGG - Intronic
983261095 4:165457646-165457668 TTTTTAATGGGCAGTCAAGATGG - Intronic
983477023 4:168225884-168225906 ATTTTTAAGGGTAATGAGTAAGG - Intronic
983625463 4:169797579-169797601 TTTTTAAATTGCACTGAGGTTGG + Intergenic
983895564 4:173077790-173077812 TTTTTAATAGGTAAGGAGGAAGG + Intergenic
983976688 4:173943452-173943474 TTTTCAAAGGACAATGAGGTGGG - Intergenic
984980730 4:185278026-185278048 TTTTTAAAAGGTAATAAGGCCGG - Intronic
985168952 4:187127894-187127916 TTTTTAAAAAGCAATGAAAATGG + Intergenic
986773887 5:10996391-10996413 TCTCAAAAGAGCAATGAGGAGGG + Intronic
987340895 5:16937660-16937682 TTTCTAAAGGGAAGTGAGGTGGG - Intergenic
987877874 5:23703481-23703503 TTTTTAAAGGTAACTTAGGAAGG + Intergenic
988203745 5:28105395-28105417 TTTGTAAAAGGCAATGACAAGGG + Intergenic
989242584 5:39217896-39217918 TTTTTAAAGCACATTGAGGCTGG + Intronic
989293815 5:39800104-39800126 TTTTTAAAAGGAAATAAGAATGG + Intergenic
989411014 5:41120478-41120500 TTTTTAGAGGCCAAGGAGGGAGG + Intergenic
990646823 5:57854780-57854802 TTATTTAATGGAAATGAGGAGGG - Intergenic
991147520 5:63324176-63324198 GTTTTAAGGGGCAATGGAGAGGG - Intergenic
991341485 5:65615511-65615533 TTTTTTAAGAGCCAGGAGGAAGG - Intronic
993111054 5:83657688-83657710 TTTTTAAAATGAATTGAGGATGG + Intronic
993707981 5:91193280-91193302 TTATTATAGGGAGATGAGGAAGG + Intergenic
993838955 5:92852306-92852328 GTATTAAAGGGCAATAATGATGG + Intergenic
994342603 5:98649114-98649136 TTTTTACAGGGCACAGATGATGG + Intergenic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
996357163 5:122608494-122608516 TTTTGAAAGGCCAAAGCGGAAGG + Intergenic
996827713 5:127704024-127704046 ATTTGAAAGGGAAATGAGTATGG - Intergenic
996932438 5:128906168-128906190 TTTTTACAGGGCAATCATGGAGG - Intronic
998556674 5:143131817-143131839 TTTTTAAATGTCAATGATAATGG + Intronic
998992415 5:147832551-147832573 TTTGTAAAGGGCAATTAACATGG - Intergenic
999227892 5:150042418-150042440 TTTATAGAGGGCAGTGAGGGGGG + Intronic
1000102419 5:158029061-158029083 TTTCTAAATGGCAATGTGGAAGG + Intergenic
1000631938 5:163600574-163600596 TTTTTGGAGGGCAATGGGAAGGG + Intergenic
1000881114 5:166698664-166698686 TTTTTAAAGGGCAGGGGGGATGG - Intergenic
1001226300 5:169947324-169947346 TTTTCCAAGGGGAATGAGGAGGG + Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1003071465 6:2948449-2948471 TTTGTGGAGGTCAATGAGGAAGG - Exonic
1003800993 6:9667115-9667137 TTTTTAAATCGCAATAAGCAAGG - Intronic
1004829178 6:19458805-19458827 TTTTTAAAGGAGGAGGAGGAAGG + Intergenic
1005950071 6:30625456-30625478 AATTTAAGAGGCAATGAGGAGGG - Intronic
1005976754 6:30806013-30806035 TTCTAAAAGGGCAAGGAAGATGG - Intergenic
1007122812 6:39397429-39397451 TTTTCAAAGAGGAAAGAGGAAGG + Intronic
1007299993 6:40860587-40860609 ACTTTAAAGGGCAATGAACATGG - Intergenic
1007339621 6:41182239-41182261 TCCTTAAAGGGATATGAGGAAGG - Intergenic
1008045857 6:46850550-46850572 TTTTAAAAGGGCAACGGGAATGG - Intergenic
1008052008 6:46909729-46909751 TTTTCAGAGGGCAAGGAGAAAGG + Intronic
1009312825 6:62177010-62177032 TTTTGAAAGTGCAATGGTGAGGG - Intronic
1009881822 6:69577086-69577108 TTATTAAAGGTTAAAGAGGAAGG - Intergenic
1009922602 6:70080975-70080997 TTTTCAAAGTAAAATGAGGATGG + Intronic
1010380910 6:75223985-75224007 ATTCTAAAGGACAATGAAGATGG + Intergenic
1010800918 6:80174736-80174758 ATTCTATAGGGCACTGAGGATGG + Intronic
1011241767 6:85279122-85279144 TTTTCAAAGTACAATGAAGAGGG - Intergenic
1012126258 6:95431998-95432020 TTTTTAAAGTCCAATTATGAGGG - Intergenic
1012204778 6:96447740-96447762 TTTTGAAAGGCAAATGAGTAAGG + Intergenic
1012931991 6:105327109-105327131 TGGATAAAGGGCAATGAGGAGGG - Intronic
1013574823 6:111471808-111471830 TTTTTTAACAGCAATGTGGAAGG + Intronic
1013778790 6:113707627-113707649 TTTTTGAGGGGGAATGAAGATGG + Intergenic
1013989628 6:116238563-116238585 TTTTTAGAAAGGAATGAGGATGG - Intronic
1014723416 6:124947278-124947300 TTTTCATAGGGGAATGAGGTAGG + Intergenic
1014738143 6:125119258-125119280 TTATTAGATAGCAATGAGGATGG + Intronic
1015894446 6:138003111-138003133 ATTTTAAAGTGAAATGAGGTTGG - Intergenic
1016698399 6:147025577-147025599 TTTATAAAGGGCAGTAAGCATGG - Intergenic
1017626922 6:156358399-156358421 ATTTTAAAGGGGAAAAAGGAGGG + Intergenic
1020021005 7:4868802-4868824 TTTTTAAAGTGCAATCTGTAAGG - Intronic
1020419701 7:7987830-7987852 CTTTTAAAGGCCAAAGCGGAAGG - Intronic
1020726895 7:11827110-11827132 TTTTTAGAGGTCAAGGTGGAAGG - Intronic
1021081156 7:16367063-16367085 TTTATAAAGAGAAATGAGTAGGG - Intronic
1021477032 7:21073670-21073692 AATTTAAGGGGAAATGAGGAAGG + Intergenic
1021579635 7:22139278-22139300 TGCTTAAAGAGCAATGATGAGGG + Intronic
1021894984 7:25224828-25224850 TTTATATAGGGTAGTGAGGAGGG + Exonic
1022591496 7:31667909-31667931 TATTCAAAGGGCAAGCAGGAGGG + Intergenic
1022785845 7:33635845-33635867 TTTTTAAAGGGCAAAGACAATGG + Intergenic
1022858818 7:34343792-34343814 TTTTTGAAAGGAAATTAGGAAGG + Intergenic
1022944636 7:35270106-35270128 TTTTTAAAATACCATGAGGAAGG - Intergenic
1023085759 7:36568676-36568698 TTTCTGAAGGGGATTGAGGAGGG - Intronic
1024134413 7:46391999-46392021 TTTGTAAAGAGAAATGAGCAGGG + Intergenic
1024353022 7:48386705-48386727 TTTGTATATGGCAATAAGGAAGG - Intronic
1024681341 7:51692798-51692820 TTTTTAAAGGACAATCATGAAGG - Intergenic
1025292190 7:57739638-57739660 TTTTTATGGGGCAAGAAGGAAGG - Intergenic
1025798836 7:64765142-64765164 TTTTTAAAGGCAAAAAAGGAAGG - Intergenic
1025997888 7:66539601-66539623 TATTTAAAGGGGAAAGAGGGGGG + Intergenic
1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG + Intronic
1027185320 7:75967651-75967673 TTTTTAATGGGAAACGGGGAGGG + Intronic
1027737652 7:81954418-81954440 TTTTTAAAGAGTAATGAGAAAGG - Intronic
1027745150 7:82063657-82063679 TTTTTAAAGAGCAATAATCAAGG - Intronic
1028297550 7:89153970-89153992 TTTTTAAAAGGTGATGGGGAAGG - Intronic
1028731223 7:94150608-94150630 TTTGTAAATGGCAAAGAGAAGGG + Intergenic
1029181883 7:98708154-98708176 TTTTTAATGGGCAAAGGGGCCGG + Intergenic
1030800175 7:113840234-113840256 TTTTTTGAGTACAATGAGGAGGG + Intergenic
1032131733 7:129234600-129234622 CTTTCAAAGGCCAAGGAGGAAGG - Intronic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1032825860 7:135567266-135567288 TTTTTAAAGGGAGATGTGCAGGG - Intronic
1032944174 7:136831061-136831083 CTTTTAAATGTTAATGAGGATGG + Intergenic
1033824879 7:145177396-145177418 TTTCTAGAGGACAAAGAGGATGG + Intergenic
1035900794 8:3456773-3456795 TCTATAATGGGCAATGGGGATGG - Intronic
1036053613 8:5226869-5226891 TTTTAAAAGGAAAATGAAGAAGG - Intergenic
1036731136 8:11265929-11265951 TTTTTGAAGAAAAATGAGGAGGG - Intergenic
1037213142 8:16416372-16416394 TTTTTAATAGGAAGTGAGGAGGG + Intronic
1037357105 8:18032557-18032579 TTTATAAACAGCAATGAAGATGG - Intergenic
1039311936 8:36326034-36326056 TTAATAAAGGGCTATGAAGAAGG + Intergenic
1039476208 8:37840647-37840669 AATTTAAAGGGGAAAGAGGATGG + Intronic
1039883958 8:41645211-41645233 TTTTTGAAAGCCAGTGAGGATGG + Exonic
1041181933 8:55258234-55258256 GTTTTACAGAGCAATGGGGAGGG + Intronic
1041234083 8:55781343-55781365 TTTTTAAATAGAAATGAAGAAGG - Intronic
1041431709 8:57788894-57788916 TTCTTAAAAATCAATGAGGAGGG + Intergenic
1043126394 8:76401501-76401523 GTTTTAAAGGGAAATAAAGAAGG - Intergenic
1043518243 8:81016690-81016712 ATTTTAAAGGGCAAGGAGAAAGG - Intronic
1046046169 8:108967394-108967416 TTTTTAAAGCACAAAGTGGAAGG + Intergenic
1046117791 8:109804907-109804929 CTTTTCAAGGACAATGGGGAAGG + Intergenic
1046125234 8:109898840-109898862 TTTTTAAAAAGAAATGAAGAAGG - Intergenic
1046382198 8:113466145-113466167 TTTTTAAAACACAGTGAGGAAGG - Intergenic
1046993405 8:120486982-120487004 TATTTTAGGGGCTATGAGGATGG - Intronic
1048599851 8:135908041-135908063 TTTTTTAAAGGTAATCAGGAAGG - Intergenic
1050297954 9:4225865-4225887 TTCTTCAGGGGAAATGAGGAAGG + Intronic
1050420082 9:5454289-5454311 TTTTTAAAGGGAAAAAAGGAAGG - Intronic
1050491656 9:6195094-6195116 TTTTTTAAGGGCAATTTGGCCGG + Intergenic
1051993885 9:23189850-23189872 TTTTGAAAGGAGAATGAGAAAGG - Intergenic
1052021292 9:23528535-23528557 TTTTCAAAGTACAATGTGGAGGG + Intergenic
1052353366 9:27480104-27480126 ATTTTCAGGGGAAATGAGGAAGG + Intronic
1052598089 9:30587463-30587485 TTTGTGAATGGCAATGAAGAGGG - Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1054164305 9:61706066-61706088 TTTTTATGGGGCAAGGAGGAAGG + Intergenic
1054808171 9:69412677-69412699 TTACTAAAGGGAACTGAGGATGG + Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055858125 9:80716701-80716723 TGTTTAAAGGGCAATGGGGGTGG + Intergenic
1056844632 9:90026523-90026545 TTTTAAAAGGGAAATGTGGGTGG + Intergenic
1057508828 9:95660694-95660716 TTTTTAGAGGAAAATGGGGATGG + Intergenic
1058634689 9:107024918-107024940 TTTATTAAGGGTAATGATGAGGG - Intergenic
1059288261 9:113197065-113197087 TTTTTAAAGGGCTGGGAGGATGG - Exonic
1185830165 X:3294067-3294089 TCTTTTAAGGGCATTTAGGAAGG - Intergenic
1186388106 X:9130536-9130558 ATTTTAAAGGAACATGAGGAAGG + Intronic
1186683800 X:11903031-11903053 TTTTTGAAGGAAACTGAGGAAGG + Intergenic
1186693395 X:12003771-12003793 TTTTTAAAGGGGAAAGTGAAAGG - Intergenic
1188585109 X:31764170-31764192 TTTCTAAATGAAAATGAGGACGG - Intronic
1189356403 X:40313092-40313114 TTTGTAAGAGGCAATGATGATGG + Intergenic
1190738412 X:53270949-53270971 TTTTAGAAGGGAAATGAGGGAGG - Intronic
1191675644 X:63789587-63789609 TTTTTACAGGGGAAAGATGATGG + Intergenic
1192115407 X:68405845-68405867 TATATAAAGGGCAATGAGGCTGG + Intronic
1192342590 X:70276599-70276621 TTCTTATAGGCCCATGAGGAAGG + Intronic
1194553024 X:95324470-95324492 TTTTTAAAAAGCAAGGAGGAGGG + Intergenic
1195773011 X:108372399-108372421 TTTTCACAGAGCACTGAGGAAGG - Intronic
1196898328 X:120359652-120359674 TTTTTGAAGTGCATGGAGGAGGG - Intergenic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1197532043 X:127640852-127640874 TCTTTAAAGGGCAATGTGAAAGG + Intergenic
1197800663 X:130344515-130344537 GTTTTAAAAGGCCAAGAGGAAGG + Intronic
1198931878 X:141870861-141870883 TTTTTAAAGGCCAAAGAAGCAGG + Intronic
1199270939 X:145881915-145881937 TCTTGAAAGGGGAATGTGGATGG + Intergenic
1199372768 X:147070794-147070816 TTTTTTAATGGCTATGAGTATGG + Intergenic
1200245761 X:154524104-154524126 CTTTGAAAGGCCAATGAGGGCGG + Intergenic
1201247808 Y:12023436-12023458 TCTTTGAAGGGCACTTAGGAAGG + Intergenic
1202203089 Y:22375222-22375244 TTTTTAAAGAGCAAGTAGGAAGG - Intronic