ID: 1197306943

View in Genome Browser
Species Human (GRCh38)
Location X:124854083-124854105
Sequence GGAGTGAAGGCAATGATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197306943 Original CRISPR GGAGTGAAGGCAATGATTAT TGG Intronic
901955127 1:12778571-12778593 GGAGAGAAGGCAAGTGTTATGGG - Intergenic
905144812 1:35879812-35879834 AGAGTGAAGTCCCTGATTATAGG + Intronic
907853778 1:58281509-58281531 GGAGTGGAGGCAAGGATACTAGG - Intronic
910328805 1:86044619-86044641 ATAGTGAATGAAATGATTATGGG - Intronic
913059050 1:115188032-115188054 GGAGTGAAGAAAATCAATATGGG - Intergenic
916087229 1:161280259-161280281 GGAGGGAAGGCAGAGCTTATAGG - Intronic
916690924 1:167189551-167189573 GGAGAGATGGCAGTGATTACAGG + Intergenic
918628529 1:186687119-186687141 GCAGTGAAAGCAATGCTTAGAGG + Intergenic
919228854 1:194745724-194745746 GGAGTGAAGGCAGTGTTGTTGGG + Intergenic
920089713 1:203443573-203443595 GGAGTGACAGCAATTATGATGGG - Intergenic
920980260 1:210827770-210827792 GAAGCCAAGGCAATGACTATTGG - Intronic
920990724 1:210936783-210936805 GGAGTAAAGGTAAAGATCATTGG - Intronic
1063670336 10:8095080-8095102 GGAGTGAAGACAAGGATAAAAGG + Intergenic
1064114094 10:12562833-12562855 GGAATGGAGGCAAGGATTAGGGG + Intronic
1064369147 10:14735964-14735986 GGAAGGTAGGGAATGATTATAGG + Intronic
1065370597 10:24981069-24981091 GGACAGAATGCACTGATTATGGG + Intergenic
1067749546 10:48961603-48961625 GGAATGAAGGCAAAAATTTTTGG + Intronic
1069497744 10:68921591-68921613 GGACTGATGGCACTGATTATTGG - Intronic
1070953026 10:80446055-80446077 GGAGTGCAGGCAATGGCAATGGG - Intergenic
1072446463 10:95503056-95503078 GGAGTCAGGGCAATGAGTAGAGG - Intronic
1073630300 10:105141538-105141560 GGTGCGAGGGCAATGATGATAGG - Intronic
1075209645 10:120480293-120480315 GGAGTGCATCCAAGGATTATTGG + Intronic
1077390222 11:2297331-2297353 GGAGTGAAGGCAGTGAATTTGGG - Exonic
1077943691 11:6871556-6871578 AGTGTGAAGGAAATAATTATTGG - Intergenic
1079834273 11:25312774-25312796 GCAGTGAAAGCAATGATTTGAGG - Intergenic
1082262502 11:50087916-50087938 GGGGTGAAGGAAATGATTTCAGG + Intergenic
1083100197 11:60296617-60296639 GTAGTGAAAGCAATGCTTAGAGG - Intronic
1083389900 11:62340694-62340716 AGAGGGAAAGCAAAGATTATGGG + Intronic
1085538837 11:77246909-77246931 TGAGTGAAGGCAGTGATAAAAGG + Intronic
1086027524 11:82312596-82312618 GGAGAGAGGGCAATGAGTAGTGG - Intergenic
1086753314 11:90527130-90527152 GGAGTGAAGACTATGTTTAATGG + Intergenic
1086772250 11:90781045-90781067 TGTGTGAAAGCAAGGATTATTGG + Intergenic
1087101230 11:94367207-94367229 GGTTTGAAGGCAATGAAGATTGG + Intergenic
1087205092 11:95386117-95386139 GGATTAAAGGGAATGATTATAGG + Intergenic
1090222829 11:125045571-125045593 GCAGTTAATGCAATTATTATAGG - Intergenic
1090674998 11:128983733-128983755 TGAATGAAGGGAATGATTAAAGG + Intronic
1091962328 12:4707269-4707291 GCAGTGAAAGCAATGTTTAAAGG + Intronic
1092661351 12:10741567-10741589 GGAGAGATGGCAAGGATCATTGG + Intergenic
1093607614 12:21111716-21111738 GGATTGAAGGCAGTCAGTATTGG - Intronic
1094330129 12:29282184-29282206 GGAATGAAGTCAATGCTGATTGG + Intronic
1096027912 12:48383889-48383911 GCAGTGGATACAATGATTATTGG + Intergenic
1099038448 12:77619815-77619837 GGAGTGAAAGTAATTATTTTAGG + Intergenic
1100013537 12:89981843-89981865 GCAGTGAAGGCAGTGAGAATTGG - Intergenic
1101084665 12:101223465-101223487 GGAGGGAAGGCAATTATCAAAGG + Intergenic
1101300877 12:103479325-103479347 GAAGTTAAGGCAAGGAATATTGG + Intronic
1106757120 13:32833112-32833134 AGAGTGAAGGCAGTGATTTGAGG - Intergenic
1107462190 13:40615014-40615036 GGAGTGATGGGAGTGATCATTGG - Intronic
1108476969 13:50829834-50829856 TGGTCGAAGGCAATGATTATTGG - Intronic
1109306290 13:60645676-60645698 GGAGTGAAGGAAATGACAAGAGG - Intergenic
1110387430 13:74929933-74929955 GGAGTGACTGCAAAGAGTATGGG + Intergenic
1110696403 13:78496406-78496428 AGAGTGTAGGCAATGATGACGGG + Intergenic
1112492721 13:99881793-99881815 GGATTGAAGGCAGTGATATTTGG - Intronic
1114547040 14:23510621-23510643 GGGGTGAAGGCAAAGGGTATAGG + Intergenic
1114855250 14:26431201-26431223 GGACTGCAAGCAATGTTTATAGG + Intergenic
1115794102 14:36913338-36913360 GGAGTGCAGTGAATGATCATGGG + Intronic
1118212761 14:63780920-63780942 GGGGTGATGGGAATGTTTATCGG + Intergenic
1119636564 14:76278112-76278134 AGAGGGAAGGAAATGATTGTAGG + Intergenic
1121421370 14:93818095-93818117 GGAGGGAAGGCAAAGAGTTTAGG - Intergenic
1124509487 15:30311028-30311050 GGAGTGAGGGCCATTATCATAGG + Intergenic
1125217822 15:37297502-37297524 GGAATGATGCCAATGAGTATGGG - Intergenic
1127129182 15:55844199-55844221 GGAAAGAAGGCAGGGATTATAGG + Intronic
1127349275 15:58134332-58134354 AGAGTGAAGGGAATGTTGATTGG + Intronic
1129149941 15:73682297-73682319 GGAGGGAAGGAAATGTGTATTGG - Intergenic
1129777629 15:78247083-78247105 GGATTGAAGGCACTGAGTTTTGG + Intergenic
1129836948 15:78714619-78714641 GGAGGGAGGTAAATGATTATGGG + Intronic
1131029879 15:89177636-89177658 GGAGTGAAGGAAAAGATTCCTGG - Intronic
1133879019 16:9763434-9763456 GGAGTGGAGGAAAGGGTTATCGG + Exonic
1137762054 16:50948872-50948894 GGAGTGAAAACAATTATAATGGG + Intergenic
1143323514 17:6083286-6083308 GGAATGAAGGCAATGAAGAGAGG - Intronic
1143864375 17:9913218-9913240 GTAGGGATGGCAAGGATTATGGG + Intronic
1144346768 17:14356495-14356517 GGAGGGAAGTCAATGAGTTTGGG + Intergenic
1145766266 17:27460232-27460254 GGAATGAAGGTAATTATTACTGG - Intronic
1146482146 17:33213377-33213399 GAAGAGAAGGAAATGATGATGGG + Intronic
1150747047 17:67825112-67825134 GGAGGGAAGGGAATGATATTTGG + Intergenic
1154109165 18:11551222-11551244 GGAAAGAAAGCAATGAATATAGG - Intergenic
1155531453 18:26771058-26771080 GTAGTGTAGACTATGATTATGGG + Intergenic
1155721387 18:29016917-29016939 GTAGTGAAGGAAATGTTTATAGG - Intergenic
1156359678 18:36373464-36373486 GGAGTGAAGGAAATTATTTCTGG + Intronic
1157718567 18:49906238-49906260 GGTGAGAAGGCATTGATTATAGG + Intronic
1159801354 18:72904235-72904257 GAAGTGTAGGCAATTATTAAAGG + Intergenic
1162294909 19:9806721-9806743 TGGGAGAAGGCAATGATTAGGGG + Intergenic
1166347234 19:42174320-42174342 GGAGTGAAGGCTCTGTGTATGGG - Intronic
926453608 2:13037652-13037674 GGAGTGAGGACAATGATAATCGG + Intergenic
927987186 2:27420266-27420288 GGAGTGATGGCAACGAATACAGG - Intergenic
933243912 2:79953744-79953766 GGATTGAAGGGAATGATATTTGG + Intronic
933521952 2:83385251-83385273 GGAGACAAGGCAATGACTAATGG - Intergenic
935509598 2:103955197-103955219 TGTGTGAAGACAATGATTTTAGG + Intergenic
935540396 2:104341147-104341169 GAGGTGAAGGAAATGTTTATGGG + Intergenic
938792179 2:134686301-134686323 GGAGAGGAGGCCATGAATATGGG + Intronic
939068932 2:137516760-137516782 GGGGTGAGGGCAATGATGATGGG + Intronic
939169035 2:138672808-138672830 GGATTGAAAGCAATAATTTTGGG - Intronic
939222859 2:139325351-139325373 GGAGAGAAGTCAATGAGTATTGG - Intergenic
940274729 2:151927384-151927406 GGAGAGAAGGCAGAGAATATGGG + Intronic
941953206 2:171177540-171177562 GGAGGGAAGGGCATGGTTATTGG + Intronic
942507629 2:176660321-176660343 GGAGTGAAGGGAATGACTATTGG + Intergenic
947101052 2:226621673-226621695 GGAGAGAAGTGAATGATTTTAGG - Intergenic
1169271705 20:4204868-4204890 GAAGTCAAGGCCATGATTAAAGG - Intergenic
1170505741 20:17024187-17024209 GGGGTGAGGGGAATGATTTTGGG - Intergenic
1170825557 20:19791921-19791943 GGAATGAAGATAATAATTATGGG - Intergenic
1171343485 20:24448121-24448143 GGAGAGAAGGGAACGGTTATAGG + Intergenic
1171415358 20:24975905-24975927 GGAGTAAAGGCAATGCATAATGG + Intronic
1172152971 20:32803598-32803620 GGAGAGAAGACAATGATTTGGGG + Intronic
1173253578 20:41377263-41377285 GGAGTGGAGGCAGTGACTGTGGG + Intergenic
1173362898 20:42360303-42360325 GGAGGGAAGGCAATGAGTCTGGG - Intronic
1176992869 21:15520158-15520180 TGACTGAAGGAAATAATTATGGG + Intergenic
1178031602 21:28533710-28533732 GCAGTGAAAGCAGTGATTATGGG - Intergenic
1178759233 21:35384768-35384790 GGAGGGAAGGCAAAGATATTTGG - Intronic
1179825830 21:43965995-43966017 TGAGTGAAGGAAATGATAAAAGG + Intronic
1180392442 22:12297276-12297298 GGAGTGCAGGGGCTGATTATAGG + Intergenic
1180407306 22:12567492-12567514 GGAGTGCAGGGGCTGATTATAGG - Intergenic
1182041356 22:27241170-27241192 GGAGTGATGGGAATTATCATGGG - Intergenic
1182341466 22:29624667-29624689 AAAATGAAGGCAATGATTAAAGG - Intronic
1185006884 22:48283902-48283924 GTAATGAAGGCAATGCTTAGAGG + Intergenic
952691904 3:36218481-36218503 TGAATGCAGGCAGTGATTATGGG - Intergenic
953360870 3:42295188-42295210 GGATTGAAGGCCATGTTTCTAGG + Intergenic
954889212 3:53908596-53908618 GCAGTGAAAGCAATGCTTAGAGG + Intergenic
957431550 3:80115386-80115408 AGAGTGCAGGAAATGATTTTAGG + Intergenic
958126862 3:89367646-89367668 GGAGTAAAGGAAATTATGATTGG - Intronic
962214740 3:133511478-133511500 GGAGTGAAGGCTATTATTGTAGG + Intergenic
962994279 3:140610171-140610193 GCAGCAAAGGCAATGATTACAGG - Intergenic
964808287 3:160635437-160635459 GGAGTGAAGGGAATGATGAGGGG + Intergenic
965627529 3:170696568-170696590 GGATTGAAGGCATTGATTTAGGG - Intronic
966650125 3:182291255-182291277 GCCATGCAGGCAATGATTATAGG - Intergenic
966988998 3:185209826-185209848 GGAGAGAAGACAGTGGTTATAGG + Intronic
970976671 4:22049724-22049746 GGAGTAATGGCAATGTTAATTGG - Intergenic
972298379 4:37761953-37761975 GGAATAAGGGGAATGATTATGGG - Intergenic
975954848 4:79825173-79825195 GCAGTTAATGCAATTATTATAGG + Intergenic
977139592 4:93351606-93351628 GGAGTTAAGTCAGTGATAATAGG + Intronic
977343403 4:95788889-95788911 GCTGTGAAGGCCATTATTATTGG - Intergenic
979558948 4:122080487-122080509 GGAGGGAGGGCAATGCTTAGAGG + Intergenic
980645809 4:135641258-135641280 GGAATCAAGGCAAGGATTATGGG + Intergenic
986054555 5:4122995-4123017 TGAGTTAAGGCAAGGAATATTGG + Intergenic
988126255 5:27042065-27042087 GGAGAGGAGGAAATGATTACTGG - Intronic
989490286 5:42043876-42043898 GCAGTGAAAGCAATGCTTAGAGG + Intergenic
990254258 5:53948937-53948959 GCAGTGAAGGTAATGATTTGCGG - Intronic
990356030 5:54967159-54967181 CAAGTAAAGGCAATGATTAGAGG - Intergenic
992334799 5:75755331-75755353 TCACTGAAGGCAATGAATATTGG - Intergenic
995381652 5:111541858-111541880 TCAGTGAAGGCAATGAGTAATGG + Intergenic
998033108 5:138890341-138890363 GAAGTGAAGGCAAATCTTATTGG - Intronic
998085314 5:139316855-139316877 AAATTAAAGGCAATGATTATAGG + Intronic
999360834 5:150985415-150985437 GGAGGGAAGGCAAGGGTTAAAGG + Intergenic
999925817 5:156375662-156375684 GGAGTGAATGCAGTGAGCATGGG - Intronic
1001124802 5:169009928-169009950 GCAGTGAAGGCAAGGCTGATTGG - Intronic
1003784168 6:9465139-9465161 GGAGTTAAGAAAGTGATTATAGG - Intergenic
1006078702 6:31551459-31551481 GGAGTGAAGGCACTGAGCTTGGG - Intronic
1008392267 6:50966091-50966113 GGAGGGAAGGCATAGATAATGGG + Intergenic
1010298474 6:74229748-74229770 GGAGTGAAGTGATTGATTAATGG + Intergenic
1011398381 6:86934597-86934619 GGAGAGAATGAAATGTTTATAGG - Intergenic
1012264112 6:97120218-97120240 GGAGGGAAGGAGATAATTATGGG + Intronic
1013275500 6:108581033-108581055 GGAGAGAAAGCAATGACTACAGG - Intronic
1014112780 6:117638318-117638340 GGAGTGGAGGCAGTGTTGATAGG - Intergenic
1015460049 6:133480102-133480124 GGAGTGAAGACAGTGATCAGAGG + Intronic
1015544427 6:134347087-134347109 GAAGTGAAGGAAAGAATTATGGG - Intergenic
1020967149 7:14885411-14885433 GGAGAGAAAGCAATGTTTCTTGG + Intronic
1021894505 7:25221603-25221625 TGAGTGAAGGAAATGAGCATTGG - Intergenic
1023116474 7:36867655-36867677 GCAGTGAAGGCAGTGCTTAGAGG - Intronic
1025184676 7:56848367-56848389 GGGGTGAAGGAAATGATTTCAGG + Intergenic
1025687254 7:63728595-63728617 GGGGTGAAGGAAATGATTTCAGG - Intergenic
1025910951 7:65828107-65828129 GGGGTGAAGGAAATGATTTTGGG - Intergenic
1026367296 7:69661432-69661454 CGAGAGAAGGCAATGATCACTGG - Intronic
1028159686 7:87471511-87471533 GGAGAGAAGACAATGAATAGGGG + Intronic
1029901344 7:104043561-104043583 GGAGAAAAGGGAATGCTTATAGG + Intergenic
1030712276 7:112764338-112764360 GGAGTGAAAGGAATTATTTTAGG - Exonic
1031033546 7:116762244-116762266 GGAGTGAAGACACTGAATTTTGG + Intronic
1031092398 7:117375129-117375151 GGAATGAAAACAATTATTATAGG + Intronic
1032775810 7:135111302-135111324 GAAGTGAAGGTAATGAATGTTGG - Intronic
1035235707 7:157496602-157496624 TGAGTGACGGCAGTGCTTATTGG + Intergenic
1035410930 7:158640720-158640742 GGAGGGAAGGAAAAGAATATAGG + Exonic
1035519177 8:263290-263312 GGAGAGAAGGCTATGATTATGGG + Intergenic
1036025987 8:4909628-4909650 GAAGTAAAGGCAATGAGTGTAGG + Intronic
1036047947 8:5165051-5165073 GTAGTGATGCCAATTATTATTGG - Intergenic
1036652213 8:10652234-10652256 GGGTTGAAGGAAATGATTTTAGG + Intronic
1037301001 8:17451846-17451868 GGAGAGTTGGCAATGATTATTGG + Intergenic
1040430287 8:47333933-47333955 GTAGTGAAAGCAATGCTTAGAGG - Intronic
1042079633 8:65037212-65037234 GGAGTCAAGGCATTGATTTTAGG - Intergenic
1042765325 8:72315008-72315030 CCAGTGCAGGCAATTATTATTGG + Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1044115157 8:88327006-88327028 GGAGTGAAGGAAATGTTTCAGGG + Intronic
1045130986 8:99152159-99152181 GCAGTGAAAGCAATGCTTAGAGG - Intronic
1046707893 8:117476648-117476670 GGAATTGAGGAAATGATTATTGG + Intergenic
1047257680 8:123228004-123228026 GGGTGGAAGGCAATGATTTTAGG - Intronic
1048387471 8:133925829-133925851 GGAGAGAAAGCAGTTATTATGGG + Intergenic
1050889412 9:10805021-10805043 TGATTAAAGGCAATGAGTATGGG + Intergenic
1052456301 9:28703269-28703291 AGAGTGAAAACAATGATTACAGG - Intergenic
1055075387 9:72209749-72209771 GTAGTGAAGGCAGTGAATTTGGG + Intronic
1056559811 9:87720248-87720270 GGGGAGAAAGCAATGATGATGGG + Intergenic
1058387823 9:104459710-104459732 TGAGTGATGGCAAGAATTATAGG + Intergenic
1058804129 9:108573977-108573999 GTAGTGAGGGAAATGATTCTAGG + Intergenic
1059326965 9:113509728-113509750 GGTGTGAAGGCGATGCTTCTAGG + Intronic
1061823445 9:133241418-133241440 TGAGTGAAGACGATGATTCTAGG + Intergenic
1186591893 X:10939375-10939397 GGAGTGACAGCAATGATTTCAGG + Intergenic
1187080153 X:15977386-15977408 GGGGTGAAGGCTGTGAGTATAGG + Intergenic
1187802684 X:23081699-23081721 GGATTGCAGGCAATGGATATGGG - Intergenic
1189536705 X:41942709-41942731 GGAGCGAAGGAAAAGATGATTGG + Intergenic
1190547381 X:51542787-51542809 GCAGTGAAAGCAGTGCTTATGGG - Intergenic
1195343126 X:103924340-103924362 GGAGTGAGGGCAAGCATTCTAGG - Intronic
1195363860 X:104109103-104109125 GGAGTGAGGGCAAGCATTCTAGG + Intronic
1197306943 X:124854083-124854105 GGAGTGAAGGCAATGATTATTGG + Intronic
1198494890 X:137182184-137182206 GGAAAAAAGGCAATGTTTATGGG - Intergenic
1198651904 X:138872417-138872439 GCAGTGATGGAAATGATGATGGG + Intronic
1199536500 X:148908181-148908203 GCAGTTAAGGCAATCATTACAGG + Intronic
1200804645 Y:7420532-7420554 AGACTAAAGTCAATGATTATGGG + Intergenic