ID: 1197290561

View in Genome Browser
Species Human (GRCh38)
Location X:124651971-124651993
Sequence GGATCAAGGACCTTGGTATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197290561_1197290567 22 Left 1197290561 X:124651971-124651993 CCAGATACCAAGGTCCTTGATCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1197290567 X:124652016-124652038 CCTGAAGCGAAGTTAAGATCAGG 0: 1
1: 0
2: 1
3: 3
4: 61
1197290561_1197290568 30 Left 1197290561 X:124651971-124651993 CCAGATACCAAGGTCCTTGATCC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1197290568 X:124652024-124652046 GAAGTTAAGATCAGGTTCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197290561 Original CRISPR GGATCAAGGACCTTGGTATC TGG (reversed) Exonic
900474561 1:2870010-2870032 GGATGAAGGGCCTTGGGAACAGG + Intergenic
906778434 1:48550711-48550733 GGATGAAGGTGCTGGGTATCAGG + Intronic
910115155 1:83723812-83723834 GGATCAAGGCCCTTTGTTTTAGG + Intergenic
911436064 1:97859429-97859451 GGATCAAGGCCCTTTGTTTCGGG + Intronic
919208728 1:194452665-194452687 GGATCAAAAACCTAGGTATATGG + Intergenic
920872404 1:209805554-209805576 GGATCAAGGACCTGCGGACCTGG + Intronic
1063208228 10:3854987-3855009 GTACCAAGTACCTTGGTGTCTGG + Intergenic
1069417567 10:68214491-68214513 GACTCAAGGAACTTGGTATAAGG - Intergenic
1071096706 10:81983892-81983914 TGATTAAGGATCTTGATATCGGG + Intronic
1073095619 10:100977984-100978006 GGATCAAGGCCCTTTGTTTTGGG - Intronic
1074925039 10:118059945-118059967 GGCTCAAGGAACTTGGAATGGGG - Intergenic
1075273862 10:121076335-121076357 GCATTGAGGACCTTGGCATCAGG + Intergenic
1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG + Intronic
1080199755 11:29655276-29655298 GGAACTAGGACTTTGGTATTAGG - Intergenic
1085256692 11:75177677-75177699 GGATCAAGGCCCTTTGTTTTGGG - Intronic
1089507147 11:118971608-118971630 GGGTCGAGGACCTGGGGATCCGG - Intergenic
1093005633 12:14047891-14047913 AGTTCAAGGACTTTAGTATCAGG - Intergenic
1101687082 12:107035659-107035681 GGTTCAAGGAGCTTGGAATTTGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1117375030 14:55112000-55112022 GGATCAAGGCCCTTTGTTTTGGG + Intergenic
1118562040 14:67096264-67096286 GGAGCAAGGTCTTTGTTATCAGG - Intronic
1119898475 14:78240423-78240445 GGATCAAGGCCCTTTGTTTTAGG + Intergenic
1121664962 14:95665386-95665408 GGATCAAGGCCCTTTGTTTTGGG + Intergenic
1125884382 15:43217752-43217774 GTCTAAAGGACCTTGCTATCAGG - Intronic
1125891050 15:43267554-43267576 GGATCAAGGCCCTTGCTCACCGG - Intergenic
1127312852 15:57767827-57767849 GGATCAAGGCCCTTTGTTTTAGG - Intronic
1129447958 15:75631974-75631996 GGCTCAGGGACCTTGGGATGGGG - Intergenic
1130144983 15:81267183-81267205 GGATCCAGGTCCTTGGGAACAGG + Intronic
1136464642 16:30433964-30433986 GGATCAAGTTCCTTTGTATCTGG - Intergenic
1137621726 16:49880727-49880749 GGAGCAAGGACATTCGTTTCTGG + Intergenic
1138653419 16:58474850-58474872 GGAGAAAGGACCTTGGTGTCAGG + Intronic
1140258275 16:73355661-73355683 AGATCAAGGACCTTGGAGTCAGG + Intergenic
1141005841 16:80350764-80350786 GGATCAGGGATCTTGATATGGGG - Intergenic
1143587849 17:7859835-7859857 AGATCAAGTACCTTGGTTTAGGG + Exonic
1148025702 17:44586132-44586154 GGATTAAGGACCTTGGTCAAGGG - Intergenic
1148487227 17:47998258-47998280 GGATCAGGGACTTTTGAATCTGG + Intergenic
1149910719 17:60564551-60564573 GGATCAAGGCCCTTTGTTTTGGG - Exonic
1150712898 17:67546742-67546764 AGTTCAAGGAACTTGGTTTCTGG + Intronic
1151426649 17:74035079-74035101 GGATCAAGGCCCATGGTTTTGGG + Intergenic
1155123336 18:22844861-22844883 GGAACTAGAACCCTGGTATCTGG - Intronic
1155836508 18:30592802-30592824 GGATCAGTAACATTGGTATCAGG - Intergenic
1156378254 18:36533612-36533634 GGATCAATGACTTTGATAACTGG + Intronic
1165949297 19:39464989-39465011 GGACCCAGGACTTTGGTTTCAGG - Exonic
1166229454 19:41417396-41417418 TGATACAGGACCTTGGAATCAGG - Intronic
1167462312 19:49632101-49632123 GGATCAGGGGCCTGGGTATAGGG + Intergenic
926072926 2:9914752-9914774 GGAAGAAGGACCTTGGAAACGGG - Intronic
926188630 2:10710844-10710866 GAATCCAGGACTTTGGGATCAGG + Intergenic
926203321 2:10816962-10816984 GCATCAAGGAACTTGGGTTCTGG - Intronic
927093456 2:19729708-19729730 GGATCAAGGGCTTTGACATCAGG - Intergenic
931727628 2:65127085-65127107 GGATCAAATACATGGGTATCTGG - Intronic
939595844 2:144121337-144121359 GGATCAAGGCCCTTTGTCTTGGG - Intronic
941518719 2:166511425-166511447 GGATGAAGGAGCTTGGTAGGGGG - Intergenic
941740844 2:169033539-169033561 GGAACAAGTACATGGGTATCTGG + Intergenic
944089628 2:195891452-195891474 GGGTAAAGGAGCTTGGTCTCTGG + Intronic
946321313 2:218956017-218956039 GGTGCAATGACCTTGGTTTCTGG + Intergenic
948447500 2:238044220-238044242 GGATCAGGTACCTTAGTATTCGG + Intronic
1171220999 20:23397927-23397949 GGATCAGGGACCATGGATTCTGG + Intronic
1173163975 20:40673301-40673323 GGATCCAGGCCTTTGGTCTCAGG + Intergenic
1174048627 20:47751636-47751658 GGATCTAGGAGCTTTGTCTCTGG - Intronic
1177054055 21:16277444-16277466 TGATCAAGGGCTTTGGTTTCTGG + Intergenic
1181172210 22:21016034-21016056 AGATCAAGGAGCTTGGAAACCGG + Exonic
1181177107 22:21044185-21044207 AGATCAAGGAGCTTGGAAACCGG - Intergenic
1181581296 22:23829477-23829499 GGGTCAGGGAGCTTGGTAGCTGG + Intronic
1182350073 22:29694411-29694433 GGCTCAGGGACCTTGGTAGATGG + Intronic
1183996291 22:41635392-41635414 CTTTCAAGTACCTTGGTATCAGG - Intronic
1184047927 22:41983320-41983342 GGGTCAGGGACCCTGGTAGCTGG + Intronic
950120201 3:10476701-10476723 GGTTAAAGGAACTTGGTGTCTGG - Intronic
952039116 3:29240519-29240541 AGATTAAGGACCTTGATATGGGG - Intergenic
954092864 3:48299194-48299216 TGATCAAGCACCTTTGTGTCAGG - Intronic
954258173 3:49420489-49420511 GGATCAAAGACCTTGGACTTGGG - Intronic
960444045 3:117725600-117725622 GCATGAAGGTCCTGGGTATCTGG - Intergenic
976637217 4:87298495-87298517 GGATCATGCACCTGGGAATCTGG - Intergenic
977533220 4:98224909-98224931 GGATCAAGGCCCTTTGTTTTGGG + Intergenic
978232158 4:106412581-106412603 GGATCTAGGAGCTTTGTGTCTGG + Intergenic
988511396 5:31867572-31867594 AGTTCAAGGACCAGGGTATCAGG + Intronic
991018918 5:61959784-61959806 GGAGGCAGGACCTTGGTCTCAGG - Intergenic
995031498 5:107487073-107487095 GGGTCAAGGCCCATGGTATCTGG + Intronic
995493864 5:112721520-112721542 GGATCATGGAAGTTGGTATTTGG + Intronic
999925609 5:156372848-156372870 GGATCAAGGAGCTTTGAATATGG + Intronic
1002278853 5:178119471-178119493 GGAGCAAGTACCTTGTTTTCAGG + Intronic
1010579279 6:77574224-77574246 GGATCAAGGCCCTTTGTTTTGGG + Intergenic
1014948669 6:127528320-127528342 GGAACAAGGAGAGTGGTATCTGG - Intronic
1018682002 6:166272095-166272117 GGATCAAGGCCCTTTGTTTTGGG - Intergenic
1019684992 7:2376857-2376879 TGAACAAGGTCCTGGGTATCGGG - Intronic
1020000250 7:4751579-4751601 GTATCGGGGGCCTTGGTATCAGG + Intronic
1022015937 7:26348257-26348279 GGAACAAGCAGCTTGGTCTCAGG - Intronic
1024259064 7:47560325-47560347 AGATCAAGGCCCTCGGTGTCTGG - Intronic
1027570551 7:79860552-79860574 GGATCAAGGTCCTTTGTTTTGGG - Intergenic
1027866478 7:83654130-83654152 GGAACATGGACCCTGGTGTCTGG - Intergenic
1029335513 7:99896387-99896409 GGATCAAGGCCCTTTGATTCGGG + Intronic
1031478644 7:122252129-122252151 GGTCCAAGGACCTTGGGGTCAGG + Intergenic
1036628019 8:10488028-10488050 GGATAAAGGATCTTGGGAACAGG - Intergenic
1038983361 8:32783149-32783171 AGATCAGGGCCTTTGGTATCAGG - Intergenic
1045406174 8:101868790-101868812 GGCTCAAGGACCCTGGTTACAGG - Intronic
1046366333 8:113237239-113237261 GCTTCAAGGACCCTGATATCGGG + Intronic
1055548200 9:77404764-77404786 GGATAAAGGATCTTTGAATCAGG + Intronic
1057429441 9:94980337-94980359 GGGTCATGGGCCTTGGCATCTGG + Intronic
1058066161 9:100550492-100550514 GGTTCAAAGACCTGGGCATCGGG - Intronic
1060880289 9:127113293-127113315 GGAGCATGGCCCTTGGTATCAGG - Intronic
1061115963 9:128612215-128612237 GGATCAAGGACTTTGACTTCTGG + Exonic
1189377239 X:40475435-40475457 GGATCAAGGCCCTTTGTTTGGGG + Intergenic
1192823408 X:74668085-74668107 CGATTAAGGACCTTGGCAGCAGG - Intergenic
1197290561 X:124651971-124651993 GGATCAAGGACCTTGGTATCTGG - Exonic