ID: 1197291283

View in Genome Browser
Species Human (GRCh38)
Location X:124661588-124661610
Sequence TCTTAACTTTGGATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197291283 Original CRISPR TCTTAACTTTGGATGGTGGC AGG Intronic
902909986 1:19588717-19588739 GCTTAGCTTGGCATGGTGGCAGG - Intergenic
904292602 1:29497623-29497645 TCTTAACTGGGGATGGGGGCTGG - Intergenic
904593628 1:31629105-31629127 TTTTAGCTCTGGATGGGGGCTGG + Intronic
908333520 1:63096463-63096485 TCTTAGCTTCAGATGGTTGCTGG - Intergenic
909282709 1:73775757-73775779 TCTTGACTTTGAATGGTGCAAGG - Intergenic
909494895 1:76267365-76267387 TTTTGACTTTGGACAGTGGCAGG - Intronic
912247593 1:107976605-107976627 ACTAAACTGTGGATGGGGGCGGG + Intergenic
912694040 1:111827480-111827502 GCTTAACTTGCGATGGAGGCAGG - Intronic
915606118 1:156952281-156952303 TCTTAGCTTTGAAAGGGGGCTGG - Intronic
919923687 1:202181378-202181400 TCTTTTCTTTTGATGGTGTCAGG + Intergenic
920028937 1:203024361-203024383 GGTTAATTTTGGATGGTGGAGGG - Exonic
920248001 1:204602735-204602757 TTTTAACTTGATATGGTGGCAGG + Intergenic
920566221 1:206975615-206975637 TCTTTACTTTGTATGTTTGCTGG + Intergenic
920601824 1:207333297-207333319 TTTCACCTTTGGAAGGTGGCAGG - Intronic
921271910 1:213477661-213477683 TCTTCACTTTGGATGGTATCTGG - Intergenic
1063786272 10:9387564-9387586 CCCTAAGTTTGAATGGTGGCTGG - Intergenic
1063994405 10:11605113-11605135 TCTTCTCTTCGGATGGTGGCTGG - Intronic
1066190796 10:33053959-33053981 TCTTGCCTTTTGATGGTGGTGGG - Intergenic
1072195472 10:93114138-93114160 TCTTTCCCTTGCATGGTGGCAGG - Intergenic
1075050478 10:119179620-119179642 ACTTAACTGGGCATGGTGGCAGG - Intergenic
1076325981 10:129623435-129623457 TCCTAATTCTGGATGGTGGCTGG - Intronic
1077312453 11:1895857-1895879 TCTGAACTGTGCATGGTGGTGGG + Intergenic
1077381072 11:2237901-2237923 GGTTATCTGTGGATGGTGGCAGG - Intergenic
1078373941 11:10777065-10777087 TCTTGAGTTTGGGTGGTGGTAGG + Intronic
1078807724 11:14723291-14723313 TCTTAAATTTTGATGGATGCTGG + Intronic
1081636447 11:44725517-44725539 TCAAAACTCTGGCTGGTGGCTGG + Intergenic
1084174172 11:67415200-67415222 CCCTACCTTTGGATGGAGGCCGG - Intronic
1084468752 11:69342882-69342904 TCTTTCCTGGGGATGGTGGCAGG + Intronic
1086802297 11:91192246-91192268 TCCTAGCTTCTGATGGTGGCAGG + Intergenic
1087297176 11:96390250-96390272 TCGTAACTTTGGGGTGTGGCAGG + Intronic
1087393108 11:97564317-97564339 TATTACCTTTTGATGGTTGCTGG - Intergenic
1087417433 11:97875211-97875233 TCCTAAATTTTGATGGTTGCTGG + Intergenic
1088665799 11:112092319-112092341 TCTTAACCTAGGCTGGTGACAGG - Intronic
1089259239 11:117211761-117211783 TCTTAACACTGGTAGGTGGCAGG - Intronic
1089395202 11:118132165-118132187 CCTTAATTTGGGCTGGTGGCAGG - Intergenic
1091938288 12:4450913-4450935 ACATAACTTTGCATGGTGGCTGG - Intergenic
1097406814 12:59199114-59199136 TTTTAACTTTGGATTGAGACTGG - Intergenic
1099141479 12:78981891-78981913 TCTTAAATTTGGATAGTTGAAGG + Intronic
1099910863 12:88831633-88831655 ACTGAACTTTGAATGGTGGTGGG + Intergenic
1102024214 12:109704249-109704271 AATTAACTGTGCATGGTGGCAGG + Intergenic
1102450958 12:113041825-113041847 TCTTAACTAAGAATGGCGGCTGG + Intergenic
1104270135 12:127276052-127276074 TCTTATCTATGGCTGGTGGGTGG - Intergenic
1105233661 13:18524905-18524927 TTTTAACTTTTGATAGAGGCTGG + Intergenic
1105296462 13:19091100-19091122 TCTCCAGCTTGGATGGTGGCTGG - Intergenic
1105469270 13:20677496-20677518 TCTTAACTTTGGAAAGGGACAGG + Intronic
1107187816 13:37545568-37545590 AATTAGCTTTGCATGGTGGCGGG - Intergenic
1107275670 13:38676196-38676218 TCTTAGCTGGGCATGGTGGCAGG - Intergenic
1108433072 13:50374132-50374154 TGCTGACTTTAGATGGTGGCTGG + Intronic
1108733681 13:53260422-53260444 TATTAACTTTGGCTGGTAGAGGG + Intergenic
1109877852 13:68429170-68429192 TCTTCAGTTTGGTTGGTGACAGG + Intergenic
1113063768 13:106353871-106353893 TTCCAACTTGGGATGGTGGCTGG - Intergenic
1113377670 13:109780879-109780901 TCTAAACTTTGAATGGTGTTTGG - Intronic
1115698258 14:35923721-35923743 TTTAAAGTTTGTATGGTGGCCGG + Intronic
1117869815 14:60188316-60188338 TCATAACTTGTGATGGTGGGAGG - Intergenic
1118484244 14:66198717-66198739 TGTTAAGTTTGGATGATGGGTGG - Intergenic
1119980591 14:79076459-79076481 CCTTACCTATGGCTGGTGGCAGG + Intronic
1120118155 14:80644114-80644136 TCTCAGCTTTTGGTGGTGGCTGG - Intronic
1120757981 14:88262170-88262192 TCTAAAGTTTGGAAGGTGGAGGG - Intronic
1121592646 14:95128911-95128933 TCATAACTTAGGTTGGTGGAAGG - Intronic
1122107609 14:99470442-99470464 TCTTAATTAAGGATGGGGGCAGG + Intronic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1125147734 15:36491749-36491771 CCTCCACTCTGGATGGTGGCTGG - Intergenic
1126829212 15:52582800-52582822 TCTTGACTTTTGATGGTGGCTGG - Intronic
1127362249 15:58254520-58254542 TCTTAGCTTTGGGTGGCCGCCGG + Intronic
1127746782 15:61985403-61985425 ACTTAGCTTGGCATGGTGGCGGG - Intronic
1128171632 15:65518361-65518383 GCTTAGCTTGGCATGGTGGCGGG + Intergenic
1128670128 15:69568378-69568400 ACTTAACTCTGGATGGGGGCTGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1138742691 16:59329268-59329290 TCCTAAATTAGGTTGGTGGCTGG + Intergenic
1139503648 16:67388211-67388233 TCTTAACATTTGCTGGTGGGAGG + Intergenic
1139912420 16:70406294-70406316 ACTTAGCTGTGGGTGGTGGCAGG + Intronic
1144174699 17:12694002-12694024 TCTTATCTTTGGAAGGTCGTGGG - Intronic
1144465191 17:15491322-15491344 TTTTAACTGGGGATGGGGGCAGG + Intronic
1147299984 17:39518705-39518727 AATTAACTGTGCATGGTGGCGGG - Intronic
1147334691 17:39720171-39720193 TCTTAACTGGGGATGGTGGGAGG + Intronic
1148413419 17:47487415-47487437 TTTAAAGTTGGGATGGTGGCTGG - Intergenic
1152475765 17:80517008-80517030 TCTCTGCTTTGGATGGGGGCTGG - Intergenic
1152661477 17:81544313-81544335 TCTTGCCATTGGTTGGTGGCTGG - Intronic
1154006328 18:10530614-10530636 GCCTAAGTTTGGATGGAGGCGGG + Intronic
1154519359 18:15210555-15210577 TTTTAACTTTTGATAGAGGCTGG - Intergenic
1155468433 18:26165064-26165086 AATTAACTTGGCATGGTGGCAGG - Intronic
1156012605 18:32512329-32512351 TCTTAAGGATGGAGGGTGGCTGG - Intergenic
1157289661 18:46400515-46400537 ACTTAACACAGGATGGTGGCAGG - Intronic
1158370085 18:56791590-56791612 TCTGAATTTTGGGTGATGGCTGG + Intronic
1159441438 18:68485520-68485542 TCCTAAATTTGCATGGTAGCTGG + Intergenic
1162312370 19:9914606-9914628 CTTTAACTTTGGGTGGGGGCGGG + Intronic
925743073 2:7021846-7021868 TCAAAACTTTAGATGGAGGCTGG + Intronic
925762868 2:7203377-7203399 TCTTAACTTTGGGGGGGGGAAGG - Intergenic
926023878 2:9521926-9521948 TCTGCAGTTTTGATGGTGGCTGG + Intronic
928225716 2:29446299-29446321 TCTTAGGTTTGCATGTTGGCAGG + Intronic
928429885 2:31208532-31208554 TCTAAACTTTGGAGGGTGAGAGG - Intronic
928466408 2:31527019-31527041 TTTTAGCTTCTGATGGTGGCCGG - Intronic
931932888 2:67160782-67160804 TCCTAGCTTTTGGTGGTGGCTGG - Intergenic
934468221 2:94285989-94286011 TCTTAACTTTTGATAGAGACTGG - Intergenic
937003347 2:118488628-118488650 AATTAGCTTTGCATGGTGGCGGG + Intergenic
937302039 2:120848472-120848494 TCTTTATTTTGGGTGGAGGCAGG + Intronic
938766196 2:134461925-134461947 TCCTCACTTTGGAAGGTGGGCGG - Intronic
940148757 2:150576403-150576425 TCCAAAATTTGGATGGTGCCAGG + Intergenic
945445394 2:209932059-209932081 TCTTAAGTCTGGCTGGTTGCTGG + Intronic
1170452061 20:16493204-16493226 GCTTAAGTTTAGATGGTGGTAGG - Intronic
1175442441 20:59001349-59001371 TCCTCACATTGGCTGGTGGCTGG - Intronic
1176777644 21:13153180-13153202 TTTTAACTTTTGATAGAGGCTGG + Intergenic
1178130856 21:29571207-29571229 TATTAACTGGGCATGGTGGCGGG + Intronic
1179445567 21:41427850-41427872 CCTTACCTTGGAATGGTGGCTGG - Exonic
1180164535 21:46017138-46017160 TGTTACTTCTGGATGGTGGCAGG + Intergenic
1182865177 22:33598073-33598095 TCTGAGCTTTTGATGGGGGCAGG - Intronic
1184558290 22:45245809-45245831 TCTTAACACTGTCTGGTGGCTGG - Intergenic
951488172 3:23237759-23237781 CCTAAACTATTGATGGTGGCAGG - Intronic
954365668 3:50144861-50144883 TCTAAACTCTGGCTGGTGGCAGG + Intergenic
956796655 3:72724191-72724213 TCTTAAGTAAGGATGGGGGCTGG - Intergenic
958193526 3:90213099-90213121 TCTTAAGTTTTGTTGGTGCCAGG - Intergenic
958416835 3:93884006-93884028 TCTTAAGTTTTGTTGGTGCCAGG - Intronic
958907839 3:99961469-99961491 TCTTAACTTTGCAAGGAGACAGG + Intronic
961880526 3:130058465-130058487 TTCTAGTTTTGGATGGTGGCCGG - Intergenic
967653006 3:192009494-192009516 TCTTAATTTAGCATGATGGCTGG - Intergenic
968784680 4:2611415-2611437 AATTAACTATGCATGGTGGCTGG - Intronic
972365732 4:38372769-38372791 TCCTAACTTGTGGTGGTGGCTGG - Intergenic
972530918 4:39960675-39960697 AATTAGCTTTGTATGGTGGCAGG - Intronic
974483059 4:62470642-62470664 TAGTAACATTGAATGGTGGCCGG - Intergenic
977822158 4:101485823-101485845 TCTTAGCTAGGCATGGTGGCTGG - Intronic
978702567 4:111666120-111666142 TCTTATCTTTTGATGGTGATTGG - Intergenic
983001239 4:162417540-162417562 TGTTAACTATGTATAGTGGCTGG - Intergenic
985638203 5:1050616-1050638 TCTGAACGTTGGTTGGTGGCTGG - Exonic
985987455 5:3528292-3528314 ACTTATCTGTGCATGGTGGCAGG + Intergenic
986125396 5:4879133-4879155 TCTTGGCTTTGGGTGGTGACCGG + Intergenic
986596323 5:9426139-9426161 TATTAAATTTGTATTGTGGCCGG + Intronic
987765708 5:22226422-22226444 GCTTAAATATGGATGGTGGGGGG + Intronic
988307141 5:29506906-29506928 TATTAATCTTGGATGCTGGCAGG - Intergenic
989583100 5:43051921-43051943 TCTTCAGTTTGAATGGGGGCAGG - Intergenic
990311076 5:54539463-54539485 ACTGCACTATGGATGGTGGCAGG - Intronic
992660687 5:78957886-78957908 TCTGGACCTTGGCTGGTGGCTGG - Intronic
996260793 5:121465488-121465510 TTTTAACTTTTGGTGGTTGCTGG + Intergenic
999958549 5:156728601-156728623 TCTTATCTTGGGGTGGTGGTGGG - Intronic
1004015718 6:11730155-11730177 TCTTCAGTTTGGATCCTGGCTGG + Intronic
1004680602 6:17890563-17890585 GATTAACTTTGGATTTTGGCAGG - Intronic
1005213372 6:23495911-23495933 TCCTAACTTCTGATGGTTGCTGG - Intergenic
1005269338 6:24146657-24146679 TATTAACTGGGGGTGGTGGCAGG - Exonic
1006681687 6:35801468-35801490 AATTAACTGAGGATGGTGGCAGG + Intergenic
1008819721 6:55616380-55616402 TCTTAAGTGTGGTTGTTGGCAGG - Intergenic
1009787861 6:68361515-68361537 CCTTTTCTTTGCATGGTGGCAGG - Intergenic
1011463686 6:87632713-87632735 TGTTAACTGGGCATGGTGGCAGG + Intronic
1014178028 6:118351167-118351189 TCTTTATCTTGGATGGTAGCTGG - Intergenic
1015610198 6:135009026-135009048 TCTCAACTTTGGGAGGTAGCTGG - Intronic
1016673774 6:146739134-146739156 TCTTATTTTAGAATGGTGGCAGG + Intronic
1017009164 6:150051332-150051354 ACTTAACTTTGGATGCTCCCTGG - Intergenic
1019911396 7:4102466-4102488 TCTTAGCTCTGGATGGAGGGGGG + Intronic
1020875192 7:13684785-13684807 TCCTAGCTTTGGGTGGTTGCTGG - Intergenic
1023850825 7:44149359-44149381 CCTTCACTTTGGGTGGGGGCAGG + Intronic
1025114920 7:56249369-56249391 TTTAAACTTTGTATGGTGTCTGG + Intergenic
1027582419 7:80015625-80015647 ACTTAGCTGAGGATGGTGGCGGG - Intergenic
1028433731 7:90777795-90777817 TTTTTACTTTGGATAGTGCCTGG - Intronic
1028460547 7:91087068-91087090 TCTTAGCTAGGGATGGTGGTAGG - Intronic
1031106933 7:117555280-117555302 TCTTTACTGTGAATGGTGCCAGG - Intronic
1035821505 8:2597452-2597474 ACTTAACTGGGCATGGTGGCGGG + Intergenic
1041366767 8:57114660-57114682 TTTTGAATTTGGATGGGGGCGGG - Intergenic
1041472842 8:58230464-58230486 GCTTAACTTAGAATGGTGGATGG + Intergenic
1043174046 8:77000967-77000989 GCTTAAGTTTGAATGATGGCAGG + Intronic
1044255145 8:90051269-90051291 TCATAACTTAACATGGTGGCAGG + Intronic
1044302592 8:90603293-90603315 TCATAACTTTTGGTGGTGGGGGG + Intergenic
1044321913 8:90811700-90811722 TCTCAACTTTGGTTTGTGTCTGG + Intronic
1045840915 8:106579617-106579639 TCTTAAGTCTGGATGGTGAAAGG - Intronic
1046719126 8:117599198-117599220 CCTTGACTTTCCATGGTGGCAGG - Intergenic
1046776328 8:118167734-118167756 TCTTAAATTGGGATGGTGGTGGG - Intergenic
1048467215 8:134675571-134675593 TCTTGAATTTGAATGTTGGCCGG - Intronic
1048936469 8:139361686-139361708 TCTTGTCTCTGGAGGGTGGCAGG - Intergenic
1056095811 9:83251991-83252013 TCCTGAGTTTGAATGGTGGCAGG - Intronic
1056624521 9:88243793-88243815 TGGTAGCTTTGGATGGAGGCTGG + Intergenic
1061022916 9:128028081-128028103 ACTTAACTGGGCATGGTGGCAGG + Intergenic
1061992356 9:134166340-134166362 TCTTTACTTTGGGTGGAGGTCGG + Intergenic
1188511156 X:30937918-30937940 TATTAACTGGGCATGGTGGCGGG - Intronic
1189755196 X:44264292-44264314 TCTTTTCTTTTCATGGTGGCTGG - Intronic
1189778360 X:44490546-44490568 AATTAACTGTGCATGGTGGCAGG - Intergenic
1191952113 X:66603820-66603842 TATTAACTTTGGATAGATGCTGG + Intronic
1193414450 X:81204671-81204693 TGTTAACTTATTATGGTGGCGGG + Intronic
1195524348 X:105869251-105869273 TCATACCTTTTGAGGGTGGCAGG + Intronic
1196090200 X:111732581-111732603 TCTTGACTTTGGATGGAGCTGGG + Intronic
1197291283 X:124661588-124661610 TCTTAACTTTGGATGGTGGCAGG + Intronic
1197683736 X:129415862-129415884 TCTTAACTTGGGCAGGTGGCTGG + Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199807313 X:151313118-151313140 TCTTAGCTGGGCATGGTGGCGGG + Intergenic