ID: 1197294940

View in Genome Browser
Species Human (GRCh38)
Location X:124707431-124707453
Sequence AATCATGTGAAACTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 33, 2: 44, 3: 62, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197294940_1197294947 28 Left 1197294940 X:124707431-124707453 CCAGGCAGCAGTTTCACATGATT 0: 1
1: 33
2: 44
3: 62
4: 181
Right 1197294947 X:124707482-124707504 TAATAGGATTTGAACCAAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 173
1197294940_1197294944 12 Left 1197294940 X:124707431-124707453 CCAGGCAGCAGTTTCACATGATT 0: 1
1: 33
2: 44
3: 62
4: 181
Right 1197294944 X:124707466-124707488 CTATTAAGACCCTGAATAATAGG 0: 1
1: 0
2: 0
3: 16
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197294940 Original CRISPR AATCATGTGAAACTGCTGCC TGG (reversed) Intronic
901410881 1:9083362-9083384 AGTCATGCAAAACTGCTGCCTGG - Intronic
901766780 1:11505158-11505180 AATCACCTGAAAATACTGCCAGG - Intronic
901837759 1:11935156-11935178 AATCATGCCTAACTGATGCCTGG - Intronic
901939752 1:12652939-12652961 AGTCATGTGAAACCGCTGCCTGG + Intronic
901940470 1:12657949-12657971 CATTGTGTGAAACTGCTGCCTGG + Intronic
902579802 1:17401261-17401283 AATCAAGGGGACCTGCTGCCTGG + Exonic
903955375 1:27021862-27021884 AGTCATGTGAAACTGCTGTCTGG - Intergenic
903956218 1:27027872-27027894 AGTCATGTGAAACTGCTGCCTGG - Intergenic
904111876 1:28132459-28132481 AGTCATGTGAAACTGCTGCCTGG + Intergenic
907646983 1:56254158-56254180 AGTCATGTGAAACTGCTGCCTGG + Intergenic
908416836 1:63921493-63921515 GATCATGTTAAACTGGGGCCTGG - Intronic
908927797 1:69277402-69277424 AATCAAGTCAAACTGCAGCCTGG + Intergenic
909081503 1:71118009-71118031 CATCATGTTAAACAGCTGCTTGG + Intergenic
909440475 1:75690521-75690543 AGTCATGTGAAACTCCTGCTTGG - Intergenic
909796327 1:79741679-79741701 AATAATGTGATTCTGCTACCAGG - Intergenic
910253625 1:85223791-85223813 AGTCATGTGAAACTGCTGCCTGG + Intergenic
910423389 1:87094696-87094718 GATGATGTTAAAATGCTGCCTGG - Intronic
916461667 1:165031086-165031108 AATTATATCAAACTGCTGCCTGG - Intergenic
916489108 1:165285880-165285902 AGCCATGTGACACTGCTCCCTGG + Intronic
919640888 1:200042493-200042515 AATCAGAGGAAACTTCTGCCCGG + Intronic
921546958 1:216484465-216484487 AGTCATGTGCAACTGCTACCTGG - Intergenic
923206739 1:231766327-231766349 AATCAAGTGAAAATTCTGCCAGG + Intronic
924043440 1:240005979-240006001 AATCATGGCTAACTGCAGCCTGG - Intergenic
1063864485 10:10349543-10349565 GAGTATGTGAAACTGCTGTCTGG - Intergenic
1065442073 10:25763060-25763082 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1066979005 10:42394160-42394182 AATCAAGTAAAACAGATGCCAGG + Intergenic
1070042144 10:72792416-72792438 AAGAATGTTAAACTGCTTCCTGG + Intronic
1071218389 10:83433865-83433887 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1073206224 10:101770811-101770833 AACCATGTGTCACTGCTGCCTGG - Intronic
1073317834 10:102595341-102595363 GAACATTTCAAACTGCTGCCAGG + Intronic
1073348386 10:102801689-102801711 AACCAGGGGAAACTGATGCCTGG - Intronic
1073986485 10:109215514-109215536 AGTGATGTGGAACTGCTGCCTGG + Intergenic
1075968500 10:126633131-126633153 AATCATGTGATAAAACTGCCTGG + Intronic
1077442161 11:2573922-2573944 AGCCATGAGAAACTGCTGCTGGG - Intronic
1079631405 11:22681528-22681550 AATCATGTTAAAGTCCTGACCGG - Intronic
1079914635 11:26353408-26353430 AGTCATGTGGAACTGCTGCCTGG + Intronic
1080722083 11:34859647-34859669 AATGTTGTGAAACTCCTGTCTGG + Intronic
1083945926 11:65922561-65922583 AATCATGGCTCACTGCTGCCTGG - Intergenic
1084304856 11:68275485-68275507 AGTTATGTAAAACTGCTGCCTGG - Intergenic
1085335430 11:75690184-75690206 AGTCATGTAAAACTGCTGCCTGG - Intergenic
1085495311 11:76963666-76963688 AGTCATGTGAAATTGCTGCCTGG + Intronic
1086009135 11:82077495-82077517 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1087098233 11:94340138-94340160 AGTCATCCGAAACCGCTGCCTGG + Intergenic
1088967511 11:114738531-114738553 AATTATGTGAAACTCAGGCCTGG + Intergenic
1090306436 11:125695170-125695192 AATCATGTGAATATGTTCCCAGG - Intergenic
1094568217 12:31618903-31618925 AGGCATGTGAAACTGCTGCCTGG + Intergenic
1095460945 12:42443780-42443802 AATCTTGAGAAACTGCTGCGGGG - Intronic
1095698307 12:45165134-45165156 ACTCATGTGAAAATGCTGTGTGG + Intergenic
1095746665 12:45666933-45666955 GCTCATGTGAAACTACTGCCTGG + Intergenic
1096031634 12:48421384-48421406 AACCATGAGAAACTGCCCCCAGG + Intergenic
1097794797 12:63850067-63850089 CACCCTGTGAAGCTGCTGCCTGG - Intronic
1099946256 12:89248049-89248071 AATCATGTGATACTACTTCTTGG - Intergenic
1100363617 12:93899601-93899623 AGGCATGTGAAAATACTGCCTGG - Intergenic
1100758419 12:97777780-97777802 AGTCATGTGAAACTGCTGTCTGG + Intergenic
1101674416 12:106904565-106904587 GATCATGTGAACCTTTTGCCAGG - Intergenic
1102091841 12:110196920-110196942 AGTCATGAGCAACTGCTGCCTGG - Intronic
1103093817 12:118117195-118117217 AGTCATGTGAAACTGCCACCTGG - Intronic
1104881871 12:132077441-132077463 GATCATCTGCACCTGCTGCCCGG - Exonic
1105585520 13:21739330-21739352 AATCATGGCAAACTGCTACCTGG + Intergenic
1106971239 13:35144548-35144570 AGTCATGCGAAACTGCTGCCTGG + Intronic
1108464402 13:50700439-50700461 AATCAAGTGAGACTACTGCCAGG + Intronic
1109153547 13:58874690-58874712 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1111279983 13:86009945-86009967 AGTCATGTGAAACTACTGCCTGG - Intergenic
1111825582 13:93263298-93263320 AGTCATGTGAAATTGCTGCTTGG + Intronic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112347666 13:98604186-98604208 AGGCATGTGACACTACTGCCTGG + Intergenic
1112526688 13:100155324-100155346 AATGAACTGAAACTGCTCCCTGG - Intronic
1115670827 14:35609860-35609882 AATCATGGGTCACTGCAGCCTGG - Intronic
1116347335 14:43811596-43811618 AATCTTCTGGAACTGCTTCCAGG + Intergenic
1117746659 14:58876304-58876326 AGTGCTGTGAAACTGCAGCCTGG + Intergenic
1118564313 14:67123026-67123048 TATCATGCAACACTGCTGCCTGG + Intronic
1120203085 14:81559715-81559737 AAACATGAGAAACCGCTGCCAGG + Intergenic
1121992523 14:98573599-98573621 CATAATGGGAAACTACTGCCTGG + Intergenic
1124180506 15:27468587-27468609 CATGATGTGAAACTACTGCCTGG + Intronic
1124187876 15:27545621-27545643 AATGCAGTGAAACTGCAGCCAGG - Intergenic
1125972926 15:43926758-43926780 AGTCATGTGAAACTGCTGTCTGG - Intronic
1126257787 15:46648344-46648366 ACTCAAGTGTAACTGCTGGCTGG - Intergenic
1126727956 15:51652255-51652277 AGTCATATGAAATTGTTGCCTGG - Intergenic
1126844591 15:52746951-52746973 AGCCATGCGAAACTACTGCCTGG + Intergenic
1128902615 15:71438341-71438363 AAAAATGTGAAACTTCTGCATGG - Intronic
1130402403 15:83569605-83569627 ACTCATTTGACACTGTTGCCAGG + Intronic
1132823257 16:1888169-1888191 AATCATGGGTCACTGCAGCCTGG - Intergenic
1133361444 16:5177064-5177086 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1133402006 16:5494977-5494999 AGTCACGTAAAACTGATGCCTGG - Intergenic
1134379581 16:13711501-13711523 AGACATGTGAAACTGCTGTCTGG + Intergenic
1135601574 16:23788265-23788287 AGCCATGTGAAAGTGCTGCCTGG + Intergenic
1136187804 16:28598255-28598277 GGTCATGTGAAACTGCTGCCTGG - Intergenic
1136190277 16:28611249-28611271 CCTCATGTGAAACTGCTGCCTGG - Intronic
1137035492 16:35566158-35566180 AGTAATGTGAAACTCCTTCCTGG - Intergenic
1141042048 16:80681211-80681233 AATGCTGTGCAACTGCAGCCAGG + Intronic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1143181016 17:4984243-4984265 AAGAATCTGAAACTCCTGCCAGG - Intronic
1143535116 17:7533856-7533878 AGTCATGTGAAAATGCTGCCTGG - Intergenic
1144793985 17:17878684-17878706 TATCATGAGAAACTCATGCCAGG + Intronic
1144941455 17:18944877-18944899 AATAATGTCAAAATGCAGCCTGG + Intergenic
1146651693 17:34611070-34611092 AGTCATGTGAAACTGCTGCCTGG + Intronic
1150610221 17:66727616-66727638 AGTCCCGTGAAACTGCTGCCTGG + Intronic
1151192856 17:72411336-72411358 AATGAGGTGACACAGCTGCCAGG - Intergenic
1151599628 17:75098264-75098286 AATCTTCTGGAACTGCTGGCTGG + Intronic
1203164385 17_GL000205v2_random:80390-80412 GATGATGTGAATCTTCTGCCTGG - Intergenic
1153060295 18:987849-987871 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG + Intergenic
1153848974 18:9075830-9075852 AATCATGTTTCACTGCAGCCTGG + Intergenic
1154339281 18:13489660-13489682 AGTTATATGAAACTGTTGCCTGG + Intronic
1155584492 18:27349321-27349343 AGTAATGTGAAAATGCTGCCTGG - Intergenic
1156578148 18:38343544-38343566 AATCTTGGGAAACTGTTTCCAGG - Intergenic
1157265974 18:46222142-46222164 AATCATTTAAAGCTGATGCCTGG - Intronic
1158746919 18:60211302-60211324 AATCCTGTAAAAATACTGCCTGG - Intergenic
1159276018 18:66222568-66222590 AGTCATGTGAAACTGCTGCTTGG - Intergenic
1162032078 19:7921832-7921854 AATCATGTGAACCTGGGTCCTGG + Intronic
1164040636 19:21489700-21489722 GGTGATGTGACACTGCTGCCTGG + Exonic
1164201635 19:23023998-23024020 AATGATGTGACTCTCCTGCCTGG - Intergenic
1164206932 19:23067012-23067034 GATGATGTGACACTGCTGCCTGG - Intergenic
1165143607 19:33717801-33717823 TGTCATATGAAACTACTGCCTGG + Intronic
1167334895 19:48878851-48878873 GGTCTTGTGAAACTGCTGCCTGG + Intergenic
1167585577 19:50373293-50373315 AGTCATGTGAAACTGCTGCCTGG + Intronic
1168529753 19:57118447-57118469 AGTCATGTGAAACTGTTGCCTGG - Intergenic
928482743 2:31698864-31698886 AATCAAGTGGAGCTGCTGACTGG - Intergenic
929080412 2:38116765-38116787 AGTCTTGTGAAGGTGCTGCCTGG + Intergenic
929938331 2:46311229-46311251 AAAACTGGGAAACTGCTGCCTGG + Intronic
929978349 2:46656271-46656293 ATGGCTGTGAAACTGCTGCCTGG - Intergenic
930258508 2:49118538-49118560 GGTCATTTGAAACTGCTGCCTGG - Intronic
930261445 2:49151533-49151555 AATGAAATGAAACTGCTGCAAGG + Intronic
930769619 2:55118480-55118502 TATCATGTGAAACTTCTTCCTGG - Intergenic
932076082 2:68664126-68664148 AGTCATGTGAAACTGCTGCCTGG + Intergenic
934572112 2:95379383-95379405 AGTCATCTGAACCTGTTGCCCGG + Intronic
935159317 2:100515553-100515575 AGTCATTTTAAACTGCTGGCCGG - Intergenic
937281771 2:120722296-120722318 AGTCAGGTGACACTCCTGCCTGG + Intergenic
937577677 2:123443877-123443899 AGTAATGTGAAACTACTGTCTGG + Intergenic
938801810 2:134770776-134770798 TGTCATGTGAAACTGCTGCCTGG - Intergenic
941988226 2:171529234-171529256 AGACACGAGAAACTGCTGCCAGG + Intronic
942773461 2:179551347-179551369 AAACATGTGAAACTGCTGTCTGG - Intronic
943620572 2:190143201-190143223 AGTCATGTGTAACTGCTGCCTGG + Intronic
945735800 2:213598782-213598804 TGTCATGTGAAACTGCTGCCTGG - Intronic
946295265 2:218778875-218778897 AGTTGTGTGAAGCTGCTGCCTGG + Intergenic
946948779 2:224849900-224849922 AGGCATGTGAAACCTCTGCCTGG - Intronic
947373247 2:229469644-229469666 AATAATGTCAAAGTGCTGGCCGG + Intronic
948084822 2:235238714-235238736 AGTCAGGGGAAACAGCTGCCTGG - Intergenic
1169595998 20:7199306-7199328 AATCTTTAGAAAATGCTGCCAGG - Intergenic
1170310839 20:14989867-14989889 AGTCATGTGAAACTGCTGCCTGG + Intronic
1170522940 20:17207075-17207097 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1171234342 20:23512237-23512259 ACTCAGGTGAAAATGCTGCCTGG + Intergenic
1171237206 20:23536657-23536679 AGTCATGCAAAACTGCTGCCTGG + Intergenic
1171331062 20:24339302-24339324 CAGCATGTGGAACTGCTTCCTGG - Intergenic
1172200120 20:33119820-33119842 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1172914126 20:38431098-38431120 AGTCATGTGACACTCCTGCAGGG + Intergenic
1174114827 20:48219692-48219714 AATCATGTGATCCTCCTGCTCGG - Intergenic
1175609671 20:60340179-60340201 AATCATGCGACACTGCTGCCTGG + Intergenic
1177730089 21:25017430-25017452 AGTCATGCAAAACTGCTGCTTGG + Intergenic
1177929892 21:27267668-27267690 AGTCGTGTGAAATTGCTGCCTGG + Intergenic
1178572990 21:33758187-33758209 AATCATGGTTCACTGCTGCCTGG + Intronic
1179614422 21:42572636-42572658 AATCATGTGAAATTGATAACAGG + Intronic
1180196424 21:46197591-46197613 AAAACTGAGAAACTGCTGCCGGG + Intronic
1182385593 22:29937947-29937969 AGTCATGTAAAATTGCTGCCTGG - Intronic
1183172359 22:36197746-36197768 CATTATGTGAACCTGCTGCCTGG - Intronic
1183180904 22:36259015-36259037 TGTCATGTGAACCTGCTGCCTGG + Intronic
950244351 3:11402097-11402119 AGTCATGTGAAACTGCTGCCTGG - Intronic
950250783 3:11463550-11463572 AATCATTTAAAAATGATGCCAGG - Intronic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
951428161 3:22573883-22573905 TTTCATGTTAAACTGCTTCCAGG + Intergenic
953070659 3:39516261-39516283 GAGCATGTGAAAGTGCTGCGGGG + Intronic
954893664 3:53956766-53956788 AACCATGTGCAAATGCTGCCTGG - Intergenic
956927945 3:74009652-74009674 AACCACGTAAAACTGATGCCTGG - Intergenic
957443213 3:80280244-80280266 AATTATGTGATACTGAGGCCTGG + Intergenic
958525927 3:95258932-95258954 AGTCATGTGAAATTGCTGCCTGG + Intergenic
958944501 3:100348488-100348510 AGTCATATGAAACTGCTGCCTGG + Intronic
959992636 3:112645653-112645675 AGTCATGTGAAACTGCTGCTTGG + Intronic
961243506 3:125432391-125432413 AGTCATGTGAAATTGCTGCCTGG - Intergenic
961829151 3:129614501-129614523 CATCTTTTGAAACTGCTGCTGGG + Intergenic
963555608 3:146783442-146783464 AGTCATGTGAAACTGCTGCCTGG + Intergenic
964357456 3:155863693-155863715 AGTTACGTGAAACTGCTGCCTGG + Intergenic
964450170 3:156804722-156804744 TATAAGGTGAAAGTGCTGCCAGG + Intergenic
965034655 3:163423056-163423078 CAGCTTGTGAAAATGCTGCCAGG - Intergenic
970729442 4:19085886-19085908 AATTCTGTGAAAATGCTGCCTGG + Intergenic
970856807 4:20658608-20658630 AATCATGTGAAAAGGCTGGGAGG + Intergenic
971421401 4:26476988-26477010 AGTCATGGGAAACTGCTGCCTGG - Intergenic
972956192 4:44395288-44395310 AATCATGTGAAACTGCTTCCTGG - Intronic
974061870 4:57042642-57042664 AACCATTTGAAACTGCAGGCCGG - Intronic
975433583 4:74323788-74323810 AGTTATGTAAAACTGCTGCCTGG - Intergenic
975485245 4:74928194-74928216 AGTCATGCAAAACTGCTGTCTGG - Intergenic
975851166 4:78574001-78574023 AGTCATGTGAAACTGCTGCCTGG + Intronic
976928364 4:90530835-90530857 AGTCACATGAAACTGCTGCCTGG + Intronic
976952843 4:90854491-90854513 ACTCATGTGCAACTGCTTTCAGG + Intronic
977357538 4:95966511-95966533 AGTCATGTGAAACTGCTCCCTGG - Intergenic
979627512 4:122861917-122861939 AATCATTTGTCACTGCTTCCAGG + Intronic
980082101 4:128355039-128355061 AATCATGTGGAATAGGTGCCAGG - Intergenic
980883444 4:138738054-138738076 AATGATGTGAACATGCTACCTGG - Intergenic
981527859 4:145724526-145724548 AATCAGGGGAAACTGCTGAAAGG - Intronic
982201961 4:152970366-152970388 AATCATGTAGAACTCCTGCCCGG + Intronic
982512190 4:156297078-156297100 AGTCATGTGAACCTGTTGCCTGG - Intergenic
982665066 4:158251474-158251496 AGTCATGTGAAACTGCTGCCTGG - Intronic
983866130 4:172768853-172768875 AGACATGTGAAACTGCTGCTTGG + Intronic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
984314428 4:178108935-178108957 AATCGTGTGTCACTGCTGCCAGG + Intergenic
988585388 5:32503500-32503522 AGTCCTGTGAAACTGCTGTCTGG - Intergenic
988803145 5:34715468-34715490 AGTCATGTGAAACTCCTGCCTGG + Intronic
989841090 5:46071329-46071351 CATTATGAGAAACTGCTTCCTGG + Intergenic
992667232 5:79022359-79022381 TATAATGTGAAACGGATGCCTGG - Intronic
993186468 5:84628545-84628567 ACTCATGTGAATAGGCTGCCTGG + Intergenic
993975392 5:94473257-94473279 AATCCTTTCAAACTGCTGACTGG - Intronic
995130312 5:108623137-108623159 AGTCATGTGAAACTGCTGCCCGG + Intergenic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
996502128 5:124229425-124229447 AGTCATATGAAATTTCTGCCTGG - Intergenic
997111454 5:131079426-131079448 AAACAGGTCAAACTGCTGCTTGG + Intergenic
998019454 5:138757150-138757172 GATCATGTCACACTGCAGCCTGG + Intronic
998941388 5:147286540-147286562 AGTCATGTGAAACTGCTGTCTGG + Intronic
998987046 5:147770670-147770692 ATTCCTGTGAAACTGCTCTCTGG + Intronic
1000352388 5:160362126-160362148 AATCATGTCAAATTGCTGCCTGG - Intronic
1000581719 5:163041806-163041828 TCTCATGTGAAAATGCTGCAGGG + Intergenic
1000871524 5:166583016-166583038 AGGCATGTGAAACTGCTGCCTGG + Intergenic
1002687109 5:181021357-181021379 GATCACGTGGAACTGCTGACTGG - Intergenic
1004091595 6:12508322-12508344 TATCATGAAAAGCTGCTGCCTGG + Intergenic
1004139249 6:13000480-13000502 AATCATGTCTCACTGCAGCCTGG - Intronic
1004398289 6:15265742-15265764 AAGCAAGTGAACATGCTGCCCGG - Intronic
1004988698 6:21112934-21112956 AATCAGTTCAAACTGATGCCTGG + Intronic
1005357553 6:24999134-24999156 AGTTATGTGAAACTGCTGCCTGG - Intronic
1005651403 6:27888532-27888554 AGTCATGTGAAACTACTGCATGG + Intergenic
1006962266 6:37945238-37945260 AGTCATGTGAAACTGCTGCCTGG + Intronic
1007919826 6:45596660-45596682 AATCATCTCCAGCTGCTGCCGGG + Intronic
1008458037 6:51734735-51734757 AATCAAGTGAAACTTCTGTTTGG - Intronic
1009331997 6:62434860-62434882 AATCTTGGGAAACTGCTTCCAGG - Intergenic
1009967248 6:70590649-70590671 AATCATGTAAAACTGCTGCCTGG + Intergenic
1010136542 6:72560968-72560990 AGTCATGTGCAATTGCTGCCTGG - Intergenic
1012147701 6:95707194-95707216 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1014382301 6:120757727-120757749 AATCAGATGAAACTACTGTCTGG - Intergenic
1014498923 6:122162643-122162665 AATCATGTGACACTCATACCAGG + Intergenic
1015865563 6:137723169-137723191 AATCATGGGAAACAGCTGGAAGG - Intergenic
1016753939 6:147662776-147662798 AATCATTTCAATCTGCTGTCAGG + Intronic
1017349475 6:153422530-153422552 AGTCATCTGAAACTGCCACCTGG + Intergenic
1017372944 6:153735153-153735175 TGTCATGTGGAACAGCTGCCTGG + Intergenic
1018281103 6:162186657-162186679 ACTCATGAGAAACTGCTCCCAGG - Intronic
1018325171 6:162659971-162659993 AACCCTGTGAAACTTATGCCAGG + Intronic
1019696806 7:2450831-2450853 AATCATGGGAAACTCCCGTCAGG + Intergenic
1020426573 7:8073073-8073095 AATCATGTCACTCTCCTGCCAGG + Intronic
1020515974 7:9119361-9119383 AGTTACATGAAACTGCTGCCTGG + Intergenic
1021069144 7:16215552-16215574 AATCATTTGAAAGCACTGCCTGG - Intronic
1022552488 7:31254500-31254522 AGTCGTGTGAAACTGCCGCCTGG - Intergenic
1023731484 7:43196097-43196119 AGTCATGTGAAACTGCCGCCTGG + Intronic
1024982837 7:55171984-55172006 GATCATGTGACACTGGTGGCAGG - Intronic
1025033550 7:55576135-55576157 AGTCATGTGAAACTGCTCCCTGG + Intergenic
1025058392 7:55783842-55783864 AATAATGTGCAACTCCAGCCTGG - Intergenic
1025156948 7:56615501-56615523 AATAATGTGACTCTTCTGCCTGG - Intergenic
1025722484 7:64029010-64029032 AATAATGTGAAACTCCTTCCTGG - Intergenic
1025744002 7:64226900-64226922 AGTAATGTGAAACTCCTTCCTGG - Intronic
1025751592 7:64298562-64298584 AATGATGTGACTCTTCTGCCTGG - Intergenic
1027913679 7:84285871-84285893 AATCATGTCTCACTGCAGCCTGG - Intronic
1027951664 7:84824207-84824229 AGTCATGTGAAATTGCTACCCGG - Intergenic
1030405791 7:109111284-109111306 ACTCACGTGAAGCTGATGCCTGG + Intergenic
1030999404 7:116397484-116397506 AAACAAGTGAACCTGCTGGCTGG + Intronic
1032292293 7:130599237-130599259 AGTCATGTGAAACTGCTGCCTGG - Intronic
1034527050 7:151671689-151671711 AATCAGGTTAACCTGCTGCCAGG + Intronic
1035969771 8:4234792-4234814 AATCATGAGAAACTGGTGGTTGG + Intronic
1036454400 8:8894151-8894173 AGTCAAGTGAAACTGCTGCCTGG - Intergenic
1036508839 8:9381902-9381924 AGTCATGTAAAACTGTTGCCTGG + Intergenic
1037396771 8:18451758-18451780 ACACCCGTGAAACTGCTGCCGGG - Intergenic
1037554883 8:20012707-20012729 AGTCATGTGGAACTGCTGCCTGG - Intergenic
1038279769 8:26153347-26153369 AGTCATGTGAAACTGCTATCTGG + Intergenic
1038472915 8:27840026-27840048 ACTCATGGGAAACTGCTGTCTGG + Intergenic
1038843293 8:31205882-31205904 AATCATGTCTCACTGCAGCCAGG + Intergenic
1039112018 8:34051128-34051150 AATTCTGTGAACATGCTGCCTGG + Intergenic
1039180865 8:34864492-34864514 AATCATGTAAAACTGTTGCCTGG + Intergenic
1040358931 8:46646351-46646373 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040371237 8:46778027-46778049 AGTGATGTGACACTTCTGCCAGG + Intergenic
1040371641 8:46781445-46781467 AATAATGTGACACTTCTGCCTGG + Intergenic
1040377355 8:46839306-46839328 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040378826 8:46852488-46852510 AATAATGTGACACTTCTGCCTGG + Intergenic
1040379566 8:46859194-46859216 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040382244 8:46884206-46884228 AATAATGTGACTCTTCTGCCTGG - Intergenic
1040959496 8:53017074-53017096 AATAAGGAGAAACTGCTTCCTGG - Intergenic
1041469479 8:58192897-58192919 AGTCATGTGGAACTGCTGCCTGG - Intronic
1041475161 8:58257031-58257053 AATCTTATGAAACTGCTTACAGG + Intergenic
1041929997 8:63276364-63276386 CATCCTGTGAAACCGGTGCCTGG + Intergenic
1043271651 8:78341396-78341418 TGTCATGTAAAACTACTGCCTGG - Intergenic
1043360753 8:79469185-79469207 AGTCACATGAAACTGCTGCCTGG + Intergenic
1044300732 8:90580293-90580315 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1045588560 8:103566279-103566301 AGTCATGTGAAACTGTTGCCTGG + Intronic
1045864415 8:106848962-106848984 AATGATGTTAGATTGCTGCCAGG - Intergenic
1047735120 8:127758484-127758506 AATCATGTCTCACTGCAGCCTGG + Intergenic
1047930659 8:129725481-129725503 ACACATTTGAAACTGCTCCCTGG - Intergenic
1048104572 8:131393736-131393758 AGTCATGTGAGACTGCGGCCTGG - Intergenic
1048805965 8:138241467-138241489 AATCATGTGACACAGCAGCTTGG + Intronic
1050163655 9:2742820-2742842 GGTCATGTGAAACTGCTGCCTGG + Intronic
1052496293 9:29229903-29229925 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1055181540 9:73393729-73393751 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1055719897 9:79161111-79161133 AATCAAGTTCAAATGCTGCCAGG - Intergenic
1056334979 9:85559554-85559576 GGTCATGTGAAACTGCTGCCTGG - Intronic
1056595707 9:88006486-88006508 AATCATGGAAAAAGGCTGCCTGG + Intergenic
1056619165 9:88196145-88196167 AGCCATGTGAAACCACTGCCTGG - Intergenic
1056625976 9:88253642-88253664 AGTCATGTGAAACTTCTGCCTGG - Intergenic
1058108957 9:101009135-101009157 TATAATGCCAAACTGCTGCCTGG - Intergenic
1059314652 9:113413715-113413737 AAACATGTTAACCTGCTGCCTGG - Intronic
1059952956 9:119486821-119486843 AAATGTGTGAAACTGCAGCCTGG - Intergenic
1060142132 9:121219479-121219501 AGTCATATAAAACTGCTGCCTGG - Intronic
1060689289 9:125642374-125642396 AGTCATGTGAAACTGCTGCCTGG - Intronic
1186053876 X:5628332-5628354 CATAGTGTGAAACTGCTACCAGG - Intergenic
1186967036 X:14798854-14798876 TGTCATGTGAAACTGCTGCCTGG - Intergenic
1188501709 X:30834048-30834070 AACCATCTGCAGCTGCTGCCTGG + Exonic
1188502026 X:30837416-30837438 AATCAGATGGATCTGCTGCCAGG - Intronic
1190473969 X:50810040-50810062 AATCATGGTACACTGCAGCCTGG + Intronic
1190804216 X:53819629-53819651 ATTCATGTGAAACCGCTGCCTGG + Intergenic
1191837171 X:65476808-65476830 AGTCATGTGAAACTGCTGACTGG + Intronic
1196316832 X:114236754-114236776 AATCATTCAAAAGTGCTGCCTGG + Intergenic
1196351843 X:114741127-114741149 ACGCATGTGACACTGCTGCTAGG - Intronic
1197220647 X:123910431-123910453 TATCATGTGAAACTAATGCTGGG - Exonic
1197294940 X:124707431-124707453 AATCATGTGAAACTGCTGCCTGG - Intronic
1198309565 X:135417073-135417095 AGTCATCTGAAACTGTTGTCTGG + Intergenic
1198993434 X:142544308-142544330 AATCATGTTAAAGTGCAGTCAGG + Intergenic
1200056975 X:153466712-153466734 AATCCTTTGAAAAAGCTGCCAGG - Intronic
1200181659 X:154154636-154154658 AATCATGTAAGACTGCACCCCGG - Exonic
1200187307 X:154191750-154191772 AATCATGTAAGACTGCACCCCGG - Intergenic
1200192956 X:154228890-154228912 AATCATGTAAGACTGCACCCCGG - Exonic
1200198711 X:154266694-154266716 AATCATGTAAGACTGCACCCCGG - Exonic
1200844895 Y:7821915-7821937 AGTGATGTGACACTTCTGCCTGG - Intergenic
1200867737 Y:8063154-8063176 AATAATGTGACTCTTCTGCCTGG + Intergenic
1200868598 Y:8073304-8073326 AATAATGTGACTCTGCTGCCTGG - Intergenic
1200894542 Y:8360848-8360870 AATGATGTGACTCTTCTGCCTGG - Intergenic
1200896801 Y:8384442-8384464 GATTATGTGACACTTCTGCCAGG - Intergenic
1201459495 Y:14206585-14206607 CATCCTGTGAGACTGCAGCCTGG + Intergenic
1202263114 Y:22990468-22990490 AATAATGTGAAACTTCTTCTTGG + Intronic
1202416104 Y:24624209-24624231 AATAATGTGAAACTTCTTCTTGG + Intronic
1202454683 Y:25045877-25045899 AATAATGTGAAACTTCTTCTTGG - Intronic