ID: 1197291375

View in Genome Browser
Species Human (GRCh38)
Location X:124662522-124662544
Sequence TAATTTGACAAAAGGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197291375 Original CRISPR TAATTTGACAAAAGGGCAGT TGG (reversed) Intronic
903309691 1:22444936-22444958 GAATTTGACCAAAGGGCATAAGG - Intergenic
904666692 1:32127483-32127505 CAATTTGTCAGAAGGGCTGTTGG + Intronic
905312355 1:37058618-37058640 TAATTGCACAAAAGGGAAATTGG - Intergenic
908376660 1:63549082-63549104 TACTTGGAGCAAAGGGCAGTAGG + Intronic
908464793 1:64382790-64382812 TAATTTGCCAAAAAGGCTGGTGG - Intergenic
908770343 1:67590350-67590372 CAATTTGAAAAAAAGGCACTTGG + Intergenic
909569726 1:77095564-77095586 CAATATGACAAAAGGGTAGGGGG + Intronic
910955570 1:92700004-92700026 TAATTTGACAAAAGAGGAAAAGG + Intronic
911278341 1:95892493-95892515 CAATTTAACAAAAGAGTAGTGGG - Intergenic
913381978 1:118221945-118221967 TAATTTGACCCATGGTCAGTTGG + Intergenic
917500327 1:175579531-175579553 GGATTTGACAGAAGAGCAGTGGG + Intronic
918118538 1:181517395-181517417 TACTTTAACCAGAGGGCAGTGGG + Intronic
918161837 1:181908422-181908444 TTATTTGATAAAAAGGGAGTAGG + Intergenic
923231051 1:231986765-231986787 TAATGTGACCACAGTGCAGTGGG + Intronic
1064846080 10:19655202-19655224 TAATTTGACCAAAAGACTGTGGG - Intronic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1066264159 10:33759075-33759097 TAATTAGTTAACAGGGCAGTTGG - Intergenic
1067540495 10:47147653-47147675 TACTTCAAGAAAAGGGCAGTTGG - Intergenic
1067655809 10:48190356-48190378 TCCTTTGACCAAAGGGAAGTAGG + Intronic
1067938163 10:50628766-50628788 TAATGGGGCAAAAGGGCACTTGG + Intergenic
1071093553 10:81947763-81947785 TAATATGACAAAAGTGCCGTCGG + Intronic
1071167238 10:82821258-82821280 TACACTTACAAAAGGGCAGTAGG - Intronic
1071369471 10:84936522-84936544 TAATGTGACCAATGGGCTGTGGG - Intergenic
1072242564 10:93510788-93510810 TCAATTGACAAAACTGCAGTAGG - Intronic
1072365660 10:94706024-94706046 TTATTTGGCAAAAGGGGAGGAGG + Intronic
1073895329 10:108149724-108149746 TTATATAGCAAAAGGGCAGTAGG - Intergenic
1074201583 10:111241091-111241113 TAATGTGACAAAGGGGTTGTTGG - Intergenic
1074635313 10:115309039-115309061 TAATTTGCCAAAAAATCAGTTGG + Intronic
1075878659 10:125829711-125829733 TTATTTGATGAAAGGGCAGGTGG - Intronic
1076168126 10:128298531-128298553 TATTTGGACAAAAGTGCATTGGG + Intergenic
1077833251 11:5898963-5898985 TAATTTGAAAAAATGGCTTTGGG + Intronic
1079662084 11:23051478-23051500 TAATTTGAAAAATGGGCAAGAGG + Intergenic
1079899669 11:26166672-26166694 TATTATGATAAAATGGCAGTTGG + Intergenic
1081270339 11:41075803-41075825 TGCTTTGACAACAGCGCAGTTGG - Intronic
1082291727 11:50383471-50383493 TAAATTTGCAAAAGGACAGTTGG + Intergenic
1085137091 11:74101273-74101295 TAATTTGACAAAGGTGCTTTTGG - Intronic
1086116675 11:83258719-83258741 ATATTTAAAAAAAGGGCAGTGGG - Intronic
1086794155 11:91079881-91079903 AAATTTGACAATAGGGTAATTGG - Intergenic
1086975828 11:93131692-93131714 TATTGAGACAGAAGGGCAGTAGG - Intergenic
1088124707 11:106410359-106410381 TTATTTGAAAAAAGTGCTGTAGG + Intergenic
1088164199 11:106912567-106912589 AAATTTGAGAAAACTGCAGTGGG + Intronic
1090455913 11:126849660-126849682 ACATTTGACTAAAGGGCGGTGGG + Intronic
1090661372 11:128884452-128884474 TAATTTGAAACAAAAGCAGTTGG - Intergenic
1093329578 12:17819018-17819040 TAACATGACAAAGGGACAGTTGG - Intergenic
1094042107 12:26129069-26129091 TAATTCTCCAGAAGGGCAGTAGG - Intronic
1095543276 12:43336237-43336259 TCATTTAATACAAGGGCAGTAGG + Intergenic
1095994328 12:48066984-48067006 AAATTTGACAAATGAGCAGGAGG + Intronic
1098628142 12:72698330-72698352 TAGTTTACCAAAAGAGCAGTAGG + Intergenic
1101709884 12:107255467-107255489 AAATTTTACAAAAGAGCAATAGG + Intergenic
1102995892 12:117350493-117350515 TACTTTGAGAAAATGGGAGTGGG - Intronic
1103251718 12:119505535-119505557 TAAAATTAGAAAAGGGCAGTTGG - Intronic
1104097021 12:125567228-125567250 CAAATTGAGAAAAGGGCAGAGGG - Intronic
1107382266 13:39869327-39869349 TGATTTAACAACAGGGCTGTGGG + Intergenic
1108404037 13:50081851-50081873 TACTTGGAGCAAAGGGCAGTCGG - Intergenic
1110085757 13:71377268-71377290 TAATTTGACCAAAGGGGATTTGG + Intergenic
1110355104 13:74558544-74558566 TAACTTGACAAAACAGCAGCTGG - Intergenic
1110591477 13:77267461-77267483 TACTTTAACAACAGTGCAGTTGG - Intronic
1110632032 13:77720176-77720198 AAATTTAAAAAAAGGGCAGTTGG + Intronic
1110880565 13:80567266-80567288 TAATTTCAGAAAATGCCAGTAGG + Intergenic
1111490290 13:88963589-88963611 TAATTTTAGAAAAGGGAAATTGG + Intergenic
1114853935 14:26414816-26414838 TAAGTTGGCAAAGGGGCAGGGGG - Intergenic
1115219106 14:31041630-31041652 TAATTTTAGAGAAAGGCAGTGGG - Intronic
1115228601 14:31132569-31132591 TAATTTGCCTAAATGGCAGTGGG - Intronic
1115831562 14:37348511-37348533 TAATATTACAGAAGGGGAGTGGG + Intronic
1117199918 14:53379325-53379347 TAATTTCACAAAATGGTACTGGG + Intergenic
1117778855 14:59211036-59211058 TATATTGACAAAAAGGCAATTGG - Intronic
1120087582 14:80292129-80292151 AAATTTTACAAAATAGCAGTAGG - Intronic
1121390604 14:93570283-93570305 CAATTTCAAAATAGGGCAGTTGG - Intronic
1126910287 15:53410169-53410191 TAATTTGAAAGAGAGGCAGTAGG - Intergenic
1129147323 15:73660398-73660420 TAATTTGACAAAATGGTTCTGGG - Intergenic
1129994164 15:79990527-79990549 TGATTTGAGAAATGGGAAGTGGG - Intergenic
1130688111 15:86056885-86056907 GATGTTGACAAAAAGGCAGTTGG + Intergenic
1131552566 15:93370242-93370264 TACTTTGGCAAAATGGCAGAAGG - Intergenic
1133708146 16:8375337-8375359 TCCTTTGGCAAAAGGGGAGTTGG - Intergenic
1134780846 16:16893996-16894018 TATTTTGACCAGAGGCCAGTAGG - Intergenic
1135249798 16:20891467-20891489 TATTTTGACAAATCGGAAGTTGG - Intronic
1136853644 16:33634910-33634932 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1141726248 16:85790788-85790810 TAACTTGTCACAAGGGCAATAGG - Intronic
1203115235 16_KI270728v1_random:1483355-1483377 TAATTTGACTGAGGGGCAGAAGG + Intergenic
1144233774 17:13236065-13236087 TAATTTTGCAAAAGCTCAGTGGG + Intergenic
1144597306 17:16581505-16581527 GAAAATTACAAAAGGGCAGTAGG + Intergenic
1146027856 17:29338292-29338314 TAATTGGAAGAAAGGGAAGTCGG + Intergenic
1147435162 17:40407310-40407332 AAATTTGACAAATTGCCAGTAGG - Intronic
1151858565 17:76740555-76740577 TAATTTGCCAAAAGTCCAGCTGG - Intronic
1151883965 17:76912390-76912412 TAATTTGAAAACAGGTCAATGGG + Intronic
1153860558 18:9200238-9200260 TAATTTGAAATCAGGCCAGTGGG + Intronic
1156128954 18:33944600-33944622 TACTTTGACAATAAAGCAGTTGG + Intronic
1157436343 18:47672668-47672690 TAATTTGACTAGAGGGCAGCAGG + Intergenic
1158325487 18:56309217-56309239 TAAGTGAAGAAAAGGGCAGTTGG + Intergenic
1164571406 19:29377205-29377227 TCATTTGTCAGCAGGGCAGTGGG - Intergenic
1166336638 19:42112216-42112238 TAAGTTGAAGAAGGGGCAGTGGG - Intronic
1166565570 19:43763510-43763532 GACTTTGACAGGAGGGCAGTGGG + Intergenic
1167637391 19:50662686-50662708 GAATGTGACAAGGGGGCAGTGGG + Intronic
1168301746 19:55408623-55408645 TTATGTGACAAATGGGCACTGGG + Intergenic
928995987 2:37291787-37291809 GAATTTGAGAAAAGGGAACTTGG + Intronic
929367225 2:41174534-41174556 TCATTTGAGAAAAAGGCAGCAGG + Intergenic
930541190 2:52708816-52708838 TGATTTGTCATAAGGGCAGGAGG + Intergenic
931523160 2:63121669-63121691 TACTTTAAAAAAGGGGCAGTAGG - Exonic
932860418 2:75285845-75285867 TAATTTGAAAAAGTGGAAGTGGG - Intergenic
933189880 2:79322740-79322762 TCATTTGACAAATGGGGACTGGG + Intronic
933270244 2:80225269-80225291 AAAGTTGAGAAAAGGGCAATCGG - Intronic
934877387 2:97937006-97937028 TTATTTGAAAACTGGGCAGTGGG - Intronic
937108672 2:119344221-119344243 TAATTTGCCTTAAGGACAGTGGG + Intronic
937528476 2:122799862-122799884 TTATTTGACAATAGGGTTGTTGG - Intergenic
939559827 2:143719299-143719321 TAATTAGACAAAAGTTCATTTGG - Intronic
942884555 2:180907609-180907631 TAAGTTGACAACATGCCAGTTGG + Intergenic
943562073 2:189476091-189476113 AAATTTTACAAAAGTGCATTAGG - Intergenic
943796200 2:191999291-191999313 TAAGTTGACAAAATGCAAGTTGG + Intronic
944430716 2:199630493-199630515 TTTTTAGACAAAAGGCCAGTGGG + Intergenic
944767940 2:202883769-202883791 GAATTTTAGAAAAGGGAAGTAGG + Intronic
945426966 2:209717756-209717778 TTAAATGACAAAAGGGCAATGGG + Intronic
945506633 2:210649926-210649948 TGCTTTGACAACAGAGCAGTAGG + Intronic
946149407 2:217754031-217754053 TGATTTAACAAAATGGCATTGGG + Intronic
947113375 2:226743882-226743904 TAATTAGACAAAAGGGAATCAGG + Intronic
1170007206 20:11682353-11682375 CAATGTGTCAAAAGGGCACTAGG + Intergenic
1170135768 20:13072119-13072141 TATTTTGAGCAAAGGTCAGTAGG - Intronic
1170192685 20:13659649-13659671 TAATTTGAGAAAAGGAGACTAGG + Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1173915302 20:46703460-46703482 TAATTTAACAGAAGCACAGTTGG - Intergenic
1174690618 20:52500697-52500719 TAATTTGTCAAATGCGCAATGGG - Intergenic
1175684846 20:61021379-61021401 AACTTGGACAAAAGGCCAGTCGG + Intergenic
1176116344 20:63433136-63433158 TTGTTTTACAAAAGGGCAGGTGG - Intronic
1177362983 21:20098511-20098533 TAAGTTGACAAATGAGAAGTTGG - Intergenic
1179519260 21:41931733-41931755 TATGCTGACAAAAGGGCTGTTGG + Intronic
1179926430 21:44537567-44537589 TAACTTTAAAAAAGGACAGTTGG + Intronic
1179943872 21:44657496-44657518 TCATTTGAAAAACAGGCAGTGGG + Intronic
1183199388 22:36375350-36375372 TCATTTGAAAAATGGCCAGTGGG + Intronic
1184531013 22:45055721-45055743 TGATGTGGCAAAAGGGCGGTAGG - Intergenic
1184948913 22:47825858-47825880 TTGTTTTACAAAAGGGGAGTTGG - Intergenic
950795272 3:15505512-15505534 TAATTTGACCAAATGGCATGTGG + Intronic
954025558 3:47780808-47780830 TATTTACACAAAAGGGAAGTTGG + Intronic
955650285 3:61186683-61186705 TCATTTGACAAAAGGTTAGATGG - Intronic
956015235 3:64875390-64875412 TAAAATAACAAAAGGGCAGAGGG + Intergenic
959638685 3:108605952-108605974 TAATTTTACAAAAGTTCACTAGG + Intronic
960159821 3:114338422-114338444 TGATTTCATAAAAGGGCTGTGGG - Intronic
961217128 3:125168300-125168322 TAATTGGTGGAAAGGGCAGTGGG + Intronic
964409786 3:156386083-156386105 TAATTTGACAAAGGGGCATAAGG + Intronic
967948777 3:194824455-194824477 CAATTTGGCAGAAGTGCAGTGGG + Intergenic
970435977 4:16036145-16036167 TTATTTTAGAAAAGGGCACTTGG - Intronic
972034343 4:34502518-34502540 TAATTTGAAAAAAAGGTTGTAGG - Intergenic
972082962 4:35176623-35176645 TAATTTGACTGAAGCACAGTAGG - Intergenic
972163182 4:36250028-36250050 TTTTTTAAAAAAAGGGCAGTAGG - Intergenic
973608413 4:52610319-52610341 TCATTAGTCAAAAGGGCAGGTGG - Intronic
974211613 4:58783941-58783963 TAATTTTACTAAAGAGCATTTGG + Intergenic
974974488 4:68873263-68873285 TAATTTGACAAAAGAGAATGTGG - Intergenic
975588207 4:75972482-75972504 TTATTTCAGAATAGGGCAGTGGG - Intronic
977066690 4:92326121-92326143 TAATTTTATAAAAGAACAGTTGG - Intronic
977559735 4:98520160-98520182 GAATTAGATAAAAGGGCAGCAGG + Intronic
978642124 4:110882965-110882987 TAGTTTCACAAAAGAGCACTTGG + Intergenic
979561579 4:122107774-122107796 TATGTTAAGAAAAGGGCAGTGGG + Intergenic
982118663 4:152118489-152118511 TGATTGGACAAAAGGGAAATGGG - Intergenic
983067423 4:163227490-163227512 GAATTTGACCAAGGGGCAGAAGG - Intergenic
983651069 4:170037281-170037303 TCATAAGATAAAAGGGCAGTGGG - Intergenic
984958914 4:185075105-185075127 TCATTTGAAAATAGGGTAGTTGG + Intergenic
986066615 5:4240618-4240640 TAATTTGACGGAGGGGCAGAAGG - Intergenic
987646038 5:20673248-20673270 TAAAATGTCAAAAGGGCAATTGG + Intergenic
988829685 5:34975547-34975569 TGCCTTGACAAAAGGGCTGTGGG + Intergenic
988917391 5:35908589-35908611 TAATTTGGGGAAATGGCAGTTGG + Intronic
992901974 5:81305789-81305811 TAATTTGAAAAAGGGGCTATTGG - Intronic
993356474 5:86915135-86915157 CAAAATGAGAAAAGGGCAGTAGG + Intergenic
993375003 5:87140501-87140523 CAAATGGATAAAAGGGCAGTAGG + Intergenic
993630555 5:90281229-90281251 TAATGTTATAAAGGGGCAGTGGG + Intergenic
994838240 5:104885566-104885588 TAATTTAACAAAAAAGCAATAGG + Intergenic
995558749 5:113358036-113358058 GAATTTGACCAAAGGGCATAAGG - Intronic
999793418 5:154965046-154965068 GAAGTTAATAAAAGGGCAGTAGG + Intronic
1000008344 5:157208611-157208633 CCATTTGTCACAAGGGCAGTGGG + Intronic
1000787001 5:165557415-165557437 TAATATGATAAAAGGTCAGCTGG - Intergenic
1006606673 6:35262365-35262387 CAACTTGAGAAAATGGCAGTAGG - Intronic
1007332697 6:41126037-41126059 TACTTTGATAAAAGAGGAGTTGG + Intergenic
1008125402 6:47662739-47662761 TATTTTGCCAACAGTGCAGTGGG - Intronic
1008264450 6:49407171-49407193 TAATTTCATGAAAGGGCAGCAGG - Intergenic
1010162550 6:72874582-72874604 TTATTTGACAAAAGGCCTTTTGG - Intronic
1011970206 6:93212802-93212824 GAATTTGAGAAAAGGGCAGGAGG + Intergenic
1012431828 6:99172046-99172068 TAATTGGGCAGAAGGGCAGTGGG + Intergenic
1013626081 6:111938346-111938368 TAATTTGCCAAAAAGAAAGTAGG - Intergenic
1013820707 6:114150429-114150451 TATTTAGTCAAAAGGGCAGCTGG - Intronic
1014318946 6:119901814-119901836 GAATATGACAAAAGTGCAGTTGG + Intergenic
1014591837 6:123282958-123282980 TAATTTGGTATAAGAGCAGTAGG + Intronic
1014693539 6:124591099-124591121 TAATTTCTCACAAGGGAAGTTGG - Intronic
1015217235 6:130763986-130764008 CAATTTAAGAAAAGGGCAGCAGG + Intergenic
1016363218 6:143290160-143290182 TAATTTGACCAAGGGGCATAAGG + Intronic
1018730728 6:166648485-166648507 TCATTTGACAAACAGGCAGCTGG + Intronic
1020855989 7:13423501-13423523 AAATTTAACAAAAGGACACTAGG + Intergenic
1021630847 7:22646193-22646215 TTATTTTAAAAAAGGTCAGTGGG - Intergenic
1022064830 7:26841873-26841895 TGATTTGACAAAAGGCCTTTTGG + Intronic
1026630157 7:72031030-72031052 TCATTTGTCAAATGGGCAGCAGG - Intronic
1027509587 7:79063072-79063094 TAATTTGCAAAAATGGCAATAGG + Intronic
1027992543 7:85380835-85380857 TAATCTTACAAAAGGGCTGAAGG - Intergenic
1028129586 7:87153461-87153483 CAATTGCACAAAAGGGCACTTGG - Intronic
1028745921 7:94326777-94326799 TAATTTTTCAAAAGGGCATCAGG + Intergenic
1030298494 7:107952532-107952554 TAATTTTAAAAAATGCCAGTGGG + Intronic
1030855310 7:114548589-114548611 TAATGTGACTAAAGTTCAGTGGG + Intronic
1031667246 7:124499701-124499723 AAGTTTGACAGAAGGGAAGTGGG + Intergenic
1032325801 7:130927148-130927170 TGCCTTGACAGAAGGGCAGTAGG - Intergenic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1033713511 7:143974990-143975012 GAATTTGAAGAAAGTGCAGTTGG - Intergenic
1034290582 7:149927978-149928000 TAATTTTACAAATTGGCAATAGG + Intergenic
1034660490 7:152764855-152764877 TAATTTTACAAATTGGCAATAGG - Intronic
1039668903 8:39573436-39573458 TAATTTTACAAAAGGACTATGGG + Intergenic
1040631291 8:49215434-49215456 TAATTATACAAAAAGGCAGAAGG - Intergenic
1043082312 8:75782345-75782367 AAATTTGAAATAAGGGCAGAGGG - Intergenic
1043450961 8:80366252-80366274 TAATTTTACTAAAGGGCAAATGG + Intergenic
1044297308 8:90544018-90544040 TATATTGATGAAAGGGCAGTGGG + Intergenic
1044847263 8:96394336-96394358 TCATTAGATAAAAGGGTAGTGGG + Intergenic
1045362146 8:101442628-101442650 TAGTTTGAGAAAAGGGGAGGTGG - Intergenic
1045566017 8:103316354-103316376 ACATTTGACAGAAGGGCAGATGG - Intronic
1048829522 8:138462679-138462701 TCATTTGAAAAAAAGGGAGTTGG + Intronic
1050139923 9:2506994-2507016 TAATTAAACAAAAGAGCAGAAGG + Intergenic
1055011849 9:71575511-71575533 TAATTTGACAAAAGTACTGATGG - Intergenic
1060616937 9:125025404-125025426 TAATTTGACAAAAGGGAAATTGG - Intronic
1186168086 X:6848362-6848384 TAATTTGAAAATAGGTCTGTGGG + Intergenic
1187705668 X:22007093-22007115 TAATTTGTTAAAGGGGCAATAGG - Intergenic
1189444663 X:41069278-41069300 TAATTTGACTTAAGGGCAGGGGG + Intergenic
1193093523 X:77521327-77521349 AAATTTAAAAAAATGGCAGTAGG + Intronic
1193713309 X:84904758-84904780 TAATCTGACAAAAGGCCACATGG - Intergenic
1194094265 X:89618081-89618103 ATATTTGACAAAAGTGAAGTAGG - Intergenic
1194949335 X:100106330-100106352 TAATTTCACAAAGAGGCAGAAGG + Intergenic
1195613743 X:106896458-106896480 CCATTTGGCAAAAGGGAAGTGGG + Intronic
1196165120 X:112530331-112530353 ACACTTGACATAAGGGCAGTAGG - Intergenic
1197291375 X:124662522-124662544 TAATTTGACAAAAGGGCAGTTGG - Intronic
1197326023 X:125094478-125094500 GAATTTGTCAAAGTGGCAGTGGG - Intergenic
1199048369 X:143205181-143205203 TAAGTTGACTAACAGGCAGTTGG - Intergenic
1200446900 Y:3274261-3274283 ATATTTGACAAAAGTGAAGTAGG - Intergenic