ID: 1197299946

View in Genome Browser
Species Human (GRCh38)
Location X:124766099-124766121
Sequence GTCTGTGAGATAGACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197299944_1197299946 -10 Left 1197299944 X:124766086-124766108 CCTTACAACAGGAGTCTGTGAGA 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1197299946 X:124766099-124766121 GTCTGTGAGATAGACATGGAAGG 0: 1
1: 0
2: 0
3: 27
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197299946 Original CRISPR GTCTGTGAGATAGACATGGA AGG Intronic
902118224 1:14139441-14139463 GTGTCTGAGCTAGACTTGGAAGG - Intergenic
902373974 1:16021652-16021674 GTCTCAGAGCTGGACATGGAAGG - Intronic
902378898 1:16043487-16043509 GTCTCAGAGCTGGACATGGAAGG - Intergenic
903021699 1:20399673-20399695 GGCTGTGACAAAGCCATGGAGGG + Intergenic
903258940 1:22120941-22120963 GTGTGTGTGAGAGACAGGGATGG + Intronic
904206758 1:28860612-28860634 GCCTGTGAGATAGACAAGGCAGG + Intronic
904375956 1:30082633-30082655 GTCTGGGAGAGAAAAATGGAAGG + Intergenic
904966161 1:34375390-34375412 TTCTGTGATATAAACTTGGACGG + Intergenic
907762259 1:57372863-57372885 TTCTTTAAGGTAGACATGGAAGG - Intronic
912714494 1:111973181-111973203 GGCTGGGAAATAGAGATGGAAGG + Intronic
913327271 1:117638026-117638048 GGATGGGAGATAGACTTGGAAGG - Intergenic
913391970 1:118324123-118324145 CTCTGTTAGATACACCTGGAGGG - Intergenic
913970696 1:143413526-143413548 GTCTGTGTGATCCTCATGGAAGG - Intergenic
914065073 1:144239137-144239159 GTCTGTGTGATCCTCATGGAAGG - Intergenic
914114078 1:144727217-144727239 GTCTGTGTGATCCTCATGGAAGG + Intergenic
916855153 1:168741617-168741639 GTCTGTCAGAGAGAAAAGGAAGG - Intergenic
918263333 1:182817053-182817075 GTGTGTGTGATAGAGATGAAAGG - Intronic
918476448 1:184930098-184930120 GTCTGTAAGAGACACATGGAAGG - Intronic
918647218 1:186918598-186918620 GACTGGGAGTTATACATGGACGG - Intronic
920593516 1:207245635-207245657 GGCTGTGACATAGTCATGGCAGG + Intergenic
920728351 1:208459087-208459109 GTCCTTGATATAGAAATGGAAGG - Intergenic
921242450 1:213199511-213199533 GGCTGTGAGTTTGTCATGGATGG - Intronic
921737200 1:218642394-218642416 GTGTGTGAGAGACTCATGGAGGG - Intergenic
923314969 1:232771569-232771591 GCTTATGAGATAGACAGGGAGGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924576909 1:245288952-245288974 GCCTGTGTCATAGGCATGGAAGG - Intronic
1066024472 10:31340799-31340821 GTCAGTGGGAGAGACAAGGAAGG + Intronic
1067348820 10:45457265-45457287 GTTTCTGAGATCGAAATGGAAGG - Exonic
1067658743 10:48217817-48217839 GTATGTGGGATAGAGAGGGAGGG - Intronic
1068055575 10:52009042-52009064 GGCTGTGAGATTGTCATAGATGG - Intronic
1069088824 10:64174830-64174852 GTGGGTGAGAGAGACATGCAGGG - Intergenic
1070791733 10:79193668-79193690 GTGTGTGACAGCGACATGGAGGG + Intronic
1071199464 10:83202640-83202662 GGCTGTGAGTTAGTCATAGATGG + Intergenic
1071282197 10:84112954-84112976 GACTGGGAGTTATACATGGATGG + Intergenic
1073079867 10:100852727-100852749 GTCTGAGATATAGACATAGAAGG - Intergenic
1073191006 10:101650641-101650663 GTCTGTGACAGACACATGGATGG + Intronic
1080875111 11:36267639-36267661 GGCTGGGATATAGACTTGGAGGG + Intergenic
1080943214 11:36942697-36942719 GCCTGTGAGTTAGACCTGGAGGG + Intergenic
1081073895 11:38643922-38643944 AACTATGAGATAGACATGCAAGG + Intergenic
1081552613 11:44128004-44128026 GACTGAGAGATAGATATGAATGG - Intronic
1081720524 11:45285578-45285600 GTCTGTGAGAGGGAGATGGGTGG - Intronic
1084678204 11:70649200-70649222 GTCATGGAGATAGACAGGGACGG - Intronic
1085654878 11:78304861-78304883 GGCTGAGAAATAGGCATGGAGGG - Intronic
1085770346 11:79319989-79320011 GTAGGTGAGAAACACATGGAGGG - Intronic
1086469989 11:87097838-87097860 CTATGTGAGATAGATGTGGAAGG - Intronic
1087413254 11:97819961-97819983 GTCTGTGCCATTGACATTGAGGG + Intergenic
1087594459 11:100235907-100235929 GTCTGTGGGACAGACCTGGCAGG - Intronic
1088961975 11:114677627-114677649 TGCTGTTATATAGACATGGAGGG + Intergenic
1090122627 11:124048480-124048502 GGCAGTGAGAGAGAAATGGAAGG + Intergenic
1090804576 11:130194886-130194908 GTGTGTGAGACAGAGGTGGATGG + Intronic
1094142017 12:27191168-27191190 GTCAGTGAGACAGAGCTGGATGG - Intergenic
1095253128 12:40001513-40001535 CTCTGTGAGGTAGACAAGGCAGG + Intronic
1096908373 12:54957468-54957490 GCCTGTGTGATAAATATGGAAGG - Intronic
1097958795 12:65512707-65512729 GGGTGGGAGATAGACAGGGACGG + Intergenic
1100559981 12:95738561-95738583 AGGTGTGAGATAGACATGAATGG + Intronic
1101322285 12:103683137-103683159 GTGTGAGGGAAAGACATGGAAGG + Intronic
1101933758 12:109038306-109038328 GTCCTTGACAGAGACATGGATGG - Intronic
1102617143 12:114164585-114164607 GTTTGTGGGATACACATGGTTGG - Intergenic
1103091484 12:118101266-118101288 ATGTCTGACATAGACATGGAAGG + Intronic
1103748606 12:123143342-123143364 GCCTGTGAGTCAGACTTGGAAGG + Intronic
1104975742 12:132551227-132551249 GTCTGTGAACTGGATATGGAAGG + Intronic
1107686990 13:42911211-42911233 ATCTGTGAGAGAGAGAGGGAGGG + Intronic
1108695594 13:52899890-52899912 CTCTGTGAGGCAGACAGGGAGGG + Intergenic
1112609539 13:100942818-100942840 CTCTGTGAGATAGGCAGGGCAGG - Intergenic
1113427042 13:110216802-110216824 ATCTGTGAAATGGACATAGAAGG - Intronic
1115723897 14:36192308-36192330 ATCTGTGAGATAGAGGGGGAAGG - Intergenic
1116261429 14:42633160-42633182 GTCTGTGAAAGAGACACTGAAGG - Intergenic
1121205083 14:92157967-92157989 ATGTGTGAGACAGACATGGATGG + Intronic
1121783513 14:96637925-96637947 GTCCGGGAGGGAGACATGGATGG - Intergenic
1121877411 14:97466017-97466039 GACTGAGTGAAAGACATGGAGGG - Intergenic
1122970715 14:105151103-105151125 GTCTGTGAAAGAGACAAGGTGGG + Exonic
1123879681 15:24665668-24665690 GTCTTTCAGATTGAAATGGAAGG - Intergenic
1126383470 15:48071057-48071079 GGCTGGGAGACAGACATGGCTGG + Intergenic
1126416678 15:48425110-48425132 ATCTCTGAGACAGTCATGGATGG + Intronic
1127836135 15:62792714-62792736 GTCTGTGGGGCAGACCTGGAGGG - Exonic
1128687331 15:69696553-69696575 GTCTGTGACCAAGACATTGAAGG + Intergenic
1129617558 15:77111455-77111477 GAATGTGAGATAGAGAGGGAAGG - Exonic
1130424934 15:83787431-83787453 GTCTGTGGGATAGGTAAGGATGG + Intronic
1132313305 15:100872709-100872731 GTCTGTGAGAGGGACAGGTAGGG + Intergenic
1133410909 16:5568073-5568095 GTTTGTGAGCTAGAGAAGGATGG - Intergenic
1133716309 16:8452781-8452803 GCCTATGAGAAAGACAGGGAAGG + Intergenic
1133980897 16:10632625-10632647 TTCTGGGGGATAGGCATGGATGG + Intronic
1134900382 16:17932666-17932688 GACTTTGAGATAGCCATCGAGGG - Intergenic
1138053761 16:53811158-53811180 CTATGTGAGTTAGACATGGGTGG + Intronic
1138169319 16:54834114-54834136 GCCTGTTAGTTTGACATGGATGG + Intergenic
1139179255 16:64726437-64726459 GTCTTTGGTATAGACCTGGATGG - Intergenic
1141504214 16:84463929-84463951 GGCTGTGGGACAGACAGGGAGGG + Exonic
1141798591 16:86291708-86291730 GTGTGTCAGAGAGACAGGGACGG - Intergenic
1141915557 16:87094125-87094147 TCCAGTGAGATAGACCTGGAGGG - Intronic
1144026877 17:11285265-11285287 GTGTGTCAGACAGACAGGGATGG + Intronic
1144872695 17:18380731-18380753 CTCTGTGAGCTAGACCTGGTTGG - Intronic
1146595818 17:34167636-34167658 GACTGTGTGAGAGACAGGGAAGG + Intronic
1147625750 17:41898745-41898767 CTCTGTGCCAAAGACATGGATGG + Exonic
1150214409 17:63458673-63458695 GTCTGTGGGATGGAGAAGGAGGG + Intergenic
1151787128 17:76280480-76280502 ATCTGGGAGATGGCCATGGAGGG + Intronic
1153029789 18:702884-702906 GTGTGTGAGACAGAGAGGGAGGG - Intronic
1153486648 18:5605264-5605286 GGCTGTGAGATGAACATGGGTGG - Intronic
1154506535 18:15045863-15045885 GCCTGTGATAGAGACAGGGAAGG - Intergenic
1156767239 18:40672090-40672112 ATCTGTGACATAGACATTGAAGG + Intergenic
1157174803 18:45441641-45441663 GTTTGTGACATCTACATGGATGG + Intronic
1157764659 18:50287189-50287211 GTCTATGAGATAAACAGGGAGGG - Intronic
1158230887 18:55253723-55253745 GTCTGGGAGATAGAAATATATGG - Intronic
1159060429 18:63509060-63509082 GCCTGTGATAGAGACAGGGAGGG - Intergenic
1159138353 18:64363155-64363177 GTCTGTGAGTTTGTCATAGATGG - Intergenic
1159218592 18:65429197-65429219 CAATGTGAGAAAGACATGGAGGG + Intergenic
1160514014 18:79468783-79468805 GTCTGTGAGACAGAGCTGCAGGG + Intronic
1163992205 19:21008991-21009013 GACTGTGAGCTATACTTGGATGG + Intergenic
1165247093 19:34504019-34504041 GTGTGAGAGAGAGACAGGGATGG + Exonic
1166305216 19:41933510-41933532 GGCTGGGAGAGAGAGATGGATGG + Intergenic
925852106 2:8091870-8091892 ATCTGTGAGAAAGACTTGGTTGG + Intergenic
927172254 2:20379924-20379946 GTCCCTGAGAGAGACATGGATGG - Intergenic
927409042 2:22804616-22804638 GTCCTTGAGAAAGACATTGAAGG + Intergenic
927945833 2:27134607-27134629 GTCTGCGAGACCGACTTGGACGG - Exonic
928212010 2:29330340-29330362 GTCTGTGAGCTGGACCTGGACGG - Intronic
928891289 2:36205943-36205965 TTCTGTGAGAAAAACCTGGATGG + Intergenic
929295880 2:40245971-40245993 GTCTCTGAGATGGACCTGTAGGG - Intronic
929523558 2:42677864-42677886 GTGTGTGAGAGAGACAGGGAGGG - Intronic
930730157 2:54721571-54721593 GTCTCTTAAATAGAAATGGATGG - Intergenic
932216125 2:69967091-69967113 GTCTGTGCCATAGACAGGAATGG + Intergenic
932480083 2:72033786-72033808 GCCTGGGAGAAAGACATGCATGG - Intergenic
932564279 2:72895810-72895832 GTATGTGAGAGAGAGAGGGAGGG - Intergenic
933106540 2:78334168-78334190 GTTTGTGAATGAGACATGGAAGG - Intergenic
933347746 2:81110887-81110909 GGCTGTGAGTTTGACATAGATGG - Intergenic
934175392 2:89574452-89574474 GTCTGTGTGATCCTCATGGAAGG - Intergenic
934285708 2:91648815-91648837 GTCTGTGTGATCCTCATGGAAGG - Intergenic
934724610 2:96607756-96607778 GTCTGGCAGACAGACGTGGAGGG - Intronic
937609603 2:123844433-123844455 GTCTGTGAGCTTGTCATGGATGG - Intergenic
938508767 2:131917179-131917201 GTGTGTGAGAGAGAGAGGGATGG + Intergenic
938878634 2:135560900-135560922 GTCTCTGAGTATGACATGGAAGG + Intronic
942053047 2:172158549-172158571 GTCTGTGAGTAAGACAGGAATGG + Intergenic
942774740 2:179567832-179567854 GTATGTGACAGTGACATGGATGG - Intronic
944905315 2:204256373-204256395 GTGTGTGAAAAAGAGATGGAGGG + Intergenic
945356944 2:208851744-208851766 GGCTGTGGGTTAGTCATGGATGG + Intronic
945417263 2:209589942-209589964 GTCTCAGATGTAGACATGGAAGG + Intronic
1168977829 20:1981256-1981278 GTCTGGGAGTCAGACGTGGAGGG - Intronic
1173700423 20:45065469-45065491 GTCTGGATGATAGACATAGATGG + Intronic
1173873766 20:46357270-46357292 GGCTGTGACACGGACATGGAGGG - Intronic
1175117513 20:56693393-56693415 GTGTGTGAGACAGAAAGGGATGG + Intergenic
1175120365 20:56711824-56711846 GGCTGTGAGCTGGACATGGCTGG + Intergenic
1175824275 20:61928217-61928239 GTCAATGAGATAGATCTGGAGGG - Exonic
1176258987 20:64169119-64169141 GTCCCTGAGGGAGACATGGAGGG - Intronic
1176791329 21:13323244-13323266 GCCTGTGATAGAGACAGGGAAGG + Intergenic
1177420095 21:20845153-20845175 ATCTGTGCAACAGACATGGAGGG + Intergenic
1177625008 21:23647352-23647374 GTCTGTGACACAGGCAAGGATGG + Intergenic
1177990466 21:28030128-28030150 GCCTGTGATAGAGACAGGGAAGG - Intergenic
1178447688 21:32660541-32660563 GACTGGGAGTTATACATGGACGG + Intronic
1178758578 21:35378011-35378033 GTATGAGAGATAGGCATGGTTGG - Intronic
1179459837 21:41526867-41526889 GTGTGTGAGATGCACGTGGAAGG + Intronic
1181956029 22:26588892-26588914 GTCTGGCAGACAGACATGCAAGG + Intronic
1183539384 22:38420874-38420896 GCATGTGAGATAGATATGAATGG + Intergenic
1183558047 22:38546772-38546794 GACTGTGAGATGGGGATGGAAGG + Intronic
1185214993 22:49593683-49593705 GTCTCTGAGACACACATGGATGG + Intronic
949877783 3:8637738-8637760 GCCTGTGAAATGGTCATGGAAGG + Intronic
950522192 3:13504073-13504095 CTCTGGGAGAGAGACATGGATGG - Exonic
950663423 3:14480979-14481001 GGCTCAGAGATAGACATGGAGGG + Intronic
951777915 3:26330315-26330337 GGCTGTGAGTTTGCCATGGATGG - Intergenic
952841926 3:37653693-37653715 GTCTGTGAGAAAGACAGGAGAGG - Exonic
953000005 3:38923851-38923873 GTCTGAGAGACAGACAAGGGAGG + Intronic
953285429 3:41602189-41602211 GTCTGTAAGAAAGAAAGGGAAGG + Intronic
953661476 3:44894319-44894341 GTATGGGAGATAGCCATGGGGGG - Intronic
954126717 3:48535474-48535496 ATCTGGGAGGTAGACAGGGAGGG + Intronic
957022467 3:75140709-75140731 GACTGGGAGCTATACATGGAAGG + Intergenic
958596726 3:96235126-96235148 GTGTGAGATATAGACTTGGAAGG - Intergenic
962074079 3:132062373-132062395 GTCTGTGAGTTGGTCATAGATGG + Intronic
962265986 3:133944686-133944708 TTCTGTGACATGGACCTGGAAGG - Intronic
963542497 3:146610942-146610964 GTCTGAGAGAGAGAGATGAAGGG + Intergenic
963897493 3:150702914-150702936 GTCTGTGAGAGAGAGAGAGAGGG + Intronic
965447204 3:168789719-168789741 GTCTGTAAGATAGACAAGCCTGG + Intergenic
966067475 3:175834467-175834489 GTCTGTAATATAGAGCTGGAAGG - Intergenic
966767951 3:183479225-183479247 CTCTGTGAGGGAGAGATGGAGGG - Intergenic
969320981 4:6412442-6412464 GTCAGGGAGATAGAAATAGAGGG - Intronic
969540405 4:7784952-7784974 GGCTATGAAATAGACTTGGAAGG - Intronic
969646960 4:8436262-8436284 GACTGGGAGCTATACATGGACGG + Intronic
972393510 4:38635409-38635431 GTTGGGGAGATAGACATAGAGGG + Intergenic
976091413 4:81461745-81461767 GACTGTCAGACAGTCATGGAAGG + Intronic
976898216 4:90138448-90138470 GTCTATGAAATAGCCAGGGAGGG - Intronic
977192591 4:94019307-94019329 GTCAGTGGCATAGACAAGGATGG - Intergenic
978220185 4:106262790-106262812 GTTGGTGAGAGAGACAAGGAGGG - Intronic
979276842 4:118823862-118823884 GTCTGTGAGCTTGATGTGGAAGG - Intronic
980780120 4:137482811-137482833 GACTGAGAGTTATACATGGATGG + Intergenic
980914233 4:139019517-139019539 ATATGTGAGAGAGACATTGAAGG + Intronic
981198639 4:141950824-141950846 GTCTGTGAGTTTGTCATAGATGG - Intergenic
981227875 4:142318203-142318225 GTGTGTGAGAAAGAAATGGGGGG + Intronic
982077622 4:151753460-151753482 GTGTGTGAGAGAGAGATGGTAGG - Intronic
982532529 4:156563695-156563717 GTCTGTGAGATGGAGATGAATGG - Intergenic
985536737 5:469345-469367 GGCTCTGAGACAGACAGGGATGG - Intronic
985547810 5:518871-518893 GGCTGAGAGAGAGACAGGGATGG - Intronic
987165202 5:15190786-15190808 GTCTGTGAGATAAGCATTTATGG - Intergenic
987580622 5:19786823-19786845 GTCTGTGTGCTAGGCATGGCTGG + Intronic
987808651 5:22804380-22804402 GCCTGTGAGAGAGAGAAGGATGG + Intronic
987985233 5:25137332-25137354 GTATGTGAGAAAGACAGTGAGGG - Intergenic
990358264 5:54992168-54992190 CTATGTGAAATAAACATGGATGG + Intronic
990702275 5:58486609-58486631 GTCCATGAGATAGCAATGGATGG - Intergenic
990924466 5:61004711-61004733 GTCATAGAGAGAGACATGGAAGG + Intronic
993463039 5:88208931-88208953 GTGTGTGAGATATATATGAAAGG - Intronic
994279007 5:97877348-97877370 GTCAGTGAGTTAAGCATGGAAGG + Intergenic
994869263 5:105323858-105323880 GTCTGTGAGAGAGACAAGAAAGG - Intergenic
995403549 5:111768177-111768199 GTCTGTGAGGTAGAATTGGTGGG + Intronic
996016128 5:118535781-118535803 GTCCTTGAGATACAAATGGAAGG + Intergenic
996644080 5:125793592-125793614 GGCTGAGAGATAGCCAAGGAGGG - Intergenic
998786183 5:145711541-145711563 GTCTGTGGGAGAGACTTGGCAGG - Intronic
998910416 5:146954008-146954030 ATCTGTGAGGTAGACTTGGGGGG + Intronic
999783142 5:154867254-154867276 GTCTGTGATGTAGAGATGTAAGG + Intronic
1001083536 5:168684146-168684168 CTCTGTGAGATGGGCAGGGAAGG - Intronic
1003776582 6:9372979-9373001 CTCAGTGAGTTAGAAATGGAAGG + Intergenic
1005362848 6:25048029-25048051 GTCTGTGAGTTTGCCATAGATGG - Intergenic
1005528861 6:26681621-26681643 GTGTGTGAAATACACACGGAGGG - Intergenic
1005530875 6:26704496-26704518 GTGTGTGAAATACACATGGAGGG - Intergenic
1005539921 6:26797150-26797172 GTGTGTGAAATACACATGGAGGG + Intergenic
1005541935 6:26820027-26820049 GTGTGTGAAATACACACGGAGGG + Intergenic
1006268849 6:32948867-32948889 GTCTGGGGGAGAGACAGGGATGG + Exonic
1006404699 6:33838158-33838180 GGCTGTGACACAGACAGGGAAGG + Intergenic
1006515352 6:34542386-34542408 GTCTGTCAGCCAGACCTGGAAGG - Intronic
1007486174 6:42182226-42182248 GACTGAGTGACAGACATGGAGGG + Intergenic
1007937822 6:45749620-45749642 GTCTGTGAGTTAGGAATGGATGG - Intergenic
1009012738 6:57862066-57862088 GTGTGTGAAATACACATGGAGGG + Intergenic
1012279831 6:97315483-97315505 GTCTGTAATATACACATGGCAGG - Intergenic
1012977670 6:105797370-105797392 ACCTGTGAGCTAGACATGGAAGG - Intergenic
1013184836 6:107748768-107748790 GGCTGTGAGAAACACAGGGAGGG + Intronic
1017052662 6:150408096-150408118 ATCTGGGAGAAAGACATGGAAGG - Intergenic
1017110253 6:150925300-150925322 GTCTGAGAGTGAGAGATGGAAGG - Intronic
1021243659 7:18235695-18235717 TTCTGTGAGATTGCCATGGCAGG + Intronic
1023242189 7:38160443-38160465 GTCTGTGGGACAGACTTGGCAGG + Intergenic
1024165773 7:46728560-46728582 GGCTGTGAGTTAGTCATGGATGG - Intronic
1024456248 7:49610652-49610674 GTCTGTGAGTTTGTCATAGATGG + Intergenic
1026562275 7:71460244-71460266 GTCTATGAAATAGACAAGGATGG + Intronic
1029939246 7:104462356-104462378 GGCTGTGAGTTTGTCATGGATGG + Intronic
1031185743 7:118477822-118477844 GTGTCTGAAATAGATATGGAAGG - Intergenic
1032981341 7:137286897-137286919 CACTGTGAGATAAACATGGCAGG + Intronic
1034030444 7:147756931-147756953 GTCTGTCTGTTAGACTTGGAGGG + Intronic
1034604602 7:152300508-152300530 GTCTGTGTGATCCTCATGGAAGG + Intronic
1034788916 7:153950245-153950267 GTTTGTCAGGTAGACATGGTAGG + Intronic
1037640377 8:20736749-20736771 GTCTGTGTGATAGACTTGGCTGG - Intergenic
1037887768 8:22604079-22604101 GTCTGTGAGGTAGATAGGGCAGG - Exonic
1038033414 8:23664226-23664248 GTCTGTGAGCAAGAGCTGGAAGG - Intergenic
1040505323 8:48042255-48042277 GTTTGTGAGATTTTCATGGATGG - Intronic
1041011737 8:53550157-53550179 GTGTGTGAGAGAGAGAGGGAAGG + Intergenic
1045495811 8:102707556-102707578 GACTTGGAGGTAGACATGGAAGG + Intergenic
1049675261 8:143886320-143886342 CTCTGTGAGAAAGACATGCCCGG - Intergenic
1050614576 9:7388608-7388630 GTCTGGGAGAGAGAGAAGGAAGG + Intergenic
1051564371 9:18480492-18480514 GTCTGTGAGAGTGACACTGAGGG - Intronic
1052508279 9:29382238-29382260 GACTGTGAGCTGTACATGGACGG + Intergenic
1053157463 9:35791317-35791339 GTGTGTGAGATGGAAATGGAAGG + Intergenic
1053342313 9:37347953-37347975 GCCTGTGAAATGGACATAGAAGG - Intronic
1054818518 9:69498414-69498436 AACTGTGAGATAGTCAAGGAAGG + Intronic
1055169195 9:73234274-73234296 GTCTCTGAAATATACATGTAGGG - Intergenic
1055709605 9:79045526-79045548 GTCTCTGACAGAGACTTGGAGGG + Intergenic
1057298957 9:93865539-93865561 CTCTCTGAGATGGCCATGGAGGG - Intergenic
1058046593 9:100364020-100364042 GTCTGTGGGTTGGACCTGGAAGG - Intergenic
1058905838 9:109481907-109481929 GCCTGTGACAAAGACAGGGAGGG + Intronic
1060015109 9:120080255-120080277 CTCTGTGAGAGAGGCAGGGATGG + Intergenic
1060229782 9:121818169-121818191 GTCTGTGAGATTGAATGGGAGGG + Intergenic
1060859169 9:126939708-126939730 GTGAGTGAGACAGACATAGAGGG + Intronic
1061573723 9:131493314-131493336 GTCTATGTGACAGACATGGTAGG - Intronic
1061618179 9:131793866-131793888 GTGTGTGAGGTGGCCATGGATGG + Intergenic
1062129585 9:134885331-134885353 CTCTGTGACATGGACACGGACGG + Exonic
1062133542 9:134913029-134913051 CTCTGTGACATGGACACGGACGG - Exonic
1185832383 X:3314577-3314599 GTTAGGTAGATAGACATGGATGG + Intronic
1185856598 X:3542086-3542108 GTGTGTGAGATAATCGTGGAAGG + Intergenic
1185878131 X:3715720-3715742 CCCTGTGAGTTAGGCATGGAAGG + Intergenic
1186704405 X:12126723-12126745 GTATGAGAGATAGTAATGGAAGG - Intergenic
1188097236 X:26039869-26039891 GTCAGTGATATGGACATAGAAGG - Intergenic
1189307299 X:39996510-39996532 GTTTGTGAGATGGAGGTGGATGG - Intergenic
1190425869 X:50334189-50334211 GACTGGGAGTTATACATGGACGG - Intronic
1190542422 X:51491584-51491606 GTCAGTGGTATAGACAGGGAAGG + Exonic
1190759397 X:53427041-53427063 GGCTGAGAGACAGAGATGGAAGG + Intronic
1193889107 X:87021187-87021209 GGCTGTGAGTTTGTCATGGATGG - Intergenic
1194897441 X:99461813-99461835 GCCTATGAGGTAGGCATGGATGG - Intergenic
1195096294 X:101504447-101504469 GTGTGTGAGAGAGAGAAGGAGGG + Intronic
1197299946 X:124766099-124766121 GTCTGTGAGATAGACATGGAAGG + Intronic
1197565305 X:128076988-128077010 GTCTGTGACACAGCCTTGGAAGG + Intergenic
1197852737 X:130880690-130880712 GTCTATGACATAAACATTGAAGG + Intronic
1198223868 X:134627674-134627696 TTCTGTGAAATAGAACTGGAAGG - Intronic
1198754539 X:139969299-139969321 GTCTGTGAAAAAGAGAAGGAAGG - Intergenic
1198970043 X:142269699-142269721 GACTGGGAGTTATACATGGACGG + Intergenic
1199137442 X:144269714-144269736 GGCTGTGAGTTTGTCATGGATGG - Intergenic
1199470861 X:148194143-148194165 GTATGTGAGATAAACCTTGAAGG - Intergenic
1200394101 X:155973156-155973178 GACTGGGAGTTATACATGGACGG - Intergenic
1200943358 Y:8807489-8807511 GACTGGGAGTTATACATGGAGGG + Intergenic
1201270332 Y:12247758-12247780 GACTGGGAGTTATACATGGACGG + Intergenic
1201550490 Y:15212278-15212300 GTGTGTGAGAGAGAGAGGGAGGG + Intergenic