ID: 1197288844

View in Genome Browser
Species Human (GRCh38)
Location X:124630108-124630130
Sequence ATGAACAAAAAGAAGACTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 746
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 673}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197288844 Original CRISPR ATGAACAAAAAGAAGACTGT TGG Intronic
900251544 1:1672879-1672901 TTTAGCAAAAAGAAGTCTGTGGG - Intronic
900261905 1:1735414-1735436 TTTAGCAAAAAGAAGTCTGTGGG - Intronic
900744971 1:4354919-4354941 GTTAACAAACAGCAGACTGTGGG - Intergenic
901767061 1:11508520-11508542 ATGAAAAAAAAGAAGACACACGG - Intronic
901786433 1:11627983-11628005 ATAAACTAAAAGAGAACTGTAGG + Intergenic
902738516 1:18417648-18417670 ATGAAGGAAAAAAAGACTGTTGG + Intergenic
903386085 1:22927831-22927853 ATGAACAAAGAAATGACTGAAGG + Intergenic
903552052 1:24164370-24164392 ATGAAATCAAAGAAGGCTGTTGG - Intronic
903831836 1:26180129-26180151 AAAAACAAAAAAAAGACTGCTGG + Intronic
904545149 1:31264331-31264353 ATGACAAGAAAGAAGACAGTAGG - Intronic
905182815 1:36177254-36177276 ACGAACAAAAAGAAAAATGGAGG - Intronic
906061414 1:42951566-42951588 ATGCACAAAGAGAAGTCTTTAGG + Intronic
906468066 1:46102630-46102652 AAGAAAGAAAAGAAGAGTGTTGG + Intronic
906991995 1:50748845-50748867 ATGAAGAAAAAGAAGAGTGGGGG + Intronic
907265513 1:53257699-53257721 ATCAGCAATAAAAAGACTGTAGG + Intronic
907678769 1:56543832-56543854 CTCCACAAAAAGAAGACTGTTGG + Intronic
907739181 1:57147424-57147446 AAAAACAAAAAGAAAACTGGGGG - Intronic
908230797 1:62103041-62103063 GTGAACAAAAAGATGACTTGTGG - Intronic
908284592 1:62581477-62581499 ATGAACACAGAGAAGACAGCAGG + Intronic
909124396 1:71647429-71647451 ATGAATAAAAATAAAAATGTGGG - Intronic
909188861 1:72525775-72525797 AAGAACAAAAAACAGACTGCAGG - Intergenic
909367724 1:74847332-74847354 AGAAACAGAAAGAAGACTGGTGG + Intergenic
909420998 1:75465218-75465240 ATCAACAACAAGAAGAATCTTGG + Intronic
909799971 1:79794969-79794991 TTGAACAAAAAGAATAAAGTAGG - Intergenic
910251922 1:85206843-85206865 ATCAACAAAATCCAGACTGTGGG + Intergenic
910709184 1:90161057-90161079 ATGAACAAATAGAAAATTGCTGG + Intergenic
911054609 1:93699360-93699382 ATGAACAGGAAGAAGACTGTAGG - Intronic
911083218 1:93953943-93953965 ATCAATAAAAAGAAGAATTTTGG - Intergenic
911172870 1:94788062-94788084 CTGAACAAAAAGAACAAAGTTGG + Intergenic
911730306 1:101285671-101285693 ATCAAAAAAAAGAAATCTGTGGG + Intergenic
911746729 1:101449086-101449108 ATGAATAAAATGAAAATTGTTGG - Intergenic
912590133 1:110809665-110809687 AACAACAAAAAAAAGACTATAGG + Intergenic
912875598 1:113355420-113355442 TTGAACAAAAAGAAGTAAGTAGG - Intergenic
913022040 1:114797939-114797961 TCAAACCAAAAGAAGACTGTTGG + Intergenic
913211540 1:116586822-116586844 AGGAACCAAAAGAACACTGGTGG + Intronic
914866936 1:151438389-151438411 ATGAAAAAAAAGAAGACAGTGGG - Intronic
916372073 1:164109616-164109638 ATAAATAAAAAGAATACTGAGGG - Intergenic
916717821 1:167460099-167460121 TTGAACAAAAATAAGATTATGGG + Intronic
917233415 1:172863110-172863132 ATGAACAGATAGAGGACTATGGG + Intergenic
917396286 1:174597959-174597981 ATCAACAACAAGAGGAATGTTGG - Intronic
917421275 1:174866572-174866594 ATGAGGAGAAAGAAGACTGAAGG - Intronic
917577180 1:176335846-176335868 AAGAACAAAAGGAAGAATGAAGG - Intergenic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917886414 1:179389690-179389712 AGGAAGAAACAGAAGACTCTAGG - Intronic
918018062 1:180657728-180657750 CTGAGCAAAAAGAAAACTGGAGG - Intronic
918119083 1:181521890-181521912 AGAAACAAAAAGAAGGCTGGAGG + Intronic
918257337 1:182761183-182761205 ATAAACACAAAGAATACTCTAGG - Intergenic
918688963 1:187456635-187456657 ATGAGCAGAAAGAACACTCTAGG + Intergenic
919807834 1:201391244-201391266 AGGAACCAAAAGTAGAGTGTGGG - Intronic
920900047 1:210100354-210100376 ATGAAAAAAGAAAAGATTGTGGG + Exonic
921557902 1:216621396-216621418 TTGAATCAAAAGATGACTGTTGG + Intronic
921958180 1:221005794-221005816 AGGAACAAAAAGAAGTCAGAAGG - Intergenic
922318970 1:224467902-224467924 AAGAAAAAAAAAAAGTCTGTAGG - Intronic
922373261 1:224932871-224932893 CTGAACAAAAAGAACAAAGTTGG - Intronic
922631566 1:227119154-227119176 ATTAACAAATAGAAAAATGTTGG - Intronic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923667271 1:236009737-236009759 AGGAACAAACAGATGACTGTTGG - Intronic
923809656 1:237299119-237299141 ATGAAAAAAAAAAAGACTCTAGG - Intronic
923989895 1:239424736-239424758 ATGGCCTAAAAGAAGGCTGTGGG + Intronic
924048401 1:240055650-240055672 ATGATCAAAGAGAAGAAAGTAGG + Intronic
924249762 1:242120131-242120153 ATAAAGAAAAAGTAGACTGCTGG + Intronic
924280941 1:242436906-242436928 AAGAACAAAAAGAAGCCTCTTGG + Intronic
1063696546 10:8341047-8341069 AGGAAAAAAAAAAAGACTATTGG - Intergenic
1063788850 10:9416681-9416703 ATGAATAAAAATCAAACTGTGGG + Intergenic
1063802314 10:9594261-9594283 ATAAATAAATAGAAGACTGTTGG + Intergenic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064674529 10:17748014-17748036 ATGAACAAATAGAAGCCAGGCGG - Intergenic
1064829763 10:19449676-19449698 AAGAACAAAGAGAAGATTGGAGG + Intronic
1064849151 10:19690690-19690712 ATGAACAAATAGAGTACTGGTGG - Intronic
1065710316 10:28510344-28510366 ATGAGGAAGAAGAAGAATGTGGG - Intergenic
1065803389 10:29372792-29372814 AAAAAAAAAAAGAAGACAGTGGG + Intergenic
1065907320 10:30268666-30268688 ATGAACAAAAAGAACAAAGCTGG + Intergenic
1066038551 10:31520711-31520733 ATCAACCAAAGGAAGACTGATGG - Exonic
1066205212 10:33182289-33182311 ATCAACAAACAGAAGAATTTCGG + Intronic
1066219801 10:33324634-33324656 CTCAAAAAAAAGAAGCCTGTGGG - Intronic
1066437750 10:35409502-35409524 GTGAACAGAAAAAAGACTGGAGG + Intronic
1066538973 10:36423373-36423395 ATGATCAAAAAGAAGCCTGATGG - Intergenic
1066541425 10:36450795-36450817 ATAAAAAAAAAAAAGAATGTGGG + Intergenic
1066580898 10:36880876-36880898 ATTAAAAAAAAGAAGAGTGGAGG - Intergenic
1068263693 10:54619497-54619519 ACGCACAAAAAGAAAACTGAGGG - Intronic
1068292062 10:55016106-55016128 AAAAAAAAAAAAAAGACTGTGGG + Intronic
1068396379 10:56466823-56466845 ATAAAAAAAAAGAAAACTGCAGG + Intergenic
1068892251 10:62160101-62160123 AGGAAAAAAAAAAAGTCTGTGGG - Intergenic
1069195325 10:65544374-65544396 ATGAAGAAGAAGAACAATGTGGG - Intergenic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1070076648 10:73142957-73142979 ATGAAGAAAAAGCAGTGTGTGGG - Intronic
1070382282 10:75891794-75891816 ATGAACAACAGGAAGAGTGGAGG + Intronic
1071073828 10:81728286-81728308 ATAAACAAATAAAAGACTCTTGG + Intergenic
1071317063 10:84412238-84412260 ATAAAAAAAAAGAAAACTTTAGG - Intronic
1071597178 10:86936781-86936803 AATAACAAAGAGAAGCCTGTCGG - Exonic
1071947474 10:90662018-90662040 AAAAATAAAAAGAAAACTGTAGG + Intergenic
1072149029 10:92670429-92670451 ATTAAAAAAAAAAAGACTATTGG + Intergenic
1072419625 10:95279026-95279048 AAGAAAAAAAACAAGACTGTTGG - Intronic
1072545872 10:96438061-96438083 ATTATGAAAAAGAAGACTGAAGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072764826 10:98086877-98086899 AAGAACAAAGAGAAGTCAGTGGG + Intergenic
1073965933 10:108989917-108989939 AAAAACAAAAACAGGACTGTGGG - Intergenic
1074643000 10:115409746-115409768 AACAACAAAAAGAAAACTATAGG + Intronic
1074643030 10:115410172-115410194 AACAACAAAAAGAAAACTATAGG - Intronic
1075243984 10:120803925-120803947 ATGATGAAAAAGGAAACTGTCGG - Intergenic
1075745172 10:124722339-124722361 ATTAAAAAAAAGAAGGCTTTGGG + Intronic
1075894771 10:125985604-125985626 ATCAACAAAAAAGAAACTGTAGG - Intronic
1076000341 10:126907905-126907927 AAGAAAAAATAGAAAACTGTTGG + Intronic
1076414594 10:130276828-130276850 AAGAACAAAGAGAAGATTGGGGG - Intergenic
1076500977 10:130935909-130935931 ATAAACAAAAAGAAGAATATTGG + Intergenic
1077715660 11:4577514-4577536 ATGAACAGAAAGAACACTCGGGG + Intronic
1078143260 11:8706831-8706853 ATGAACAAAAGGAAGGCAGATGG + Intronic
1078582309 11:12547932-12547954 AAGAACAGTAAGGAGACTGTGGG - Intergenic
1078987349 11:16608440-16608462 ATGAACAATAAGAAGGATGAAGG + Intronic
1079303020 11:19296257-19296279 AGGAACAAAGAGAAGAGTCTAGG - Intergenic
1079473365 11:20802021-20802043 CTGAGCAAAAAGAAAACTGGAGG - Intronic
1079579168 11:22040870-22040892 ATTAACAACAACAAGACTATTGG - Intergenic
1079985148 11:27192347-27192369 ATGAGCAGAAAGAAGACCGATGG - Intergenic
1080135725 11:28852000-28852022 ATGAAAAAAAAAAAGACTATTGG - Intergenic
1080242058 11:30137816-30137838 ATGAAATGAAAGAAGACTGTTGG + Intergenic
1080382834 11:31791608-31791630 ATGAATTAAAAGAAGTGTGTCGG + Intronic
1080905483 11:36540732-36540754 AAGAACAAAGAGAAGATTGGAGG - Intronic
1081317084 11:41643188-41643210 ATGAACAAAAAGAACATAGCTGG - Intergenic
1082801169 11:57416011-57416033 ATGCACAGCACGAAGACTGTAGG - Intronic
1082900231 11:58241170-58241192 CTGAGCAAAAAGAACAATGTTGG - Intergenic
1083550293 11:63583525-63583547 ATGATTAAACACAAGACTGTTGG + Intronic
1084167722 11:67383838-67383860 AAAAAAAAAAAGAAGACTCTTGG - Intronic
1085138415 11:74116463-74116485 ATTAAAAAAAAAAAGAATGTTGG + Intronic
1085157492 11:74309631-74309653 ATGAACAAAAAGAAAACATTTGG + Intronic
1086023107 11:82256147-82256169 ATGAAAAAATATAAGACTGGTGG - Intergenic
1086412303 11:86554907-86554929 AAAAACAAAAAGAAAACTATGGG + Intronic
1086941537 11:92803414-92803436 ATGTAACAAAAGAACACTGTGGG + Intronic
1087121846 11:94583336-94583358 ATTAACAAAAACAAAACTGCAGG - Intronic
1087589660 11:100170949-100170971 ATGTATAAAAAGAAGAGTGTGGG - Intronic
1087867637 11:103251600-103251622 ATGTACAACATGAGGACTGTAGG - Intronic
1087937556 11:104052578-104052600 ATAAGCATAAAGAAGACTGTAGG + Intronic
1088177837 11:107074074-107074096 ATGAACAATAAGAACTGTGTGGG + Intergenic
1088255346 11:107898121-107898143 AAAAAAAAAAAAAAGACTGTAGG + Intronic
1088290868 11:108235611-108235633 TTGAACAAAAATAAGACACTTGG - Intronic
1088503602 11:110507993-110508015 AAGAAGACAAAGAAGGCTGTGGG - Intergenic
1089594942 11:119572662-119572684 AGGTATAAACAGAAGACTGTAGG - Intergenic
1089811368 11:121134566-121134588 ATGAAAAAAAAAAAGACTTTGGG - Intronic
1090093187 11:123717727-123717749 AAAAAAAAAAAGAAGCCTGTTGG - Intergenic
1090116786 11:123981574-123981596 AACAACAAAAAGAAAACTTTAGG - Intergenic
1091033218 11:132210237-132210259 ATGAAGAAACAGAAGAGTGCTGG + Intronic
1091155479 11:133367872-133367894 CTGAACACAAAGCAGAATGTTGG + Intronic
1092599631 12:10045382-10045404 ATGCACAAAATGGAGACTCTGGG - Intronic
1092829599 12:12430906-12430928 ATGAACAAAGAAAAGAATGAGGG - Intronic
1093389385 12:18599811-18599833 ATGAAGAAAAAGAGGAATTTAGG + Intronic
1093843587 12:23937983-23938005 ATGAATACAAAGAACACAGTTGG - Intronic
1094029066 12:25989981-25990003 ATGTGCAAAATGGAGACTGTAGG + Intronic
1094140212 12:27172994-27173016 AAGAACAAAAAGAAGGTTGAAGG - Intergenic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1094144585 12:27215073-27215095 ATAAAAGAAAAGGAGACTGTTGG - Intergenic
1094237799 12:28188543-28188565 ATAAAGAAAAAGATTACTGTGGG + Intronic
1096115816 12:49054453-49054475 ATTAACAAAAAGAGGATTGCTGG + Intronic
1096198484 12:49664414-49664436 ATAAACAAAAAGAAGACAGAAGG + Intronic
1097309594 12:58103816-58103838 ATAAACAAAAACAAAGCTGTAGG + Intergenic
1097447523 12:59690517-59690539 ATAAAAAGAAAGAAGAGTGTAGG + Intronic
1098100237 12:67007518-67007540 AGGAAGAAAAAGAAGAGTGATGG + Intergenic
1098609656 12:72440209-72440231 CTGCAAAAAAAGAAAACTGTAGG - Intronic
1098694337 12:73533432-73533454 ATCAACAAAAAGTTCACTGTCGG + Intergenic
1098907017 12:76172734-76172756 AGGAACTAAAAGAAGGCTGTGGG + Intergenic
1099127497 12:78781769-78781791 AAAAAAAAAAAGAAGACTATTGG + Intergenic
1099428395 12:82552330-82552352 AGGAACAAAAAGAAAACAGAAGG - Intergenic
1099648017 12:85384668-85384690 ATCAACAAAAAGAAGACTCTTGG + Intergenic
1099907864 12:88793181-88793203 ATGCACAAAAAGAAGAAGGGAGG - Intergenic
1100066647 12:90654527-90654549 ATGATCAGAAAGAACACAGTTGG + Intergenic
1100075382 12:90774790-90774812 ATGAATAGAAAGAAGACACTGGG - Intergenic
1100165344 12:91911487-91911509 ATGAACAAAAGGAAGATGGTAGG + Intergenic
1100321145 12:93494079-93494101 ATGAACAAGGAAAAGACAGTAGG + Intronic
1100321529 12:93497919-93497941 ATGAACAAGGAAAAGACAGTAGG - Intronic
1100471690 12:94899499-94899521 ATGAACAAAATCCAGACTGTAGG + Intronic
1100553080 12:95665262-95665284 ATAAACAAAACAAAAACTGTAGG - Intronic
1101247455 12:102897992-102898014 ATGAACTAAAAAATGAATGTTGG + Intronic
1101518250 12:105457452-105457474 ATGAACAGAAAAAAGACTAAAGG + Intergenic
1101606526 12:106250875-106250897 AAAAAAAAAAAGCAGACTGTAGG + Intronic
1101785310 12:107877927-107877949 AAAAAAAAAAAGAAGATTGTGGG - Intergenic
1104321169 12:127752391-127752413 ATTAACAAAAAGACAAGTGTTGG - Intergenic
1105978467 13:25494512-25494534 ATGAAAAGAGAGGAGACTGTGGG + Intronic
1105993207 13:25643699-25643721 ACGAAGAAAAAGAACACAGTGGG - Intronic
1106966369 13:35074876-35074898 ATGTACAACATGAGGACTGTAGG - Intronic
1107478315 13:40762732-40762754 ATGAAGAAAAATAAGAGTGATGG - Intronic
1107606720 13:42064596-42064618 AGGAAGGAAGAGAAGACTGTTGG + Intronic
1107799131 13:44087723-44087745 AGGAACAAAAATAAGACTTCAGG - Intergenic
1109032832 13:57215829-57215851 ACAAACAAAAATAAGACTATTGG - Intergenic
1109484480 13:63000870-63000892 CTGAACAAAAGGAACACAGTTGG + Intergenic
1109713876 13:66195100-66195122 TTGAACAAAAAGAAGAAAGCTGG - Intergenic
1109713878 13:66195140-66195162 TTGAACAAAAAGAAGAAGGCTGG - Intergenic
1110012763 13:70358757-70358779 TTGAGCAAAAAGAACACTGTTGG + Intergenic
1110150397 13:72245161-72245183 ATGAAAAAAAAGAAGAGAGGGGG + Intergenic
1110426901 13:75377571-75377593 ATGAGCAAAAACAAGACATTCGG + Intronic
1110530930 13:76596754-76596776 ATGGTCAATAAGAAGATTGTAGG + Intergenic
1110752301 13:79129271-79129293 ATTAAAAAAAAGAAGAATTTAGG - Intergenic
1111632939 13:90866568-90866590 CTGAACAAAAAGAGGGGTGTTGG - Intergenic
1112032202 13:95467585-95467607 ATCAACAAAAAGCAGAGTATAGG - Intronic
1112094030 13:96112822-96112844 ATGAAGAAGAAGAGGACTGGTGG + Intronic
1112309128 13:98302376-98302398 GTGAAAAAAAAGATGAGTGTGGG - Intronic
1112451484 13:99515246-99515268 TTTAACATAAAGAAGACTGAAGG - Intronic
1113237929 13:108302328-108302350 ATGAATAAAAAGAAGATTGAGGG - Intronic
1114389559 14:22292270-22292292 CTGAACAAAAACAAAACTATGGG + Intergenic
1114632123 14:24165798-24165820 AAGAACAAAAAGAAGAGAGAGGG - Intronic
1114755058 14:25249901-25249923 ATGAGAAAAAAGTAGACTTTGGG - Intergenic
1115186386 14:30692848-30692870 AAGAAGAAAAAGAAAACTTTGGG - Intronic
1115673290 14:35640770-35640792 ATCAACAAAAAGAAAACTACAGG + Intronic
1116100705 14:40431168-40431190 ATTAAAAGAAATAAGACTGTAGG + Intergenic
1116240968 14:42341947-42341969 AGGAAGATAAATAAGACTGTAGG + Intergenic
1116453308 14:45088144-45088166 ATGGAGAAAAAGAATGCTGTTGG + Intronic
1116876808 14:50120367-50120389 ATGAACTAAAGAAAGACTCTGGG + Exonic
1117080651 14:52148926-52148948 AACAACAAAAAGAAAACTTTAGG - Intergenic
1117603675 14:57402559-57402581 ATGAACAAAAATAAGACAATTGG - Intronic
1117677996 14:58174309-58174331 CTGAACAAAAAGAATAAAGTTGG - Intronic
1117746732 14:58877131-58877153 ATCACAAAAAAGAAGACTGGAGG + Intergenic
1117787300 14:59299753-59299775 GTGAACAAAATGCAGTCTGTTGG + Intronic
1118124122 14:62880663-62880685 AATAAGAAAAAGTAGACTGTAGG + Intronic
1118627420 14:67672417-67672439 AAGAAAAAAAAGTAGACTGCAGG - Intronic
1118794441 14:69128531-69128553 AAGAAAAAAAACAAGACTGCAGG + Intronic
1119339976 14:73868789-73868811 AAAAAAAAAAAGAAGACTCTGGG + Intronic
1119553377 14:75533892-75533914 ATGAAACAAAAGCAGACTGGTGG - Intronic
1119598736 14:75959775-75959797 AAGAAAAAAAAAAAAACTGTTGG + Intronic
1119635269 14:76268238-76268260 ATGAACAGAAGGACGGCTGTGGG - Intergenic
1120179321 14:81327379-81327401 ATGATCAAAATGTAGATTGTGGG - Intronic
1120382774 14:83803028-83803050 ATGAACAAAAACAAGGGTTTTGG + Intergenic
1120646334 14:87079048-87079070 AACAACAAAAAAAACACTGTGGG + Intergenic
1120682613 14:87498768-87498790 ATTAAAAAAAAAAAAACTGTTGG + Intergenic
1121442178 14:93956285-93956307 ATAAACAAAACAAAGGCTGTGGG + Intronic
1121978602 14:98431371-98431393 ATGAGCAAAATGAAGATTTTTGG - Intergenic
1122046623 14:99028603-99028625 AAAAACAAAAAGAAGGCTGGGGG + Intergenic
1122170246 14:99867268-99867290 ATGAAAAAGAAGAATACAGTTGG - Intronic
1122553189 14:102561164-102561186 AAGAACAAAAAAAAGTCTGTAGG - Intergenic
1202890770 14_KI270722v1_random:155055-155077 ATGAAAGAAAAGAATGCTGTTGG - Intergenic
1124153563 15:27205504-27205526 AACAACAAAAAGAACACTTTAGG - Intronic
1124404954 15:29384241-29384263 ATTCACAAAAAGAAGAAAGTGGG - Intronic
1124549343 15:30663976-30663998 ATGAAGAAAAAAAAGAGTGATGG - Intronic
1124791921 15:32735777-32735799 AAAAAAAAAAAGAAGAATGTGGG + Exonic
1124893777 15:33757414-33757436 ATGAACCAAATGAAGAGTTTTGG + Intronic
1125791714 15:42371990-42372012 ATTAAAAAAAAAAAGGCTGTTGG + Intronic
1125845428 15:42848214-42848236 TTGAAAAAGAAGAAGAATGTTGG - Intronic
1125963129 15:43849178-43849200 AAAAAAAAAAAAAAGACTGTTGG + Intronic
1126622237 15:50651653-50651675 ATTAAAGAAAAGAAGACTGTGGG + Intronic
1128596285 15:68953489-68953511 AAAAACAAAAAGAAAACTATAGG - Intronic
1129095556 15:73203503-73203525 ATGAACAGAAAGAAAACAGTTGG - Intronic
1130095429 15:80852002-80852024 ATGAGGAAGTAGAAGACTGTGGG + Intronic
1130366241 15:83241863-83241885 ATGCACAAAAAGAACAATGCTGG + Intergenic
1130819940 15:87484414-87484436 AAAAAGAAAAAGAAGAATGTGGG + Intergenic
1131288656 15:91084692-91084714 AGAGACAAAAAGAAGAATGTTGG - Intergenic
1132088526 15:98928048-98928070 CTGAACAGAAAGAAGAGTGAAGG - Intronic
1132159701 15:99528321-99528343 ATAAAGAAATAGCAGACTGTAGG - Intergenic
1133603541 16:7363818-7363840 ATAAACATCAAGAAGACTGACGG - Intronic
1133635182 16:7658179-7658201 ATGTTGAGAAAGAAGACTGTGGG - Intronic
1133821440 16:9240680-9240702 AAAAAAAAAAAAAAGACTGTAGG - Intergenic
1133847634 16:9470487-9470509 ATGTACAACATGAAGACTATAGG - Intergenic
1136631481 16:31491610-31491632 AAAAAAAAAAAAAAGACTGTCGG - Intronic
1137257914 16:46792767-46792789 AAGAAAAAAAAGAAGACGGCCGG + Intergenic
1137289607 16:47042980-47043002 AAAAAAAAAAACAAGACTGTGGG - Intergenic
1137429984 16:48410891-48410913 AAAAAAAAAAAGAAGAGTGTAGG - Intronic
1138066462 16:53946558-53946580 AAGAATAAAAAGAAGACAATAGG - Intronic
1138113581 16:54342906-54342928 CTGAACAAACAGAAGCCTGTGGG + Intergenic
1138166699 16:54808749-54808771 ATCAACAGATAAAAGACTGTGGG - Intergenic
1139610950 16:68058147-68058169 ATGAAGAAGAAGCAGACTGCAGG + Intronic
1139800721 16:69520505-69520527 AAGAAAAAAAAAAAGAGTGTAGG + Intergenic
1140157807 16:72451901-72451923 ATCAACAACAAGAAGAATTTTGG - Intergenic
1140186041 16:72773267-72773289 ATAAACCAAAAGTAGACTGTGGG - Intergenic
1140334066 16:74086984-74087006 TTGAACAAAAAGAACACAGCTGG - Intergenic
1141340053 16:83194878-83194900 ATGAACAAAAAGGAGATTGTAGG - Intronic
1203124869 16_KI270728v1_random:1565411-1565433 ATGAAGGAAAAATAGACTGTTGG - Intergenic
1143063115 17:4220315-4220337 ATGAACAACAAAAAAAATGTAGG + Intronic
1143173189 17:4941926-4941948 AAAAACAAAAAGAAAACTGAAGG + Intronic
1143333999 17:6158934-6158956 AGGAATAAAATGAAGACTTTTGG + Intergenic
1143700663 17:8657598-8657620 ATGAACAAAAATAAAACCATGGG - Intergenic
1144276971 17:13679690-13679712 ATAAATAAATAGAAGACAGTTGG + Intergenic
1144531833 17:16046627-16046649 ATGGACAAAATGAAGACTGATGG + Intronic
1144683242 17:17209103-17209125 ATAAACAAAAATAAAACTGGGGG + Intronic
1145082041 17:19902220-19902242 ATGGACAAACAGAAGCATGTGGG - Intergenic
1145404184 17:22571158-22571180 ATGGACAAAGAAAAGACGGTGGG + Intergenic
1147344745 17:39782511-39782533 AAGAAAAAAAAGAGGACTATTGG + Intronic
1149285326 17:55157733-55157755 ATGAACAAAATGTATACTATAGG + Intronic
1150059499 17:62053199-62053221 ATGAATAAAAAGGAAGCTGTTGG + Intronic
1150238383 17:63611584-63611606 GTGAACAGAAAGAAGAGTGAGGG + Intergenic
1150353969 17:64467675-64467697 ATGAACAAAAAGCAAACTTGAGG + Intronic
1150978235 17:70112502-70112524 ATGAAAAAAAAAAATAGTGTTGG + Intronic
1151173912 17:72271171-72271193 ACTAACCAGAAGAAGACTGTGGG - Intergenic
1153146785 18:2042296-2042318 ATGAAAAAATAGTAGACTATTGG + Intergenic
1153424619 18:4948072-4948094 ATGAAAAGAAAGATGACTATCGG + Intergenic
1153877005 18:9382821-9382843 AAAAACAAAAAGAAGTCTGTTGG + Intronic
1153882885 18:9435947-9435969 AAAAAAAAAAAGAAGGCTGTTGG + Intergenic
1153958479 18:10119652-10119674 TTGAACAAAAAGAATAATGCTGG + Intergenic
1154012183 18:10584238-10584260 AAGAAAAAAAAAAAGACTGGTGG - Intergenic
1155088654 18:22483981-22484003 ATGAACATAAAAAGGACTGGAGG - Intergenic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1156156545 18:34309440-34309462 AAAAACAACAACAAGACTGTAGG - Intergenic
1156224575 18:35091614-35091636 CTGAACAAAAAGAACAATGCTGG + Intronic
1156244772 18:35287815-35287837 ATTAACAGAAAGAAAACTGAAGG + Intronic
1156902269 18:42313593-42313615 ATGAAAGAATAGAAGATTGTAGG + Intergenic
1157059232 18:44267845-44267867 CTGAACAAAAAGAACAAAGTTGG + Intergenic
1157173362 18:45428483-45428505 ATGAACATAAAGCAGACAGCAGG + Intronic
1157820521 18:50764900-50764922 ACAAAAATAAAGAAGACTGTCGG + Intergenic
1157955564 18:52093806-52093828 ATAAACAAAACCAAGACTTTTGG + Intergenic
1158270074 18:55703273-55703295 AGGAACAAAAAGAAGTCAGACGG - Intergenic
1158275590 18:55763810-55763832 AAGAAGAAAAAGAGGACAGTTGG - Intergenic
1158682318 18:59579905-59579927 ATGAAAAAAAAGATGCCTCTGGG + Intronic
1158721736 18:59931290-59931312 AGAAAGAAAAAGAAGACAGTAGG - Intergenic
1158787639 18:60735016-60735038 TTAAGCAAAAAAAAGACTGTAGG + Intergenic
1159319458 18:66828525-66828547 CTGAGCAAAAAGAAGATAGTTGG - Intergenic
1159382249 18:67675317-67675339 ATGAATAAAAAGAAAAGTCTAGG + Intergenic
1159874326 18:73793367-73793389 ATGAAATGAAAGAAAACTGTTGG - Intergenic
1160194829 18:76744365-76744387 AAAAAAAAAAAAAAGACTGTAGG - Intergenic
1160798827 19:957849-957871 ACAAACAAAAAAAAGACTTTGGG + Intronic
1162434529 19:10649410-10649432 AAAAACAAAAAGAAGGCTGGGGG - Intergenic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1164404329 19:27929608-27929630 ATGAACAATCAGAACGCTGTGGG + Intergenic
1164551632 19:29217185-29217207 AAAAAAAAAAAAAAGACTGTAGG - Intergenic
1165396061 19:35564142-35564164 AAGAAAAAAAAAAAGAGTGTGGG - Intergenic
1167294309 19:48640359-48640381 AAAAAAAAAAAAAAGACTGTTGG - Intronic
1167825253 19:51966946-51966968 ATTAAAAAAAAGAATACTTTGGG - Intronic
925139990 2:1543608-1543630 ATGAACAAAACTAAGAGTTTGGG - Intronic
926930265 2:18030856-18030878 ATGAACAAAAAGAATAAAGCAGG + Intronic
927058971 2:19395997-19396019 CTGTACAAAAAGAAGATTGGTGG + Intergenic
927343897 2:22014206-22014228 ATGAACATCAAGAAGACCATTGG + Intergenic
927421388 2:22935093-22935115 ATGAACAAATAGAAAACAGAAGG + Intergenic
927808272 2:26167385-26167407 ATTAACAAAATGCAGACTGTAGG + Intergenic
928686256 2:33752971-33752993 ATGAGCAAGAAGAAAACTGAGGG + Intergenic
928838127 2:35571915-35571937 ATCAACAAAAAGAAAACTCCAGG - Intergenic
929887060 2:45888457-45888479 AAAAAAAAAAAAAAGACTGTTGG - Intronic
929961067 2:46496697-46496719 AAAAAAAAAAAGAAAACTGTAGG + Intronic
930010750 2:46936799-46936821 ATGAAAAAAAAGAAGACCACTGG - Intronic
930236507 2:48893975-48893997 ATGAACACAAAGGAGACAGCAGG + Intergenic
930303458 2:49647207-49647229 ATCAACAATCAGAAGGCTGTAGG + Intergenic
930598418 2:53415371-53415393 CTGAAAAAAGAGTAGACTGTTGG - Intergenic
930885189 2:56317533-56317555 ATGAGGAAAAAGAAGAGTCTGGG - Intronic
931598840 2:63981525-63981547 ATGAACGAAAAGAATACTATAGG + Intronic
932200542 2:69823572-69823594 ATTAATAAAAAGAAGAATTTAGG + Intronic
932807933 2:74798855-74798877 ATGAATAAAGAAAAGACAGTTGG + Intergenic
932931624 2:76046784-76046806 ATTAACAACAAGAAGAATTTTGG + Intergenic
933012429 2:77084162-77084184 ATGAACAGAAAGAAAACTTGCGG + Intronic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935309394 2:101768536-101768558 CAGAAAAAAAAGTAGACTGTGGG - Intronic
935319812 2:101875484-101875506 ATGAACAGAGAGAGGGCTGTAGG + Intronic
935351123 2:102152531-102152553 AAAAAAAAAAAGAAGAGTGTGGG + Intronic
936652312 2:114442146-114442168 AAAAAAAAAAAAAAGACTGTTGG - Intergenic
936872664 2:117151155-117151177 ATGAAAAAAAAGGAGACTCAGGG - Intergenic
938116154 2:128604113-128604135 AGGAACAAAAAGAAGGGTGAGGG - Intergenic
938132135 2:128725546-128725568 ATGAAGAAAAAGCAGGCTATGGG + Intergenic
938626982 2:133121162-133121184 ATCAACAAAACTTAGACTGTAGG + Intronic
938845928 2:135208922-135208944 ATGGACAAAGTGAAGAATGTTGG - Exonic
938897876 2:135770648-135770670 ATTAACAAAAAGAATGCTGGAGG + Exonic
938964076 2:136372377-136372399 ATAAATAAAAAGAAAGCTGTAGG - Intergenic
939122141 2:138129954-138129976 AAGAACAAAGAGAAGATTGGGGG + Intergenic
939360483 2:141165327-141165349 ATAAACAAAAATAAGACAGTTGG - Intronic
939753097 2:146073490-146073512 CTGAACAAAGAGAAGCCTTTTGG - Intergenic
939942836 2:148371503-148371525 ATGGAGAAAAAGAACACTCTAGG + Intronic
940221819 2:151360667-151360689 ATGAACAAATAGAGAACTCTTGG - Intronic
940421959 2:153489494-153489516 TTAAAGAAAAAGAAGACAGTTGG + Intergenic
940684667 2:156831851-156831873 CTGAACAAAAAGAACAAAGTTGG + Intergenic
941040287 2:160614019-160614041 AGGAACAAAAAAAGGACTGCTGG - Intergenic
941351595 2:164444181-164444203 ATGATGAAAAAGAATACTGAGGG - Intergenic
941356432 2:164498850-164498872 ATGAACCATAATAAGATTGTAGG - Intronic
941582080 2:167310771-167310793 AAGAAAAAAAAGAAGCCTGCTGG + Intergenic
941766486 2:169302697-169302719 ATGAACACAAGCCAGACTGTGGG + Intronic
942018202 2:171839332-171839354 ATGAAGAAAAACAATACTGTGGG + Intronic
942716323 2:178896622-178896644 ATCAATAACAAGAAGCCTGTTGG - Intronic
942810686 2:179996606-179996628 ATGAAGATAAAGCAGACTGGCGG + Intronic
942814031 2:180030820-180030842 ATCAACAACAAGAAGAATTTTGG - Intergenic
943128275 2:183824110-183824132 ATCAAGAAAAAGAAAACTATAGG + Intergenic
943766997 2:191673880-191673902 ATGAACTAATTGAAGACTGATGG - Intergenic
943926384 2:193787451-193787473 TTGAACGAAAAGAAAAATGTTGG + Intergenic
944019589 2:195085926-195085948 AGGAACATATAGAATACTGTAGG + Intergenic
944075511 2:195725910-195725932 AGGAACAGAAAGCAGATTGTTGG + Intronic
944190160 2:196994484-196994506 AAGAAGAAGAAGAAGACTGTTGG - Intronic
944568175 2:201013035-201013057 ATAGACAAAAATAAGACAGTGGG - Intronic
944972005 2:205003596-205003618 AAAAACACAAAGCAGACTGTGGG - Intronic
945106230 2:206317888-206317910 AGGAACAAAAAGAAGAACGTTGG - Intergenic
945796353 2:214369282-214369304 ATGAAGAAAAAGAAGAAGTTTGG + Intronic
946498815 2:220223857-220223879 CTGTACAAAAAGAATACTGTGGG - Intergenic
946498948 2:220225232-220225254 GTGTACATAAAGAATACTGTGGG + Intergenic
947074005 2:226321159-226321181 ATAAACACAAATAAGTCTGTTGG + Intergenic
947092345 2:226526193-226526215 ATGAAACAACAGAAGACTTTTGG - Intergenic
947362019 2:229355410-229355432 ATGAAGAAACAGAAGCCAGTAGG + Intergenic
947882817 2:233534608-233534630 ATCAACAAACAGAAGAGTGTAGG + Intronic
947894721 2:233658969-233658991 TTGCACAAAAAAAAGCCTGTTGG + Intronic
948081657 2:235210754-235210776 ATGAACAAGATGAAGACTTTTGG - Intergenic
1169116072 20:3066838-3066860 AAAAAAAAAAAAAAGACTGTGGG - Intergenic
1169330286 20:4710778-4710800 ATGAACAGAAAAAAGAATGAAGG + Intergenic
1169419852 20:5451175-5451197 AAGAAAAAAAAGAAAACTATTGG + Intergenic
1169620824 20:7504711-7504733 CAGAACAAAAAGCAGATTGTTGG + Intergenic
1169665229 20:8026634-8026656 ACTAACAAAAAGAAAAGTGTAGG - Intergenic
1170004654 20:11652592-11652614 ATGATCAAAAATAGGACAGTGGG - Intergenic
1170194588 20:13676937-13676959 ATGAACATAAATAACACTGCAGG + Intergenic
1170236340 20:14109097-14109119 ATCAACAACAAGAAGAATTTTGG + Intronic
1170419802 20:16181360-16181382 ATGAAAGGAAAGAAGGCTGTTGG - Intergenic
1170740920 20:19055481-19055503 ATGAACAAGAAGAACAAAGTTGG + Intergenic
1172527931 20:35611825-35611847 AAAAAAAAAAAAAAGACTGTGGG - Intergenic
1172585638 20:36082138-36082160 ATGCACAAAAGGAAACCTGTTGG - Intergenic
1173027475 20:39322064-39322086 ATCATCAAAATGCAGACTGTAGG - Intergenic
1173421720 20:42907105-42907127 ATGAAAAAAATGAATACAGTAGG + Intronic
1174347769 20:49943640-49943662 AAAAAAAAAAAGAAGACAGTAGG - Intronic
1174841542 20:53905850-53905872 ATGAACAAAATGAATAGTGCTGG + Intergenic
1175702424 20:61149482-61149504 ACAAACAAAAAGGAGACTGATGG + Intergenic
1176636598 21:9249572-9249594 ATGTACAACATGAGGACTGTAGG - Intergenic
1176792053 21:13329150-13329172 AGGAACAAAATGAAGTCGGTTGG - Intergenic
1177386547 21:20416940-20416962 AGAAACACACAGAAGACTGTTGG - Intergenic
1177531813 21:22370607-22370629 ATGGACAACAATAAGACTTTAGG - Intergenic
1177791238 21:25723795-25723817 AAAAAAAAAAAGAACACTGTTGG + Intronic
1178266717 21:31149541-31149563 ATTCACAAAAAGGAGACTTTGGG - Intronic
1178348644 21:31853867-31853889 ATGAAGAAAATGAAGATTATGGG - Intergenic
1178896861 21:36566031-36566053 ATGATAAAAAATAAGACTGATGG - Intronic
1179572288 21:42284814-42284836 ATGAGCTAACAGAAGGCTGTGGG - Intronic
1179796925 21:43790181-43790203 ATGAACAAGAAGTAGATTCTCGG - Intronic
1182570030 22:31229997-31230019 AGGAAAAAAAAGAGGCCTGTTGG - Intronic
1182730629 22:32488663-32488685 ATGAACAAGAATAAGCCTTTAGG - Intronic
1183810617 22:40253944-40253966 AAGCACAAAGAAAAGACTGTTGG + Intronic
1183854441 22:40620879-40620901 ATGAAATAAAGGAAGGCTGTTGG + Intronic
1184260921 22:43315614-43315636 CTGAACAGAAAGAACTCTGTTGG + Intronic
949420336 3:3858417-3858439 ATGAACTAAAGGAAGTCTGAAGG + Intronic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
950364708 3:12474819-12474841 AGGAGTAGAAAGAAGACTGTAGG + Intergenic
950573372 3:13815816-13815838 ATGAAGCAAAACATGACTGTGGG - Intergenic
951150764 3:19287558-19287580 AACAACAAAAAGTGGACTGTGGG - Intronic
951240844 3:20284478-20284500 ATGAATAAATAGAAGACGGATGG - Intergenic
952568958 3:34690806-34690828 GTGAACAAAAAGAAGTCGTTTGG + Intergenic
954574579 3:51668780-51668802 AGGAACAGAAGGAAGACTGATGG + Intronic
955096861 3:55807365-55807387 AGGAACAAAAAGAAGTCATTGGG - Intronic
955618965 3:60840671-60840693 ATACAGAAAAAGAAGAATGTGGG - Intronic
956221620 3:66910051-66910073 AACAACAAAAATAAGACTGTAGG + Intergenic
956370893 3:68559609-68559631 ATCAACAAAATGCAGACTTTGGG + Intergenic
956370918 3:68560128-68560150 ATCAACAAAATGCAGACTTTGGG - Intergenic
956774979 3:72557470-72557492 CTGAACTAAAAGGAGACTATAGG + Intergenic
957104165 3:75865692-75865714 ATGCACAACATGAGGACTGTAGG + Intergenic
957927279 3:86830494-86830516 CTCAATAAAATGAAGACTGTGGG - Intergenic
958035589 3:88166785-88166807 ATGTACACAGTGAAGACTGTAGG + Intronic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
960232346 3:115243385-115243407 ATGAGGAAAAAGGAGACTTTGGG + Intergenic
960247868 3:115419406-115419428 ATGCATAAAAAGGAGACTGAGGG - Intergenic
960581731 3:119285507-119285529 ATTAAAAAAAAGAAAACTGCAGG - Intergenic
961153739 3:124661573-124661595 ATGAACAAAAACAGGAAGGTAGG + Intronic
961617122 3:128191648-128191670 ATAAACAAAAAGTAGAATGGTGG - Intronic
961762458 3:129181749-129181771 ATGAAAAAAAAGAGGACCTTTGG + Intronic
961818480 3:129563337-129563359 AGGATCCAAAAGGAGACTGTTGG - Intronic
961854786 3:129859047-129859069 AGGAACAAAAAGAATCTTGTAGG + Intronic
962989540 3:140565805-140565827 ATGAACTCAAGGTAGACTGTTGG - Intronic
963180755 3:142353365-142353387 TTAAACAAAAAGAACAATGTTGG + Intronic
963200705 3:142583178-142583200 ATGAACAAAAAGCATGCTGAGGG + Intergenic
963365421 3:144327931-144327953 AAGAAAAAAAGGAAAACTGTAGG + Intergenic
963373479 3:144433198-144433220 ATAAACATAGAGAAGAGTGTGGG - Intergenic
963450592 3:145476358-145476380 GTGAATGAAAAGAAGACTGCAGG - Intergenic
963763027 3:149304413-149304435 ATCAACAACAAGAAGAATCTTGG - Intergenic
963805908 3:149722713-149722735 AGGAACAGAAAAAAGACTGGAGG - Intronic
964036166 3:152199774-152199796 ATGATAAAACATAAGACTGTTGG + Intergenic
964255343 3:154768743-154768765 AAAAAAAAAAAAAAGACTGTAGG + Intergenic
964542649 3:157796734-157796756 ATGATTAAAAATAAGGCTGTGGG - Intergenic
964825194 3:160818290-160818312 CTTAACAAAAAGAATAGTGTCGG + Intronic
965174033 3:165307583-165307605 CTGAGCAAAAAGAAGACAGCTGG + Intergenic
965526391 3:169723501-169723523 AATAACAAACAGAAGACTGTTGG + Intergenic
966471823 3:180298233-180298255 ATAAACAAAAAGTAGTCTCTTGG - Intergenic
966512393 3:180778540-180778562 ATGCAAAAAAAGAAAACTTTAGG - Intronic
968238093 3:197049765-197049787 ATGAATAAAGAGAATATTGTAGG + Intronic
968294872 3:197568238-197568260 CAAAACAAACAGAAGACTGTGGG - Intronic
969390903 4:6890744-6890766 AGGAAGAAAAAGAAGTCTCTGGG + Intergenic
971456184 4:26846961-26846983 ATGTACAAAAAGAAGATTAAAGG - Intergenic
971468361 4:26990155-26990177 TTGAGCAAAAAGAACACTGCTGG + Intronic
971543122 4:27847297-27847319 ATGAAAAAAAATAATATTGTAGG + Intergenic
971703049 4:30005712-30005734 GAGAAAAAAAAGAAGAATGTTGG - Intergenic
971894094 4:32568056-32568078 TTGAACGGAAAGAAGATTGTTGG + Intergenic
971952829 4:33377011-33377033 GTGAAAAAAAAGAAGTCGGTTGG + Intergenic
971991694 4:33906309-33906331 ATGAAAAAAAAAAGAACTGTGGG + Intergenic
972166032 4:36285266-36285288 AAGAAAAACTAGAAGACTGTAGG + Intronic
972596791 4:40536553-40536575 AGGAAGAAAAAGAAAATTGTGGG - Intronic
972767055 4:42160790-42160812 ATCAACACAAAGAAAACTGGAGG - Intergenic
972823542 4:42730199-42730221 ATGTACAAATAAAAGACTTTTGG + Intergenic
972849199 4:43027414-43027436 ATGAAGAAACAGTAGACTCTTGG + Intronic
973023197 4:45230405-45230427 TAGAACAAAAATAACACTGTGGG + Intergenic
974409990 4:61527988-61528010 AAGAACTAAAAGATGACTGGAGG - Intronic
974558181 4:63479353-63479375 AAGAACTAAAAGAAGAATATTGG + Intergenic
974920061 4:68227869-68227891 AGGAACATAAAGACCACTGTAGG - Exonic
975107038 4:70579141-70579163 AGGAAAAAAAAAAAGACAGTGGG + Intergenic
975410840 4:74047408-74047430 CTGAACAAAAAGAACAAAGTAGG - Intergenic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
975610477 4:76197642-76197664 ATTAACAGATAGAGGACTGTTGG - Intronic
976185900 4:82442526-82442548 ACAAACAAAAAAAACACTGTCGG + Intronic
977005572 4:91565341-91565363 ATGAACAAAAAGAACAAAGCTGG - Intronic
977569784 4:98617129-98617151 ATGAACAAAAGAAAGGGTGTAGG + Intronic
977821991 4:101483088-101483110 CTGAACAAAAAGAACAATGCTGG - Intronic
978551545 4:109932890-109932912 ATGGAGAAAAAGAAGACACTAGG - Intronic
979079486 4:116316527-116316549 ATGAGCCAAAAGAAAACTTTTGG + Intergenic
980696409 4:136362244-136362266 ATAAGCAAAAAGAAGAAAGTTGG + Intergenic
980751532 4:137096422-137096444 AGGCACAAAAAGAAGATTCTAGG - Intergenic
980756520 4:137171321-137171343 ATGACAAAAAAGAAGCCAGTTGG + Intergenic
980767775 4:137330161-137330183 ATGAACAAAATTAAGAAAGTGGG - Intergenic
981181392 4:141749995-141750017 AGGAAAAAAAAAAATACTGTTGG + Intergenic
981187767 4:141824343-141824365 TTGATCTAAAAGATGACTGTTGG + Intergenic
981982627 4:150812598-150812620 ATGAATAAAAATAAGCCTATTGG + Intronic
982165896 4:152613495-152613517 ATGAGTGAAAAGAAGGCTGTTGG + Intergenic
982405040 4:155010032-155010054 ATGAAAAGAAAGAAGACTAAGGG - Intergenic
982544092 4:156711108-156711130 ATGAATAAGCAGAAGACTGCAGG - Intergenic
982681565 4:158437204-158437226 ATGAGCAAAAATAAGGCTGGAGG + Intronic
983029534 4:162782643-162782665 ATGAAAAAAAAGTAGATGGTGGG - Intergenic
983548030 4:168983600-168983622 ATGAAAAAAAAGAAAACTTTAGG + Intronic
984136555 4:175947943-175947965 ATGAATAAAAAGATGAATGAAGG + Intronic
984160539 4:176247390-176247412 ATGAAAAAATAGAAGAATGTGGG + Intronic
984207745 4:176806504-176806526 ATGAACAAGAAGAAAGTTGTAGG + Intergenic
984331293 4:178322788-178322810 TTGAACAAAAAGCAGACTCATGG + Intergenic
984539079 4:181014744-181014766 ATGAACCAAAAGAAAGATGTTGG + Intergenic
984599805 4:181713110-181713132 ATGGACCAAAATTAGACTGTTGG + Intergenic
984693763 4:182758324-182758346 ATGCACAAAAAGAAAAGGGTGGG + Intronic
985311810 4:188609842-188609864 ATTAAAAAAGAGAAGACAGTAGG - Intergenic
1202751486 4_GL000008v2_random:8011-8033 ATGTACAACATGAGGACTGTAGG - Intergenic
986537013 5:8798824-8798846 ATGAACAAAAAGAAAACAAAAGG + Intergenic
986910448 5:12549262-12549284 ATGAACTAAGACAAGCCTGTTGG - Intergenic
987101613 5:14596175-14596197 AAGAACAAAAAGGAGTGTGTTGG - Intronic
987427331 5:17788220-17788242 ATGAAAAAAGAGAAGACGGAGGG - Intergenic
988596516 5:32597264-32597286 AGGAACAAAAAGTAGAATGGTGG - Intronic
988790821 5:34605834-34605856 AAGATCAAAAAATAGACTGTGGG - Intergenic
989320859 5:40132090-40132112 ATGAACAAACATAAAACAGTTGG + Intergenic
989992733 5:50787099-50787121 ATGAAAAAAAAGAAGAGTTAAGG - Intronic
990373104 5:55141107-55141129 ATGAGCAGAAAGAACACTTTGGG + Intronic
990418226 5:55607106-55607128 AGAAAGAAAAAGAAAACTGTTGG + Intergenic
990842371 5:60096897-60096919 CTGAAAAGAAAGAAGAGTGTTGG - Intronic
990919114 5:60943699-60943721 ATGAAAAAAAAGCTGCCTGTGGG + Intronic
990943062 5:61222937-61222959 ATGATTAAAAAGAAAACTCTTGG + Intergenic
992355408 5:75977370-75977392 AGGAACAAAAAGCAGATTGGTGG - Intergenic
992894792 5:81236557-81236579 ATGCTCAAAAAGAAGACAGAAGG + Intronic
993999750 5:94765078-94765100 ATCAATAAAAAGAGGACTTTGGG + Intronic
994029086 5:95120375-95120397 ATTAAAAAAAAGAAAACTATAGG + Intronic
995569449 5:113463953-113463975 GAGAACAGCAAGAAGACTGTGGG + Intronic
995637566 5:114211582-114211604 AAGATCAAAAAGATAACTGTTGG + Intergenic
995976454 5:118041867-118041889 GTGAAAAAAATGAAGACTATAGG + Intergenic
995995675 5:118295674-118295696 AGGGAAAAAAAGAAGACTGGAGG - Intergenic
996087996 5:119323646-119323668 ATGGACTAAAAGAAGCATGTGGG + Intronic
996199801 5:120657820-120657842 ATGAACAAAAAGCAGAAGGTGGG - Intronic
996513489 5:124344034-124344056 ATCAACAGAATGCAGACTGTCGG - Intergenic
996652344 5:125894812-125894834 AAGAACAAAGAGAAGATTGGAGG - Intergenic
996720265 5:126623140-126623162 AAGAAAAAAAATAAGAATGTAGG + Intronic
997065272 5:130552425-130552447 ATGTACAACATGAAGACTATAGG + Intergenic
997907683 5:137835697-137835719 CTGACCAAAAAGAGGAGTGTTGG - Intergenic
998020633 5:138766946-138766968 ATGAACAGTAAGAATACAGTGGG + Intronic
998120044 5:139568670-139568692 ATGAAAATAAAAAATACTGTAGG + Intronic
998682337 5:144483205-144483227 AAGAAGAAAAAGAAAAATGTAGG + Exonic
999363872 5:151008431-151008453 ATGAACAAACAGAAAGTTGTAGG + Intergenic
1000030915 5:157400632-157400654 ATGAACAGAAAAAAGATTGCAGG + Intronic
1001264571 5:170264198-170264220 AAGAACAAAAAGAAGATTGGAGG - Intronic
1001438234 5:171717855-171717877 AGGAAAAATAAGAATACTGTAGG + Intergenic
1002805718 6:572302-572324 ATGTACAAAAAGAATAGTCTGGG - Intronic
1003237841 6:4313818-4313840 TTGAACAAAAAGAATAAAGTTGG - Intergenic
1003434750 6:6076711-6076733 AAAAAAAAAAAGAAAACTGTAGG + Intergenic
1004282591 6:14293551-14293573 ATGAACAACAAGAAAACCTTAGG - Intergenic
1004431217 6:15545804-15545826 ATTAACAAAATGAACACTGCAGG + Intronic
1005156765 6:22815911-22815933 ATCAATAAAAAGAAAACTATAGG - Intergenic
1005599422 6:27411520-27411542 ATGAACACAAAGCATAATGTAGG + Intergenic
1007265138 6:40590082-40590104 AAGCACAAAAACAAGAATGTGGG - Intergenic
1008443106 6:51555526-51555548 ATGAAAAAAAAGAAAACTGCAGG + Intergenic
1008745325 6:54662859-54662881 ATGAGCAAAAAGAACAAAGTTGG - Intergenic
1009387784 6:63107369-63107391 ATGAAAAAAAAGAAAACTACAGG - Intergenic
1009858939 6:69299823-69299845 CTGAACAAAAAGAAGAAAGCTGG - Intronic
1010314134 6:74425684-74425706 ATCAAAAAAAAGAAAACTATAGG + Intergenic
1010559922 6:77336262-77336284 ATTAAAAAAAAGAAAACTATAGG - Intergenic
1010837217 6:80603851-80603873 ATGAACAACAAGAGGAATTTTGG - Intergenic
1010852078 6:80789716-80789738 AGGAAAATAAAGAAGACTGTAGG + Intergenic
1010924677 6:81729841-81729863 AAGAAGAAAAAGCAGAGTGTAGG + Intronic
1011513431 6:88126540-88126562 ATGAATAAAAAGATGTCTATAGG - Intergenic
1011716008 6:90105755-90105777 ATGAACAAGAAGAAAAGTGAAGG + Intronic
1011813170 6:91156206-91156228 ATGAACAAAAATAAGAGTTTGGG + Intergenic
1011958012 6:93047853-93047875 GGGAACAAAAACAAGAATGTCGG - Intergenic
1012458477 6:99432985-99433007 ATAAATAAAAAGAAGACAGTTGG - Exonic
1012591808 6:100991066-100991088 AAAAAAAAAAAGAAGACTGATGG - Intergenic
1012682704 6:102203205-102203227 AATAAAAAAAAGAAGACTTTGGG + Intergenic
1012756434 6:103237897-103237919 ATGACAAAAAAGAAAACTATAGG - Intergenic
1012759075 6:103274119-103274141 TTGACCTGAAAGAAGACTGTTGG - Intergenic
1013036651 6:106391561-106391583 ATGTAAAAAAAAAAGACTGATGG - Intergenic
1013334157 6:109138092-109138114 CTGAACAAAAGGGAGACTGAAGG + Intronic
1013740363 6:113276731-113276753 TGGAACAAAAAGAAATCTGTAGG + Intergenic
1014758813 6:125331919-125331941 ATCAACAAAATCAAGACTGCAGG - Intergenic
1014844321 6:126257449-126257471 AACAACAAAAAGAAAACTATAGG - Intergenic
1014862750 6:126489839-126489861 ATGAGCAAAAAGAACAAAGTTGG - Intergenic
1015030591 6:128589873-128589895 ATTAATAAAAAGAAGAATTTGGG + Intergenic
1015187912 6:130439658-130439680 ATGACCAAGAACAAGACTCTAGG + Intronic
1015225819 6:130855848-130855870 ATGAAGAAAAAGAACACTATCGG + Intronic
1015979939 6:138828387-138828409 ATCAGCAAAATGCAGACTGTGGG - Intronic
1015994101 6:138980282-138980304 ATGAGCAAAAAGAATACTGGGGG - Intronic
1016027715 6:139305148-139305170 ATGAACAAGGAGAAGGCTTTTGG - Intergenic
1016379605 6:143461380-143461402 ATGAACAAATAGCTGACTATAGG + Intronic
1016686599 6:146889207-146889229 ATGAACATAAAGTAGGCTCTGGG - Intergenic
1016927462 6:149365803-149365825 ATGAATAAAAAAGTGACTGTGGG - Intronic
1016943527 6:149505651-149505673 ATGAAGAAGAAGAAAGCTGTTGG - Exonic
1017933797 6:158985713-158985735 AAAAACAAAAAGAAGAATTTTGG - Intronic
1018779774 6:167052663-167052685 CTGAACAAAACCCAGACTGTAGG - Exonic
1019387644 7:767243-767265 AAAAAAAAAAAAAAGACTGTAGG + Intronic
1020476317 7:8599132-8599154 AGGAACAAATAGAAGGCTGTGGG + Intronic
1020988292 7:15163769-15163791 ATAAAAAAAAAGAAAACTGTAGG - Intergenic
1021058459 7:16080136-16080158 ATCAACAAAGACAAGAATGTGGG + Intergenic
1021880969 7:25095026-25095048 GTGAACAAAACCCAGACTGTGGG - Intergenic
1021893263 7:25208650-25208672 ATGTACAACATGAGGACTGTAGG - Intergenic
1022232950 7:28431733-28431755 ATGAAGAAAAAGAAAATTTTAGG + Intronic
1022247070 7:28570795-28570817 ATGAACTTTAAGATGACTGTGGG + Intronic
1022546086 7:31190665-31190687 ATCAGCAAAAAGCAGACTGTGGG - Intergenic
1022750916 7:33224670-33224692 ATGAGCAAAATCCAGACTGTGGG - Intronic
1022879158 7:34567710-34567732 ATGTACAAAAAGGTGCCTGTGGG + Intergenic
1022945021 7:35274529-35274551 CTGAACAAAAAGAACACAGCTGG + Intergenic
1023825158 7:44004017-44004039 AAAAAAAAAAAAAAGACTGTAGG - Intronic
1023935344 7:44736100-44736122 AGGAACAAAAAGTAGATTATTGG + Intergenic
1023981137 7:45070797-45070819 AAGAAAAAAAAAAAGGCTGTTGG + Intronic
1023986798 7:45101681-45101703 ATGAACAAAGATGGGACTGTGGG + Intronic
1024853862 7:53754222-53754244 ATGAAACAAATGAAGGCTGTTGG + Intergenic
1026000244 7:66555549-66555571 AAAAAAAAAAAAAAGACTGTGGG - Intergenic
1026034232 7:66819586-66819608 AAAAAAAAAAAAAAGACTGTGGG - Intergenic
1026088706 7:67282799-67282821 AAAAAAAAAAAAAAGACTGTAGG - Intergenic
1026471805 7:70700183-70700205 GTAAACAAAAATAAGAATGTGGG - Intronic
1026725542 7:72867551-72867573 AAAAAAAAAAAAAAGACTGTAGG + Intergenic
1027118302 7:75498102-75498124 AAAAAAAAAAAAAAGACTGTAGG - Intergenic
1027273499 7:76537365-76537387 AAAAAAAAAAAAAAGACTGTAGG + Intergenic
1027326947 7:77056422-77056444 AAAAAAAAAAAAAAGACTGTAGG + Intergenic
1027518903 7:79179475-79179497 TTGAACAAAAAGAATAAAGTTGG + Intronic
1028399753 7:90412312-90412334 ATTGACAAAAAGAAGATTGAAGG + Intronic
1028603313 7:92627255-92627277 ACGAACAGAAAGTAGACTGGTGG + Intronic
1028630717 7:92930727-92930749 ATGAAAAGAAACAAGGCTGTGGG + Intergenic
1028848317 7:95508139-95508161 TTGAAGACAAAGAAGACAGTAGG + Intronic
1028887401 7:95949172-95949194 GTCAACAAAAAGGAGAGTGTGGG + Intronic
1029009740 7:97246453-97246475 ATGAACAAAAAGAAAAAGGCCGG + Intergenic
1029719191 7:102351938-102351960 AAAAAAAAAAAAAAGACTGTAGG + Intergenic
1029753424 7:102557328-102557350 AAAAAAAAAAAAAAGACTGTAGG - Intronic
1029771373 7:102656412-102656434 AAAAAAAAAAAAAAGACTGTAGG - Intronic
1030898239 7:115088438-115088460 ATGACCAAAAAGAATACTTTAGG + Intergenic
1030993286 7:116327414-116327436 ATAAACAAAATGAACACTGTGGG - Intronic
1031231311 7:119110611-119110633 ATCAAAAAAAAGAAAACTGTTGG - Intergenic
1031813719 7:126406108-126406130 ATGAAGAAAATGAATACTGGAGG - Intergenic
1031868450 7:127065588-127065610 ATGAAAGATAAGAAGAGTGTTGG + Intronic
1032557792 7:132855880-132855902 AAGAAAAAAAAGAAGAGGGTGGG + Intronic
1033093029 7:138404345-138404367 ATGAACAAGAGGAAGAAGGTGGG - Intergenic
1034083377 7:148301363-148301385 ATAAAAAAAAAAAAGACTATGGG + Intronic
1034395773 7:150824083-150824105 AAGAACAAAGAGAAGGCTGGAGG - Intergenic
1034636142 7:152568719-152568741 ACGAACAAAAAAAAGTATGTTGG + Intergenic
1035813204 8:2510785-2510807 TTGAACAAAAAAAGGACAGTAGG + Intergenic
1035893308 8:3370215-3370237 ATGAAATAAAAGAAGAAAGTTGG - Intronic
1037146885 8:15582881-15582903 AAGAACAAAGAGAAGGTTGTAGG - Intronic
1037366948 8:18132952-18132974 ATCAATAAAAAGAAGAATCTTGG + Intergenic
1037818076 8:22122381-22122403 ATGAAGAGAGAGAAGCCTGTGGG - Intronic
1037899579 8:22679794-22679816 AAAAGCCAAAAGAAGACTGTTGG - Intergenic
1038102249 8:24390753-24390775 AATAACAAAAACAACACTGTTGG + Intronic
1038871575 8:31500527-31500549 ATGCACAAGATGAAGACTATAGG - Intergenic
1039444748 8:37622059-37622081 AAAAACAAAAAGAAGACTTGGGG - Intergenic
1039515663 8:38131163-38131185 ATCAATAAAAATGAGACTGTAGG - Intronic
1039542669 8:38384154-38384176 AGGAAGAAAAAGAAGAATGGAGG - Intergenic
1042609237 8:70578631-70578653 TCGAAAAAAAAGAAGACTCTAGG + Intronic
1042797055 8:72675850-72675872 ATAAACAAAAATCAGACTGCAGG - Intronic
1043006382 8:74824208-74824230 ACAAAAAAAAAAAAGACTGTGGG - Intergenic
1043787143 8:84417523-84417545 AAGAAAAAAAAAAAGACTATAGG - Intronic
1043807788 8:84694654-84694676 TTGAACAAAAAGAACACAGCTGG + Intronic
1045534066 8:103010644-103010666 ATGAACAAACAGGAGAGTCTGGG - Intergenic
1045634112 8:104163080-104163102 ATGGAAAAAGATAAGACTGTTGG + Intronic
1045773315 8:105771232-105771254 AGGAAAAAGAAGAAGACAGTGGG - Intronic
1045853398 8:106731834-106731856 ATGAAGAAAAAGAACAAAGTTGG - Intronic
1046607236 8:116384902-116384924 AAGAACAAAAAGAGGTCTGAGGG + Intergenic
1046777206 8:118177107-118177129 ATGAACAAAAGGGAGAGTGTTGG + Intergenic
1046782422 8:118230002-118230024 ATTAAAAAAAAGAAAACTGAGGG + Intronic
1047102440 8:121692828-121692850 CTGAACAAAAAGAACACAGCTGG + Intergenic
1047123451 8:121932216-121932238 TTGAAGAAAAATAAGACTATTGG + Intergenic
1047203745 8:122787025-122787047 AAGAACAGGAAGCAGACTGTGGG - Intronic
1047377442 8:124315308-124315330 ACAAACAAAAAAAAAACTGTAGG - Intronic
1047701128 8:127450510-127450532 ATGAAGGAAAAGAAGCTTGTAGG - Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1048434811 8:134406331-134406353 ATGTACAACAGGAGGACTGTAGG - Intergenic
1048641003 8:136361474-136361496 ATGAACAAATTGAAGACTGCAGG - Intergenic
1049913561 9:294463-294485 AATAACTAAAAGAAGACTGGAGG - Intronic
1050346537 9:4694375-4694397 ATGAACAAAATAAAGACAGGTGG - Intronic
1050444463 9:5704207-5704229 ATAAAAAAAAAAAAGACAGTGGG - Intronic
1050715178 9:8516238-8516260 ATGCAGAAAAAAAATACTGTAGG - Intronic
1050771708 9:9209262-9209284 ATGAACAAAATTCAGACTGTGGG + Intronic
1050775369 9:9252971-9252993 TTAAACAAAAATAAGACTATTGG + Intronic
1050957440 9:11682421-11682443 AAGAAAAAAAGGAAGACTGAGGG + Intergenic
1051128070 9:13827665-13827687 AGGAACAAAAGGAACATTGTAGG - Intergenic
1051564076 9:18476663-18476685 AAAAACAAAAAAAAGACTATAGG - Intronic
1051913731 9:22184293-22184315 ATATCCACAAAGAAGACTGTGGG - Intergenic
1053226131 9:36359384-36359406 ATAAACAAAAATAAGTCTTTTGG - Intronic
1053622805 9:39837462-39837484 ATGACCAAAAAGAAAACTTCAGG + Intergenic
1054730739 9:68700517-68700539 AAGAACAATAAGAAAACTGGAGG - Intergenic
1054932216 9:70647232-70647254 ATGAAAAAAAAGAAAACTTCAGG + Intronic
1056106556 9:83352851-83352873 ATGAAAAGAATTAAGACTGTGGG - Intronic
1057061384 9:92006583-92006605 ATGAAAAAAAAGTAGAAGGTGGG + Intergenic
1057381022 9:94567652-94567674 AGGAAAAGAAAGAAGACTATGGG - Intronic
1057464503 9:95300418-95300440 ACCAAGAAAAAGAAGTCTGTAGG + Intronic
1057977408 9:99620752-99620774 ATGAACACAAAGACGACAGCAGG + Intergenic
1058573891 9:106379418-106379440 AACAAGAAAAAGAACACTGTGGG + Intergenic
1058949551 9:109890922-109890944 AGGAACAAACACAAGACTCTAGG - Intronic
1059294046 9:113253950-113253972 AAAAAAAAAAAAAAGACTGTGGG - Intronic
1059683468 9:116609407-116609429 ATGAACAAAGATAGGACTGATGG + Intronic
1059814631 9:117898975-117898997 GAGAACAAAAAGATGACTTTTGG + Intergenic
1059834902 9:118140863-118140885 AAGAACAAAAAGAAGATAGAGGG - Intergenic
1059861900 9:118473765-118473787 ATGAACAAAAGCCAGACTGTGGG + Intergenic
1059906213 9:118989819-118989841 CAGAACAAAAAGAAGACTGATGG + Intergenic
1060355482 9:122904182-122904204 ATGAAAAAAAGGAAGGCCGTGGG + Intronic
1060705176 9:125792141-125792163 ATGTAGGAAAAGAATACTGTGGG + Intronic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1061383342 9:130272856-130272878 ATGAATAAAAAGAAGATGCTCGG - Intergenic
1061535727 9:131248555-131248577 AAAAAAAAAAAGAAGTCTGTCGG - Intergenic
1203718937 Un_KI270742v1:185540-185562 ATGTACAACATGAGGACTGTAGG + Intergenic
1203653171 Un_KI270751v1:149215-149237 ATGTACAACATGAGGACTGTAGG + Intergenic
1185711643 X:2308724-2308746 ATGAACAAAATCAACATTGTGGG + Intronic
1185959569 X:4534089-4534111 GTGAACAGAAAGCAGACTGGAGG + Intergenic
1186601852 X:11047096-11047118 ATCAACAAAAAGAGGAATTTTGG - Intergenic
1186747234 X:12582702-12582724 ATGAAAAGAAAGGAGCCTGTAGG - Intronic
1187420054 X:19126114-19126136 AAAAAAAAAAAAAAGACTGTGGG + Intergenic
1187834476 X:23417449-23417471 ATGAACAACAACAAAAATGTTGG - Intergenic
1187846519 X:23543547-23543569 ATCAATAACAAGAAGAATGTTGG + Intergenic
1187865392 X:23718915-23718937 AAAAAAAAAAAAAAGACTGTAGG + Intronic
1187905796 X:24065285-24065307 ATGAACAAAGAGAAAAGTGTGGG - Intronic
1188442794 X:30229844-30229866 AGGAACAGAATGAAGAGTGTGGG - Intergenic
1188575836 X:31649149-31649171 ATGAACAAAAAACAGTCTGTTGG + Intronic
1188732024 X:33660444-33660466 GTTAACAAAAAGAAAAATGTGGG + Intergenic
1188744496 X:33826199-33826221 AAGAACAAAAAGGAAACTTTAGG - Intergenic
1189457493 X:41206518-41206540 ATCAACAAAATTCAGACTGTGGG - Intronic
1189919554 X:45889906-45889928 TAGAAGAAAAAGATGACTGTGGG + Intergenic
1190263186 X:48811816-48811838 ATGAACAAAATAAAGAACGTCGG - Intronic
1190393959 X:49960816-49960838 ATGATTAAAAAGAAGATTTTGGG - Intronic
1192396618 X:70788213-70788235 ATGAGCAAAAAGAATACAGCTGG + Intronic
1192747786 X:73956810-73956832 AAGAAAAAAAAGAAAACTATTGG - Intergenic
1193231566 X:79052960-79052982 ACGAAGAAACAGATGACTGTTGG - Intergenic
1193384383 X:80853646-80853668 ATAAACAAAAAGAAAACAGTTGG + Intergenic
1194039762 X:88925859-88925881 ATGAACAAAACCAAGTCTCTGGG + Intergenic
1194062465 X:89221381-89221403 ATGAAAAAAAAAAAGACTAGTGG + Intergenic
1194325679 X:92513913-92513935 ATGAACAGAAAGCAGACTAGTGG - Intronic
1194459258 X:94146613-94146635 AAGAAAAAAAAGAAGTCTCTAGG - Intergenic
1194609557 X:96024453-96024475 ATAAACAAAAAGTAGAATGGTGG + Intergenic
1194776916 X:97976513-97976535 ATGAACAAAGAGAAGATTGCTGG - Intergenic
1194815248 X:98432908-98432930 ATGATCAAAAAGACCAGTGTAGG + Intergenic
1194989368 X:100529549-100529571 AAAAACAAAAAGAAAAGTGTTGG - Intergenic
1195501471 X:105605648-105605670 TTGAACAAAAAGAACAAAGTTGG + Intronic
1195579172 X:106482206-106482228 ATTTAATAAAAGAAGACTGTTGG + Intergenic
1195595782 X:106687453-106687475 ATCAACAAAAAGAAAACTACAGG + Intergenic
1195688660 X:107606422-107606444 ATGGAAAAAAAGGAGTCTGTAGG - Intergenic
1195773153 X:108373668-108373690 ATGAACAAGATGAAGTGTGTAGG - Intronic
1195953937 X:110308582-110308604 ATGGACAAGTAGAAGAGTGTGGG + Intronic
1196024716 X:111029198-111029220 ATCAACAAAGAGAAGCCTATAGG + Intronic
1196315491 X:114217524-114217546 ATGAATAAAAAGATCACTGACGG - Intergenic
1196395257 X:115254345-115254367 CTGAAAAAAAAGAACACAGTTGG + Intergenic
1196547429 X:116978961-116978983 ATGAATAAAAAGTAGAATTTTGG + Intergenic
1196861664 X:120034390-120034412 ATGAAATGAAGGAAGACTGTTGG + Intergenic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1197756156 X:129996366-129996388 ATGAACCAAAAGGAGCCTGGGGG + Intronic
1197832491 X:130659227-130659249 ATGAATAAAAAGGAGGATGTTGG - Intronic
1198190762 X:134302668-134302690 ATTAACAACAAGAGGAATGTTGG + Intergenic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1198453897 X:136796070-136796092 ATGGTCAAAAAGAAGGCTTTTGG - Intergenic
1198951222 X:142074528-142074550 AGGAAAAAAAAAAAAACTGTCGG - Intergenic
1199865511 X:151845747-151845769 TTGAACAAGAAGAACACAGTTGG + Intergenic
1200364071 X:155642785-155642807 ATCAACAACAAGAAGAATTTTGG - Intronic
1200593079 Y:5101482-5101504 ATGGGCACAAAGAAAACTGTGGG + Intronic
1200634408 Y:5633080-5633102 ATGAACAGAAAGCAGACTAGTGG - Intronic
1200716333 Y:6550347-6550369 ATGAAAAAAAAAAAGACTAGTGG + Intergenic
1200871624 Y:8105447-8105469 ATGAAGAAAAAGAATTCAGTTGG - Intergenic
1201902556 Y:19058346-19058368 AAAAAAAAAAAAAAGACTGTGGG - Intergenic