ID: 1197306274

View in Genome Browser
Species Human (GRCh38)
Location X:124845737-124845759
Sequence AGGGAAATTACAGGGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 336}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197306265_1197306274 1 Left 1197306265 X:124845713-124845735 CCCTCCCACTTTTTAAGATAAGG 0: 1
1: 0
2: 1
3: 29
4: 246
Right 1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 336
1197306267_1197306274 0 Left 1197306267 X:124845714-124845736 CCTCCCACTTTTTAAGATAAGGT 0: 1
1: 0
2: 0
3: 19
4: 178
Right 1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 336
1197306264_1197306274 4 Left 1197306264 X:124845710-124845732 CCTCCCTCCCACTTTTTAAGATA 0: 1
1: 0
2: 2
3: 33
4: 323
Right 1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 336
1197306270_1197306274 -4 Left 1197306270 X:124845718-124845740 CCACTTTTTAAGATAAGGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 137
Right 1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 336
1197306268_1197306274 -3 Left 1197306268 X:124845717-124845739 CCCACTTTTTAAGATAAGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 336
1197306263_1197306274 14 Left 1197306263 X:124845700-124845722 CCAGGACTTACCTCCCTCCCACT 0: 1
1: 0
2: 5
3: 22
4: 330
Right 1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG 0: 1
1: 0
2: 1
3: 23
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197306274 Original CRISPR AGGGAAATTACAGGGTGTGA TGG Intronic
900034223 1:393518-393540 AGGGAAACAGCAGGGTGAGATGG - Intergenic
900055058 1:623408-623430 AGGGAAACAGCAGGGTGAGATGG - Intergenic
901791264 1:11654762-11654784 AGGAAAATTACCTGGTGTGGGGG - Intronic
902181783 1:14694886-14694908 AGGGCAAGCACAGGGTGTTAGGG + Intronic
902704859 1:18197587-18197609 AGAGAAGTCACTGGGTGTGAAGG + Intronic
904767384 1:32860947-32860969 AGGGAAACCTCAGGGTCTGAGGG - Intergenic
904838224 1:33353472-33353494 AGGAAAATTAAAGGATGGGAAGG - Intronic
905500386 1:38431976-38431998 AGGGAAGATAGAGGGTGGGAGGG + Intergenic
906059205 1:42937339-42937361 TGTGATATGACAGGGTGTGATGG + Intronic
906187249 1:43871416-43871438 AGGGAGAGGACGGGGTGTGAGGG + Intronic
906782320 1:48583750-48583772 AAAGAAATTACATGGTCTGATGG - Intronic
908396669 1:63731349-63731371 ATGGAAATTCCCTGGTGTGAAGG - Intergenic
908659285 1:66420314-66420336 AGGGAATTTCCAGGGTGCTAGGG - Intergenic
908778117 1:67661390-67661412 AGTGAAATTACTGGGTTTTAAGG + Intergenic
909465499 1:75969535-75969557 AGGGAAACTACAGGGAATAATGG + Intergenic
914423790 1:147555420-147555442 AGCTACAATACAGGGTGTGAAGG - Intronic
915305562 1:154975525-154975547 GGAGCCATTACAGGGTGTGATGG + Intronic
917086648 1:171310898-171310920 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
917280427 1:173373936-173373958 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
918229484 1:182515011-182515033 AGTGAAAACTCAGGGTGTGAGGG + Intronic
919468563 1:197951135-197951157 AGGTAAATTGCATGTTGTGAAGG + Intergenic
920371400 1:205481489-205481511 AGGGAAAGAACTGGGTGTGTAGG + Intergenic
920546644 1:206823804-206823826 AGGGAATAAACAGTGTGTGATGG + Intronic
920970606 1:210740591-210740613 AGGTAAATAACAGAGAGTGAGGG - Intronic
922256579 1:223897687-223897709 AGGGAAACAGCAGGGTGAGATGG - Intergenic
924201841 1:241668451-241668473 AGGGAAATGACAGGTTAGGAAGG + Intronic
924252435 1:242145961-242145983 TGGCAAATGACAGGGTGTGGTGG - Intronic
924337787 1:243000546-243000568 AGGGAAACAGCAGGGTGAGATGG - Intergenic
924401855 1:243691883-243691905 AGAGAAAGTACAAAGTGTGAAGG + Intronic
924910387 1:248505761-248505783 AGAGAATTTAAAGGGAGTGATGG - Intergenic
924913713 1:248542278-248542300 AGAGAATTTAAAGGGAGTGATGG + Intergenic
1063288728 10:4718057-4718079 AGGGAAGTAACAGAGTGTGGAGG + Intergenic
1065318261 10:24485352-24485374 AGGTCAATTACAGGAAGTGAGGG - Intronic
1065764146 10:29010867-29010889 ATGGAAATTAGCGGGTGTGGTGG - Intergenic
1066614039 10:37278577-37278599 AGGGAATTTCCAGGGTGCTAGGG - Intronic
1066710345 10:38226936-38226958 AGGGATATTCCTGGGTGAGAAGG + Intergenic
1066979663 10:42400486-42400508 AGGGATATTACTGGGTGAGAAGG - Intergenic
1067184778 10:44017310-44017332 AGGGGAAGTAAAGGGTGGGAGGG - Intergenic
1067238268 10:44469618-44469640 AGGGACATTACAGGCTGGCAGGG + Intergenic
1067429066 10:46230971-46230993 TGGGAAATAAGAGGGTGGGAGGG + Intergenic
1068030016 10:51694727-51694749 AGGGAAAATTCAGGATGTGAGGG + Intronic
1068550301 10:58400416-58400438 AGAGAAATTACAGGGTGCATGGG + Intergenic
1068684640 10:59857168-59857190 AGGGAAATTAAAGGGAGAGTAGG + Intronic
1069418405 10:68223515-68223537 AGGCAATTTAGAGGATGTGATGG + Intergenic
1069954293 10:72040380-72040402 AGGGAAATTACAGGGCGGGGTGG + Intergenic
1070472416 10:76795937-76795959 AGGGAAATCAAAGGTTGGGAAGG + Intergenic
1070856008 10:79608532-79608554 AGTGAAAACTCAGGGTGTGATGG + Intergenic
1072118337 10:92384830-92384852 TGGGAGATCACAGGGTGGGAGGG + Intergenic
1072283551 10:93892409-93892431 AGGGAAATTTCAGGGAAGGATGG - Intergenic
1073087658 10:100904314-100904336 AGGGAAATTACTGGGTCATAGGG - Intergenic
1073680767 10:105701096-105701118 AGGGAAATAACAGTGTTTGCTGG + Intergenic
1073843647 10:107527268-107527290 AGGGACACTGCAGGGCGTGAAGG + Intergenic
1074915164 10:117948283-117948305 AAGTAAACTACATGGTGTGAAGG - Intergenic
1075054868 10:119209742-119209764 TGGGAAATCACTGGGTCTGATGG + Intronic
1075093914 10:119458768-119458790 GGGGAAAGGACAGGGTGTGGAGG - Intronic
1078754462 11:14195897-14195919 AGTGAAATTTCTGGGTCTGAGGG + Intronic
1079114725 11:17634040-17634062 AGGGGAATGGCAGGGTGCGAGGG - Intronic
1080253146 11:30258490-30258512 TATGAATTTACAGGGTGTGAGGG - Intergenic
1080440163 11:32286646-32286668 AGGTAAATTCCATGTTGTGAGGG - Intergenic
1082192308 11:49261331-49261353 GGGGAAACTGCAGGGAGTGAGGG - Intergenic
1082829770 11:57607375-57607397 AGTGATATTACAGGGTGAGGAGG - Intronic
1083798420 11:65032095-65032117 TGGGGCATTACAGGGTGAGAGGG + Intronic
1085408303 11:76277072-76277094 AGGGAAAGGACTGGGTCTGATGG - Intergenic
1086346215 11:85900241-85900263 AGGGAAATTGTAGAGGGTGATGG - Intronic
1086558541 11:88140672-88140694 GGGGAAATACCAAGGTGTGATGG + Intronic
1086783437 11:90935568-90935590 ATTGATATTACAGGATGTGAAGG + Intergenic
1087337608 11:96864045-96864067 AGGGAAAATACTGGAAGTGAGGG - Intergenic
1087339664 11:96887635-96887657 AGGGAGATTGGAGGGTGTTATGG - Intergenic
1087682795 11:101234598-101234620 AGGGAATTTCCAGGGTGCTAGGG - Intergenic
1088873211 11:113910725-113910747 AGAGAAATTGCCGGGTGTGGTGG - Intronic
1090955713 11:131511451-131511473 AGGGAAATGAGGGGGTGTGCTGG - Intronic
1091324015 11:134670738-134670760 AGGGGAATTGCAGGGGATGAAGG + Intergenic
1092517471 12:9230328-9230350 AGGAAAAATGCAGGGTTTGATGG + Intergenic
1093100197 12:15018799-15018821 GGGGAAATTAAGGGGTGGGAGGG + Intergenic
1093534703 12:20209734-20209756 AGTGAAAACTCAGGGTGTGATGG - Intergenic
1093572925 12:20689396-20689418 ATTTAAATTACATGGTGTGAGGG + Intergenic
1093696001 12:22161143-22161165 AGGGAGATAACAGGGAGTGTTGG + Intronic
1095768308 12:45921809-45921831 AGGGAAAGTAAAGGGTTTAAAGG - Exonic
1096086482 12:48868472-48868494 AGGGAAACTTCAGGGTGGAAAGG + Intergenic
1098976765 12:76910560-76910582 AGAGAAAGTACAGAGAGTGAAGG - Intergenic
1099271574 12:80517335-80517357 AATGAAATAAGAGGGTGTGATGG - Intronic
1099637660 12:85235273-85235295 AGGAAAATTCCAGAGTTTGAGGG - Intronic
1099800722 12:87453066-87453088 AGGGAAATTACATGAGGTGATGG + Intergenic
1100529670 12:95451951-95451973 AGGGAATTTCCAGGGTGCTAGGG - Intergenic
1101217045 12:102595405-102595427 AGTGAAAACTCAGGGTGTGAGGG + Intergenic
1101425497 12:104584889-104584911 AGGGAAATTGCTGGATTTGAAGG + Intronic
1102209355 12:111113383-111113405 AAGGAAATTTCGGGGGGTGATGG - Intronic
1102219279 12:111183425-111183447 AAGGAAATCTCAGGGTCTGAGGG + Intronic
1102740054 12:115199094-115199116 AGGGAACTTGGAGGGTGTGATGG + Intergenic
1103951261 12:124552590-124552612 AGGGAAATCACAGGCTCTGTGGG + Intronic
1104081556 12:125434503-125434525 TGGGAGATTAGAGGGTGGGAGGG + Intronic
1106615137 13:31319651-31319673 AGGGACAATACAGGGTGAGAAGG - Intronic
1107195585 13:37647520-37647542 AGGGAAATAAGAGAGGGTGATGG + Intronic
1108377912 13:49830341-49830363 GGGGAAATTAAATGGTGTGGAGG + Intergenic
1108796891 13:54043046-54043068 AGGGAATTTTTAGGGAGTGATGG + Intergenic
1108870335 13:54976710-54976732 AGGGAAACTAAAGTGGGTGAAGG - Intergenic
1110561436 13:76914411-76914433 AGGGAATTTTCAGGGTGAGGTGG - Intergenic
1111050910 13:82882570-82882592 AGGGAAATACCTGGGTGTCAAGG + Intergenic
1113655288 13:112064143-112064165 TGGGAAAGTACTGGGTTTGAAGG + Intergenic
1113901446 13:113800528-113800550 AGGGAAATATCAGGGTGCGTGGG - Intronic
1117522672 14:56566332-56566354 TGGGAAAATGCAGGGTGTTATGG - Intronic
1119407050 14:74405513-74405535 AGGGTGGATACAGGGTGTGAGGG - Intergenic
1119635069 14:76267015-76267037 AGGAAAATTACAGGGTTTGAGGG + Intergenic
1120260410 14:82177416-82177438 TCCAAAATTACAGGGTGTGATGG - Intergenic
1120793550 14:88607593-88607615 ATGGTAGTTACAGGGTGAGATGG - Intronic
1120976222 14:90250541-90250563 AGGGTAACTACAGGGTTTGCTGG + Intergenic
1121337073 14:93083960-93083982 AGGGAAATTGCCGGCTTTGATGG - Intronic
1121546065 14:94764641-94764663 AGGAAAAGTGCAGGGTGTGCGGG - Intergenic
1123712078 15:22995753-22995775 GGGGAAATTTCTGGGGGTGATGG - Intronic
1123998443 15:25734757-25734779 AGGGCAATTCCAGTGGGTGACGG + Intronic
1124787746 15:32697932-32697954 ACGAAAATTAGAGGGTGTGGTGG - Intergenic
1127028313 15:54833152-54833174 AGGGAAAGGAAAGGATGTGAGGG - Intergenic
1127356081 15:58201335-58201357 AGGGAAATAGCAGCCTGTGAAGG + Intronic
1127703425 15:61524456-61524478 ATGAAAATAACTGGGTGTGAGGG - Intergenic
1129119527 15:73387533-73387555 AGGGAAAAAAGAGGGAGTGAGGG + Intergenic
1131558199 15:93417459-93417481 AGGTAAATTAGAGGATTTGAAGG - Intergenic
1132222494 15:100115351-100115373 AGGGAAAATTCAGGGTGCAAAGG + Intronic
1133638994 16:7698747-7698769 AGGGAAAGTACAGGGAGCTAAGG + Intronic
1134105902 16:11485908-11485930 TGGGAAATTACAGGGCTGGATGG + Intronic
1134407209 16:13970984-13971006 AAGGAAATTACTGGGTTGGATGG + Intergenic
1135224948 16:20647613-20647635 AAGGCAATTGCAGGCTGTGAAGG - Intronic
1135971081 16:27072426-27072448 AGGGAATTTACGGGGAGTGATGG - Intergenic
1136549395 16:30974638-30974660 AGCCAAGTTACAGGGTGTTAAGG + Intronic
1137537224 16:49336563-49336585 AGGAAAAGTACAGGGTGTTGTGG - Intergenic
1138136779 16:54530265-54530287 AGGGCAATTGTATGGTGTGAAGG - Intergenic
1138648710 16:58444579-58444601 TGGGAAATCTAAGGGTGTGATGG - Intergenic
1139268975 16:65664316-65664338 AGGAACATAAAAGGGTGTGAGGG + Intergenic
1139648780 16:68351335-68351357 ACGGAGACTACAGGGTGGGAGGG - Intronic
1139752138 16:69115325-69115347 AGAGAAAAGACAGGGTGGGAGGG + Exonic
1140608326 16:76567655-76567677 AAGGAAATTACAGGGAATGGGGG - Intronic
1141760720 16:86026784-86026806 CGGGAAGTGAGAGGGTGTGAAGG - Intergenic
1141854002 16:86668648-86668670 AGGGAAAGTAGGGGGTGTCAGGG + Intergenic
1142497315 17:313118-313140 AGAGGAATTAGAGGGGGTGAAGG - Intronic
1142878963 17:2869765-2869787 AGGGAAATGTCAGGATGAGAAGG - Intronic
1143216536 17:5229307-5229329 AGGGCATTTCCAGGGTGTCAGGG + Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144111553 17:12039923-12039945 AGGTAAATAACAGGGCATGAAGG - Intronic
1146706594 17:35004823-35004845 AGGGAAATTATTGGGGGTGTAGG - Exonic
1147546845 17:41408408-41408430 AGGGAAATTACTGGGGAGGATGG - Intergenic
1147736769 17:42643856-42643878 ACAGAAATTGCTGGGTGTGATGG - Intergenic
1148187685 17:45656325-45656347 AGAGAAATTACAGGGTGCTGTGG + Intergenic
1150250958 17:63704267-63704289 AGGGTAAGGCCAGGGTGTGAAGG - Intronic
1152292042 17:79445568-79445590 AGGGAAATCACAGGGGAGGAGGG - Intronic
1152620248 17:81359850-81359872 AGTGATATTCCAGGGTGTGGAGG + Intergenic
1155059802 18:22218589-22218611 AGGCAAATGATAGGGTGTTAGGG - Intergenic
1156462732 18:37330704-37330726 AGGGTCATGACAGGGTGTGATGG - Intronic
1156552391 18:38031186-38031208 AGGGAAAGAAGAGGGTGGGATGG + Intergenic
1156951466 18:42905059-42905081 AGGGAAATTAAACTGTGTGAAGG - Intronic
1157241024 18:46009525-46009547 AGGGAACTTAGAGGGTGGCAGGG + Intronic
1158672698 18:59491273-59491295 AGAAAATTTACAGGGTGAGAGGG - Intronic
1161232475 19:3181239-3181261 ATGGAAATTGCTGGGTGTGGTGG + Intergenic
1161841442 19:6683736-6683758 AGGGAAATGGCCGGGTGTGGCGG - Intronic
1163771671 19:19194842-19194864 AGTGAAATTACTGGGTCAGATGG + Intronic
1165169999 19:33885397-33885419 AGGGAAATTGCTGGGTTTCACGG + Intergenic
1165857145 19:38886252-38886274 AGGAAAGTTACAGGGCGTGTGGG - Intronic
1165922198 19:39306329-39306351 AGTGAAATTTCAGAGAGTGAAGG + Intergenic
1166895539 19:46019768-46019790 TGGGAAATTAACGGGTGAGAAGG - Intronic
1167235724 19:48313593-48313615 TGGGAAATTGCTGGGTGTGGTGG + Intronic
1167397903 19:49243635-49243657 AGGTAAATAAAAAGGTGTGAGGG + Intergenic
925004287 2:429081-429103 AGGGAAGTTACTGGGTGACATGG + Intergenic
925706019 2:6685317-6685339 AGTGAAAACTCAGGGTGTGAGGG + Intergenic
925721774 2:6836380-6836402 AGGGAAGTTATAGGTTGAGATGG - Intergenic
925732441 2:6928922-6928944 AGGGAACTGACAGGGTCTGAAGG - Intronic
926251960 2:11159775-11159797 AGGGAGATGGCTGGGTGTGAGGG + Intronic
926677286 2:15636663-15636685 AGGGCAATAATTGGGTGTGAAGG + Intergenic
927477010 2:23421131-23421153 AGTGGAATTACAGGGTGGGCTGG - Intronic
931067231 2:58600349-58600371 AGGGAATTTGCAGTCTGTGATGG + Intergenic
931295003 2:60914614-60914636 AGGGAAATTTTAGGGGGTGATGG - Intronic
931371694 2:61669121-61669143 AGGAAAAATCCAAGGTGTGATGG - Intergenic
934909599 2:98239045-98239067 ATGGCAATGACAGGGTGGGATGG + Intronic
935108956 2:100074214-100074236 TGGGAAATTCCAAGGAGTGAGGG - Intronic
935593996 2:104865716-104865738 AGGGAAACTTCCAGGTGTGAGGG + Intergenic
935672560 2:105568271-105568293 AGGAAAACACCAGGGTGTGAGGG + Intergenic
936057078 2:109269357-109269379 CTGGAAATTACACGGTGTGTGGG - Intronic
936392427 2:112087491-112087513 GGGGAAATGACAGGGTCTGGGGG - Intronic
936441340 2:112556296-112556318 AGGGAATTACCAGGGAGTGAAGG - Intronic
936802595 2:116286036-116286058 AGGGAATTTCCAAGGTGTTAGGG + Intergenic
937101583 2:119275278-119275300 GGAGAAATTACAGGCTGTTAGGG - Intergenic
937477330 2:122227285-122227307 AGGGGAATCACAGGGTTGGAAGG + Intergenic
937484475 2:122300249-122300271 AAGGAAATGGCAGGGGGTGATGG - Intergenic
937890814 2:126937101-126937123 AGGGAAATTGCACAGGGTGAAGG + Intergenic
938122521 2:128644059-128644081 AGGGAAATTACACCCTGTAATGG + Intergenic
938874640 2:135519796-135519818 AGGGGAAGTACTGGGTGTTAAGG + Intronic
939530449 2:143353473-143353495 AGGTTAAATACATGGTGTGAAGG + Intronic
939539822 2:143479935-143479957 AGGGAAATTAAACATTGTGATGG + Intronic
941839974 2:170071484-170071506 AAGCAAATTTTAGGGTGTGATGG + Intronic
944365453 2:198913738-198913760 AGGGAGATGACAGTGGGTGATGG + Intergenic
945290958 2:208127017-208127039 AGGTAAATTGCATGTTGTGAAGG + Intergenic
945896850 2:215492733-215492755 TGGCAAATTCCAGGATGTGAAGG - Intergenic
946206260 2:218111128-218111150 AGGGAATTTCCAGGGTGCTAGGG - Intergenic
948018227 2:234707886-234707908 AGTGAAATTACTGGGTCAGATGG + Intergenic
948979440 2:241485505-241485527 GGGGAGATCACAGGGAGTGAGGG - Intronic
1169909118 20:10632954-10632976 ACGGAAATGACAGGGCGTGGAGG + Intronic
1170721801 20:18887728-18887750 AGTGAAATTGCTGGGTCTGAGGG + Intergenic
1170974599 20:21150292-21150314 AGGGAAATAACAGTGGGTGGAGG + Intronic
1172638912 20:36429229-36429251 ACAAAAATTACTGGGTGTGATGG - Intronic
1172827600 20:37803708-37803730 AGGGAATTTACATGGTTGGATGG + Intronic
1173238200 20:41267534-41267556 AGGGAAGGTACTGGGTGTGAAGG + Intronic
1173685298 20:44919181-44919203 AGGGAAAATGCTGAGTGTGAAGG + Exonic
1174711424 20:52709685-52709707 AGGTAAATTACATGTTGTGGGGG - Intergenic
1177283629 21:19019420-19019442 ACTCAAATTACAGGGTTTGAAGG - Intergenic
1178479134 21:32963989-32964011 AGGAAAATGGCAGGGTGGGAGGG + Intergenic
1179917704 21:44488456-44488478 AGCGAAAACTCAGGGTGTGATGG - Intergenic
1181679511 22:24483687-24483709 ATGGAAATTACTGGGTGTGGTGG + Intergenic
1181918195 22:26297803-26297825 AGGGAAAATAGAGGGTGGAAAGG - Intronic
1182647886 22:31825166-31825188 GGGGGAATTACAGGTTCTGATGG + Intronic
1183481908 22:38069880-38069902 AGGGAAATTGCAAGGTTTGGGGG - Intronic
1183528597 22:38339265-38339287 AAGGAAACCACAGAGTGTGAGGG + Intronic
1183657515 22:39196712-39196734 AAATTAATTACAGGGTGTGATGG - Intergenic
950335485 3:12189519-12189541 AGGGAAATTGCCGGGTGCGGTGG + Intronic
950532735 3:13562141-13562163 AGGGAAATTAGAGGGTGACCCGG - Intronic
952373993 3:32749927-32749949 AAGGAAATAACTGGGTGTGGTGG + Intronic
954157551 3:48694970-48694992 AGGGAAAGCACAGAGTGGGAGGG + Intronic
955157771 3:56434161-56434183 AAGGAAATTACAAGCTGTAATGG + Intronic
955194067 3:56788519-56788541 AGGGAAACTCCATAGTGTGATGG - Intronic
955624847 3:60907487-60907509 AGAGACATTACAAGGTATGAGGG + Intronic
956534841 3:70264772-70264794 AGGGAAAATACAGGGAGCTATGG + Intergenic
962286505 3:134090677-134090699 AGGGAACTTTCTGGGGGTGAGGG + Intronic
962481412 3:135801609-135801631 TGGGCAATTACAGTGTGAGAAGG + Intergenic
963929036 3:150982812-150982834 AGGGAAACTACAAGGGATGATGG + Intergenic
964291774 3:155189151-155189173 ACAGAAATTACCGGGCGTGATGG - Intergenic
965693176 3:171379667-171379689 AGAAAAATTACAGGAGGTGATGG - Intronic
965776097 3:172232994-172233016 ATTGAAATCACATGGTGTGAAGG + Intronic
966520520 3:180869288-180869310 AGTGAAATTTCGAGGTGTGAGGG + Intronic
966521661 3:180880519-180880541 AGAAAAATTACCGGGTGTGTTGG - Intronic
966749728 3:183310505-183310527 AAAAAAATTACCGGGTGTGATGG + Intronic
967733319 3:192926533-192926555 AGAGAATGTAAAGGGTGTGAGGG - Intergenic
967836164 3:193964932-193964954 AGGGGAATGACAGGGTTAGAAGG + Intergenic
970224695 4:13845563-13845585 TGGGAACTGACAGGGTCTGATGG + Intergenic
971444078 4:26723543-26723565 AGGGAAATGACAGGCTATGGTGG + Intronic
971634360 4:29037299-29037321 AACGAAATTAAAGGGTGGGATGG - Intergenic
972513666 4:39793242-39793264 AAAGAAATTACTGGGTGTGGTGG + Intergenic
972561880 4:40236087-40236109 ATGGGAATTACAGTGTGTGTTGG + Intronic
972657513 4:41079014-41079036 AGGGAAATTACCATGGGTGAGGG + Intronic
974527069 4:63058903-63058925 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
977895540 4:102360850-102360872 AGGGAAAGAACAAGGTTTGAAGG - Intronic
979239354 4:118434770-118434792 AGGGAAACAGCAGGGTGAGATGG + Intergenic
980474257 4:133291204-133291226 ATGGCCATTGCAGGGTGTGAAGG + Intergenic
980809480 4:137856812-137856834 GGGGAAATTAAAGGGGGAGAGGG - Intergenic
984562371 4:181285936-181285958 ACAAAAATTACAGGGTGTGGTGG - Intergenic
984898123 4:184560174-184560196 ATGGAAATCACATGGTGTAAGGG + Intergenic
985188478 4:187345256-187345278 AGGGAAATTCCAGTGTGTTGTGG - Intergenic
985496933 5:213815-213837 AGTGAAATTACTGGGTTTTATGG - Intronic
985781412 5:1873773-1873795 GGGTAAATTAAAGGGTGTGGTGG + Intergenic
986365068 5:7021451-7021473 AGTGAAAATTCAGGGTGTGATGG + Intergenic
986687654 5:10288638-10288660 AGGAAAAGTAGTGGGTGTGAAGG + Intronic
986714092 5:10510244-10510266 AGGGAAAATACAAAGTGTGTGGG + Intronic
987651934 5:20752412-20752434 AGGGAAACTAGAGGTTGAGACGG - Intergenic
987726260 5:21703798-21703820 AGGTAGATTACAGGGTGAAAGGG - Intergenic
988743629 5:34109066-34109088 AGGGAAACTAGAGGTTGAGACGG + Intronic
992049902 5:72932366-72932388 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
993223323 5:85132491-85132513 ACAGAAATTACAGGCTGAGATGG + Intergenic
993968352 5:94386414-94386436 AAAGAAATTACAAGTTGTGACGG + Intronic
995457961 5:112371900-112371922 ATGGACAATACAGGGTGTGGTGG + Intronic
996680742 5:126226216-126226238 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
998952789 5:147408707-147408729 AGGTAAGTTACAGGGGATGAAGG - Exonic
999824787 5:155263680-155263702 AGGGCAAATACAGGATGTTATGG - Intergenic
1000406231 5:160891336-160891358 AGGAAAATCACTGGGGGTGAAGG - Intergenic
1000786623 5:165552527-165552549 AGCAGAATTTCAGGGTGTGAAGG - Intergenic
1001235365 5:170024880-170024902 AGGGAAATTACAGGGTTCCAGGG - Intronic
1001618048 5:173057590-173057612 AGGGCGATTACAGGGTTTGGCGG - Intronic
1002079649 5:176729714-176729736 AGGGCATTTACAGGATGTGTGGG + Intergenic
1002363960 5:178695843-178695865 AGGCTACTGACAGGGTGTGATGG + Intergenic
1002739597 5:181425350-181425372 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1003037662 6:2659121-2659143 ATGGAAATCAGAGAGTGTGACGG + Intergenic
1003622385 6:7712335-7712357 AGGGAAATTACAGGACTTGGTGG - Intergenic
1006833571 6:36983795-36983817 AGGCAAATTACTGGGAGTGGGGG - Intronic
1006936773 6:37724056-37724078 AGGGAATCTGCAAGGTGTGAGGG - Intergenic
1007235741 6:40390466-40390488 TTGGAAATTACAGGGTGGAATGG - Intergenic
1009725440 6:67531428-67531450 AGTGAAAACTCAGGGTGTGATGG + Intergenic
1010532320 6:76983643-76983665 AGGAAAATTACAGATGGTGAAGG + Intergenic
1010709926 6:79162014-79162036 AGGCCAATTACAAGGTGTCAGGG - Intergenic
1011001255 6:82590754-82590776 TGGGGAATTTCAGGGTGGGAGGG + Intergenic
1011281311 6:85680629-85680651 AGAAAAATTACAGGGCGTGATGG - Intergenic
1011326048 6:86150898-86150920 AGTGAAAACTCAGGGTGTGATGG + Intergenic
1012961521 6:105627299-105627321 ATGGAAATTAAAGTGTCTGATGG - Intergenic
1013898950 6:115129277-115129299 AGGAAAATTACAGGTAGTTAAGG + Intergenic
1014005178 6:116409752-116409774 TGGGAAACTACAGTGTGTAATGG + Intronic
1014187474 6:118452403-118452425 AATGAAATTAAAGGGTGGGAAGG + Intergenic
1014199518 6:118593163-118593185 TGGGAAAATAGAGGGTTTGAAGG + Intronic
1015216185 6:130752545-130752567 ATGGAAATTACAGTTTGTAAAGG + Intergenic
1016366599 6:143325309-143325331 AGGAAGAGTACAGGGTCTGAAGG - Intronic
1016589065 6:145723176-145723198 AGGTAAATTACAGTTTGTGCAGG + Intronic
1016978638 6:149833357-149833379 ACAGAAACTACAGGATGTGAGGG + Intronic
1017533554 6:155322168-155322190 AGAGAGATGACAGTGTGTGAAGG + Intergenic
1018072589 6:160178652-160178674 AGGGAAAAGACAGGGAGAGAGGG - Intronic
1019025575 6:168960050-168960072 AGGGAAAATACAGAGTTTGAAGG - Intergenic
1019244713 6:170700937-170700959 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1019783557 7:2959111-2959133 TGGGAAATTACAGCGTGTGTGGG - Intronic
1022011515 7:26311516-26311538 AGGGAATTGTCAGGGTGTGTGGG + Intronic
1022224398 7:28348006-28348028 AGGGAAATTGTAGGGAGAGAGGG + Intronic
1022594269 7:31697134-31697156 AGGGCATTTGCAGGGGGTGATGG + Intronic
1023050633 7:36248031-36248053 AAGGAACACACAGGGTGTGAGGG + Intronic
1023546446 7:41322981-41323003 TGGGATATTAAAGGGTGAGATGG - Intergenic
1024482232 7:49875690-49875712 AGGGTAATAACAGTGTCTGATGG + Intronic
1024870275 7:53956641-53956663 AGGGAATTTCCAGGGTGCTAGGG - Intergenic
1024965092 7:55017754-55017776 AGGGAAGTTCCAGGTTGTGCGGG + Intergenic
1025075220 7:55936819-55936841 ATGGAAATGACAAGGGGTGAGGG + Intronic
1026867388 7:73832075-73832097 ACGGAAGTGACAGGGTGTGGTGG + Exonic
1027495804 7:78886807-78886829 AGGTAAATTACATGGTGATATGG + Intronic
1027819123 7:83021154-83021176 AGGATGATTATAGGGTGTGAGGG - Intronic
1029875048 7:103741677-103741699 AGGGAAAAGACAGGGAGGGAGGG + Intronic
1031323674 7:120365148-120365170 AGGGAAAATGGAGGGTGGGAGGG + Intronic
1031632153 7:124056492-124056514 AGTGATATTACAGGATTTGACGG + Intergenic
1031841233 7:126742091-126742113 ATGGAAAATACAGGGTTTGCAGG - Intronic
1032917932 7:136512171-136512193 AGTGAAAATTCAGGGTGTGAGGG + Intergenic
1033870870 7:145752066-145752088 AGTGAAAATTCAGGGTGTGATGG + Intergenic
1034054146 7:148016725-148016747 AGGGAAATTTCTGGTTGTCAAGG + Intronic
1034887439 7:154808699-154808721 TGGGAAATTACAGGGATTGACGG + Intronic
1035503413 8:107251-107273 AGGGAAACAGCAGGGTGAGATGG - Intergenic
1035929316 8:3763476-3763498 AGGTATATCACAGGGTGAGAAGG - Intronic
1037767579 8:21781583-21781605 AGGGAAGACACAGGGTGCGATGG - Intronic
1039552993 8:38456721-38456743 AGGAAATTAACTGGGTGTGATGG - Intronic
1044551297 8:93515419-93515441 AGGAAAATTACAGTGTGCAATGG - Intergenic
1045800116 8:106092531-106092553 AATGAAATTACAGACTGTGATGG + Intergenic
1046225774 8:111278640-111278662 AGGGAAATTACTGAGTGTTTTGG - Intergenic
1051949919 9:22619244-22619266 AGAGAAATGACAGGGAATGAGGG - Intergenic
1052053653 9:23879508-23879530 AAGGATATTAGAGGGTGGGAAGG - Intergenic
1054729586 9:68687137-68687159 AGGGAAGTTGGAGGGTCTGAAGG - Intergenic
1054733800 9:68729883-68729905 AGGGAAATTACTGGATCTAAGGG - Intronic
1054978084 9:71171666-71171688 AGGAAAAGCACAGGGTGTGTTGG + Intronic
1055089659 9:72349968-72349990 AGTGAAGATTCAGGGTGTGAAGG - Intergenic
1055308621 9:74955041-74955063 ACGGTAATTACCGGGAGTGAGGG - Intergenic
1055862644 9:80771480-80771502 AGGAAAATTTCATGCTGTGACGG + Intergenic
1056392267 9:86151230-86151252 AGGGAATTTCCAGGGTGTTAGGG - Intergenic
1056772438 9:89489239-89489261 AGTGGAATTACAGGGTTTCATGG - Intronic
1057157801 9:92859422-92859444 AGGGAACTTAGAGGGAGAGAGGG + Intronic
1057719478 9:97520436-97520458 AGGGAAGACACAGGGTGGGAGGG - Intronic
1057789264 9:98112511-98112533 AAGGAAATGGCAGGGTGTGGTGG + Intronic
1058777519 9:108299482-108299504 AGGGAAATTACAAGTGGAGAGGG - Intergenic
1059641141 9:116218251-116218273 AGGGAAGGTGCAGGGTGTGAGGG - Intronic
1060531023 9:124347060-124347082 AGGGAACCTTCAGGGTGGGAGGG - Intronic
1061215940 9:129222177-129222199 ATGCAAATTTCAGGATGTGAGGG - Intergenic
1061424320 9:130489630-130489652 AGGGAAAGTGCAGGGCATGAGGG + Intronic
1062237833 9:135521188-135521210 AGGGAAACTGAAGGGAGTGAAGG - Intergenic
1062442247 9:136576057-136576079 AGAGACATAACAGGGTGTGGAGG + Intergenic
1203604903 Un_KI270748v1:50157-50179 AGGGAAACAGCAGGGTGAGATGG + Intergenic
1186039575 X:5461129-5461151 AGGGAAACTTCAGAGGGTGAAGG + Intergenic
1187518632 X:19994062-19994084 AAGGAAATGAAAGGGTGAGATGG - Intergenic
1188011420 X:25060265-25060287 AGGGAGGAGACAGGGTGTGAAGG + Intergenic
1188442657 X:30228719-30228741 AGGGAAACTACATGGTGGGCTGG + Intergenic
1188612783 X:32119883-32119905 AGGGTGACCACAGGGTGTGATGG - Intronic
1190036697 X:47031919-47031941 AGGGAAATTGCATGGAGTGGAGG + Intronic
1191059771 X:56282650-56282672 AGGTAATTTACAGGGAGTAAAGG + Intronic
1195129963 X:101841772-101841794 AGTGGAACTACAGGGAGTGAAGG + Exonic
1195176258 X:102318012-102318034 AGTGGAACTACAGGGAGTGAAGG - Exonic
1195182606 X:102369081-102369103 AGTGGAACTACAGGGAGTGAAGG + Exonic
1195744272 X:108099007-108099029 AGAGCAATTACAAGGTGGGACGG + Intronic
1196068934 X:111497850-111497872 AGGGAAATAACTGGATGTGGTGG + Intergenic
1196267387 X:113666197-113666219 AGGGAAATTTCTGGGGGTAATGG - Intergenic
1196520046 X:116661955-116661977 AGTGAAAACTCAGGGTGTGATGG - Intergenic
1197186256 X:123590504-123590526 AGGAAAAGTACAGGGTGCTAAGG - Intergenic
1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG + Intronic
1197513904 X:127401083-127401105 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
1197626427 X:128807438-128807460 AGGGAAATGACTTGGTGTAAGGG + Intergenic
1198161076 X:134008980-134009002 ATGGCAATTACAGGTGGTGATGG + Intergenic
1198320498 X:135514740-135514762 AGAGGAAATACAGGGTGTTATGG - Intergenic
1198509334 X:137333727-137333749 AGGAAAATAACAGGCTCTGAGGG + Intergenic
1201455599 Y:14164315-14164337 AGGGAATTTCCAGGGTGCTAGGG + Intergenic
1201702116 Y:16895155-16895177 ATGGTAATTACCAGGTGTGATGG - Intergenic
1201725234 Y:17143248-17143270 AGGGAATTTACTGGGTGAAAAGG + Intergenic