ID: 1197310017

View in Genome Browser
Species Human (GRCh38)
Location X:124893433-124893455
Sequence AAAGATATGAAAAGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 669}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197310017 Original CRISPR AAAGATATGAAAAGTGTGTT TGG Intronic
900708122 1:4093416-4093438 ACAGTTATGACAGGTGTGTTGGG + Intergenic
902915487 1:19636561-19636583 ACAGATATGAAAATTGTAATAGG - Intronic
903297860 1:22356731-22356753 AAGGATATGAACAGTGTCCTTGG - Intergenic
904918546 1:33987730-33987752 AAAGTGATGAAGAGTCTGTTTGG - Intronic
905060920 1:35138312-35138334 AACGATATGAATAAAGTGTTAGG - Intergenic
905062439 1:35151158-35151180 AAAAATATGAAAAATTAGTTGGG - Intergenic
906642157 1:47447844-47447866 AAAGAAATGATAAGTGTTTGAGG - Intergenic
906998505 1:50825122-50825144 AAAGAAATGATAAGTGTTTGAGG + Intronic
910179513 1:84466064-84466086 TCAGATATGTAAAGTATGTTAGG + Intergenic
910429304 1:87145434-87145456 AAAGAAATGATAAGTATGTGAGG - Intronic
911190561 1:94944590-94944612 AAAAATATGAAAAGCACGTTTGG + Intergenic
911540414 1:99151075-99151097 AAAGAAAAGAAAAGTGAGTAGGG - Intergenic
911546284 1:99221549-99221571 AATGAAATGAAAAGTGTTTGAGG + Intergenic
912006461 1:104907717-104907739 GAAAATTTGAAAAGTTTGTTAGG + Intergenic
912015712 1:105032879-105032901 AAATATATCAAAGGGGTGTTAGG - Intergenic
912129594 1:106585477-106585499 AAAAATATGAAAAGAGAGGTCGG - Intergenic
912493749 1:110077930-110077952 AGAGGTATGAAAAGTGCATTAGG + Intergenic
913373367 1:118125351-118125373 AAAGAAATGATAAGTGTTTGAGG - Intronic
913379535 1:118194003-118194025 AAAGAAATGATAAGTGTTTGAGG + Intergenic
913637651 1:120779682-120779704 ATAGATATGTAAGGGGTGTTGGG + Intergenic
914901854 1:151715333-151715355 AAAGATCTGGAAAGTGTGGGAGG - Intronic
915240311 1:154516505-154516527 AAGGATGTGCAAAGTGTGTGCGG + Intronic
915387154 1:155505822-155505844 AATGATAATAATAGTGTGTTAGG - Intronic
915882236 1:159684241-159684263 AAAGATCTGAAAAGTGCTTATGG - Intergenic
915908058 1:159893991-159894013 AAAGAAATGACAAGTGTTTGAGG + Intronic
915973148 1:160367802-160367824 ATAGATGTGATAAATGTGTTGGG + Intronic
916287054 1:163119406-163119428 AAAGAAATGATAAGTATGTAAGG + Intronic
916475757 1:165167081-165167103 AAAAATACAAAAAGTGTATTAGG - Intergenic
916915123 1:169398311-169398333 AAAGAAATGACAAGTGTTTGAGG + Intronic
917072072 1:171162574-171162596 AAAGATATCAAAAGTGGAATGGG + Intergenic
917240619 1:172944446-172944468 AAAATTGTGAAAAGTCTGTTTGG + Intergenic
917603159 1:176597695-176597717 GAAGAAAAGAAAATTGTGTTTGG + Intronic
917919448 1:179738262-179738284 AAAGAAATGATAAATGTGTGAGG + Intergenic
918084511 1:181234301-181234323 AAAGAAATGATAAATGTGTGAGG + Intergenic
918253854 1:182730120-182730142 AAAGATATGAAAAGGAAGGTTGG - Intergenic
918497692 1:185157665-185157687 AAACAAAGGAAAAGAGTGTTCGG - Intronic
918676144 1:187288588-187288610 AAAGAAATGACAAGTGTTTGAGG - Intergenic
918915978 1:190637652-190637674 AAAGATTTGAAAAATGTATGAGG - Intergenic
918994607 1:191740747-191740769 AAAGATAAGAAAAGGAAGTTAGG - Intergenic
919083861 1:192897206-192897228 AAAGAAATGACAAGTGTTTGAGG + Intergenic
919967913 1:202547471-202547493 AAAGATACTGAAAGTGTGTCTGG + Intronic
920455273 1:206096439-206096461 AAAGAAATGAAAATTGTGGAAGG - Intronic
920496264 1:206457007-206457029 AAAGGTATTCAAAGTGTCTTTGG - Intronic
920999011 1:211023958-211023980 AAAGAAATGAAAAATGTTTGAGG + Intronic
921704680 1:218308793-218308815 AAATACATGAACACTGTGTTTGG + Intronic
923002490 1:230019070-230019092 AAAGAAATGATAACTGTTTTAGG - Intergenic
923078653 1:230633015-230633037 AGAGATAGGGAAGGTGTGTTAGG + Intergenic
923647101 1:235834863-235834885 ACAGGTATGGAAGGTGTGTTAGG - Intronic
924156994 1:241188103-241188125 AAAGAAATGATAAATGTTTTGGG + Intronic
924303077 1:242659453-242659475 AAAGAAAGGAAAAGTTTATTTGG + Intergenic
924350902 1:243113754-243113776 AAAAACATGAAAAGTATGTGAGG + Intergenic
924595981 1:245444967-245444989 AAAGAAATGTCAACTGTGTTAGG + Intronic
924714489 1:246560042-246560064 AAAGATGACAAATGTGTGTTGGG - Intronic
924824826 1:247528356-247528378 AAAGAAATGACAAGTGTTTGAGG - Intronic
1062845628 10:702389-702411 AAAGAAATAAAAAATGTTTTAGG - Intergenic
1062900270 10:1138866-1138888 AAAGATAAAATATGTGTGTTTGG + Intergenic
1063890038 10:10619730-10619752 GAAGATAGGAGAAGTTTGTTTGG + Intergenic
1064620904 10:17216430-17216452 AAGGATATGGGCAGTGTGTTGGG + Intergenic
1064698358 10:17990581-17990603 AAGGGTATGAGAAATGTGTTGGG - Intronic
1064808578 10:19166593-19166615 AAAGAAATGAGAAGTGTGTGAGG + Intronic
1065958659 10:30715551-30715573 AAATATTTAAAAAGTGTATTAGG + Intergenic
1066144927 10:32547715-32547737 AAAGAAATGAAAAGTGCTTGAGG - Intronic
1066462877 10:35627467-35627489 TAAAATATGAAAACTGTGTGTGG + Intergenic
1066748694 10:38630490-38630512 AAAGAAATGATAAGTATGTGAGG + Intergenic
1066967979 10:42287292-42287314 AAAGAAATGATAAGTATGTGAGG - Intergenic
1068019067 10:51557708-51557730 CAAGATGTGAAAAATGTATTGGG + Intronic
1068691172 10:59916384-59916406 AATGACATGAAAAGAGTGATAGG - Intergenic
1068787919 10:60997250-60997272 AAAGATATCAAAATTGTGATTGG + Intronic
1068887907 10:62116299-62116321 AAATATATGAAAATTGGGGTCGG + Intergenic
1069323813 10:67206098-67206120 AAAGATATAAAAAGTTCCTTTGG + Intronic
1069437128 10:68394922-68394944 AAAAATATGAAAAGTTGGCTAGG - Intronic
1069461847 10:68603012-68603034 AAAAAAATGAAACCTGTGTTTGG + Intronic
1069607851 10:69751262-69751284 AAAGCGATTACAAGTGTGTTTGG + Intergenic
1069865468 10:71500138-71500160 AAAGAAATGATAAGTGTTTGAGG + Intronic
1070279064 10:75035662-75035684 TAAGATATGAAATATTTGTTTGG - Intergenic
1070620001 10:78002092-78002114 AAATAAATGAAATGTCTGTTTGG + Intronic
1070837086 10:79455133-79455155 AAAGAAATGGAAACAGTGTTCGG - Intergenic
1071331804 10:84568106-84568128 AAATAGATGAAAAGTCTGTCTGG - Intergenic
1071580147 10:86761828-86761850 ACAGATATGAAAAATGAGGTGGG + Intronic
1071966838 10:90860011-90860033 AAAAATATCAAAAGTATCTTGGG - Intergenic
1074085220 10:110204685-110204707 AAACAAATGAACAGAGTGTTGGG + Intergenic
1074179838 10:111049905-111049927 TAAAATATGAAAACTGTTTTTGG - Intergenic
1074887626 10:117706702-117706724 AAAGAAATGATAAGTATGTGAGG - Intergenic
1075040127 10:119101541-119101563 AAAGATAGGAAACATGTGTGAGG + Intergenic
1077762471 11:5117948-5117970 AAAGAAATGATAAATGTTTTAGG + Intergenic
1081058639 11:38444947-38444969 AAATATATCTAAAGTGTGGTTGG - Intergenic
1081486035 11:43530003-43530025 AAAGAGATGAAAAGAATCTTTGG - Intergenic
1081852096 11:46281047-46281069 AAAGTCAAGACAAGTGTGTTTGG + Intronic
1082642204 11:55676371-55676393 AAAGAAATGAATATCGTGTTAGG + Intergenic
1082682414 11:56192097-56192119 AACAATATAAAAAGTGTTTTAGG + Intergenic
1082697970 11:56393963-56393985 AAAGAGTTGACAAGGGTGTTTGG - Intergenic
1083223815 11:61271136-61271158 AAAGAAAAAAAAAGTGTGTATGG - Intronic
1083527404 11:63381985-63382007 AATGATGTGAAAAGTGAATTAGG - Intronic
1083575132 11:63784946-63784968 ACAGAAATGAAGAATGTGTTTGG + Intergenic
1084628123 11:70324599-70324621 AAAGGTATGAAAAGTATTTCAGG - Intronic
1084663777 11:70564417-70564439 AAAAATATGAAAAGTTGGCTGGG - Intronic
1084682034 11:70672041-70672063 AAAGAAAAGAAAAGTATGGTGGG - Intronic
1084993224 11:72948958-72948980 AAAGAAATGAAAATTATGCTGGG - Intronic
1085265224 11:75233907-75233929 GAAGAAATGAGAAGTGTGGTTGG + Intergenic
1085670319 11:78458138-78458160 AAAGAAATGAAAAATGTTTGAGG + Intronic
1085915129 11:80878000-80878022 AAAGATATCAAAGGTTGGTTTGG - Intergenic
1085990422 11:81836186-81836208 AAAGAAATGATAAGTATGTGAGG - Intergenic
1086253282 11:84843525-84843547 AGAGATATAAAAAGTGTCCTTGG + Intronic
1086663602 11:89452670-89452692 AAAGAAATGATAAGTGTTTTGGG - Intronic
1086675707 11:89604629-89604651 AAAGGTATGAGAACTGTGTGAGG + Intergenic
1087180384 11:95136019-95136041 AAAGAAATAACAAGCGTGTTGGG + Intergenic
1087219531 11:95531400-95531422 AAAGAAAAAAAAAGTTTGTTTGG - Intergenic
1087375028 11:97329203-97329225 AAAAATATGACAGGAGTGTTGGG + Intergenic
1087976813 11:104559814-104559836 ATATATATGAATAATGTGTTAGG + Intergenic
1088295506 11:108289716-108289738 AAAGATATAAAAAGTGGCTTAGG + Exonic
1088400746 11:109421190-109421212 AAAAATATGAATAGTGCATTTGG - Intergenic
1088862046 11:113809735-113809757 AAAGATATGGAAAGTGGGCCGGG + Intronic
1090463843 11:126915304-126915326 AAAGAAATGAAAAATATGCTGGG - Intronic
1091023624 11:132123031-132123053 GAAGATAGGAAAAGTGTGCCAGG - Intronic
1091522007 12:1254897-1254919 AAAGAAATGACAAGTATGTGAGG - Intronic
1092069496 12:5621298-5621320 AATGACAGGAAAAATGTGTTTGG + Intronic
1092098106 12:5861105-5861127 AAAGATATGTTAGGTGTGCTTGG - Intronic
1093606203 12:21092087-21092109 AAAGAAATGATAAATGTGTAAGG - Intronic
1093785860 12:23191324-23191346 GAAAATATGAAAATTATGTTGGG + Intergenic
1094308546 12:29050879-29050901 AAAGATACGATAAGTATGTGAGG - Intergenic
1094402371 12:30075889-30075911 AAAAATATGAAAAATTAGTTGGG - Intergenic
1094457341 12:30651420-30651442 AAGGAAAACAAAAGTGTGTTGGG + Intronic
1095033526 12:37324417-37324439 AATTGTACGAAAAGTGTGTTTGG - Intergenic
1095343528 12:41121074-41121096 AAAGATTTGTAAAGTTTATTGGG - Intergenic
1095503399 12:42865836-42865858 AAAGGAATGAAGAGTGTATTAGG + Intergenic
1095855931 12:46861131-46861153 AAAAATATGAAAAGAGAGTCTGG - Intergenic
1096057147 12:48663706-48663728 AAACATATAAAATATGTGTTAGG + Intronic
1096231745 12:49900602-49900624 ACAGATATGAGAAGAGTGATTGG + Intronic
1096398887 12:51288907-51288929 AAAAATACAAAAAGTTTGTTGGG - Intronic
1097348351 12:58519965-58519987 AAAGATGGGGAAACTGTGTTTGG + Intergenic
1097805004 12:63955434-63955456 AAAAAAATGATAAGTGTGTGAGG - Intronic
1098179881 12:67834671-67834693 AAAGAAATGATAAATGTGTGAGG - Intergenic
1098549425 12:71746918-71746940 AAACATATGTAAAGTTTCTTGGG + Intergenic
1099356386 12:81641078-81641100 AAAGAAATGAAAAGCGTTTGAGG - Intronic
1099406404 12:82268793-82268815 AAAGAAATGATAAATGTTTTAGG + Intronic
1099819460 12:87692008-87692030 CAAGAGAGGAAAAGAGTGTTTGG + Intergenic
1100001414 12:89841027-89841049 GAATATATTAAAATTGTGTTGGG - Intergenic
1100018752 12:90044739-90044761 AAAAATATTAAAAGTTAGTTGGG - Intergenic
1100609374 12:96178565-96178587 AAAAATATGAAAAGTTAGTGGGG + Intergenic
1100662241 12:96712497-96712519 AAAGAAATGACAAGTGTTTGAGG - Intronic
1102408710 12:112697878-112697900 AAAGAAAAAAAAAGTCTGTTTGG - Intronic
1102582018 12:113895387-113895409 ACAGATAAGGAAAGTGGGTTTGG - Intronic
1103696764 12:122821862-122821884 AAAGACATGATAAGTATGTGAGG - Intronic
1104342552 12:127964669-127964691 AAAGATGTGAAAAGTATGTAGGG + Intergenic
1105947473 13:25202239-25202261 AATGAGATGTAAAGTCTGTTGGG - Intergenic
1106544800 13:30721135-30721157 AAAGAAGAGAGAAGTGTGTTCGG - Intronic
1106644758 13:31620569-31620591 AAAGAAATGAAAAGTGTTTGAGG - Intergenic
1106712686 13:32355103-32355125 ACAGAGTTGAACAGTGTGTTAGG + Exonic
1106828237 13:33547895-33547917 AATGAAATAAAAAGTTTGTTAGG + Intergenic
1106839929 13:33676145-33676167 TAAGATGTGAAAAATCTGTTGGG - Intergenic
1106919060 13:34543170-34543192 AAAGAAATGACAAGTGTTTGAGG - Intergenic
1107353268 13:39538283-39538305 AAAGATAAGAAAAATGGGCTGGG - Intronic
1107729116 13:43330545-43330567 AAAGATTTGCAAAGTGTGAGGGG - Intronic
1108059023 13:46514850-46514872 AAAGATAAGGTAAGTGTGTATGG - Intergenic
1108416753 13:50205349-50205371 AATGATATGAAAATTGCCTTTGG + Intronic
1108560807 13:51642150-51642172 AAAGATATGGAAAATGTGAAAGG - Intronic
1108562180 13:51654963-51654985 ATATATATGTAAAGTGTTTTGGG + Intronic
1108994916 13:56717127-56717149 ATAAATGTGAAAAGTGTTTTAGG + Intergenic
1109048936 13:57452546-57452568 AAATATGTGAAAATTGTGTAGGG - Intergenic
1109497517 13:63192231-63192253 AAAAAAATGAAAAATGTGATTGG + Intergenic
1109521467 13:63516503-63516525 AAAGAAATGACAAGTGAGTTAGG + Intergenic
1110381048 13:74851299-74851321 AAAACAATGAAAAGTATGTTTGG - Intergenic
1110651134 13:77942507-77942529 AATATTATGAAAAGTCTGTTTGG - Intergenic
1111013320 13:82341395-82341417 AAAGAAATGACAAGTGTTTGAGG + Intergenic
1111255842 13:85667316-85667338 AGAGAAATGCAAAGTTTGTTAGG - Intergenic
1111765789 13:92526771-92526793 AAAGATTTGAAATGTGTTTTAGG + Intronic
1111872604 13:93851940-93851962 AAAAATATGATAAACGTGTTTGG + Intronic
1112051812 13:95650128-95650150 AAAGATTTAAAAAATGTGTTGGG - Intergenic
1112678373 13:101731782-101731804 AAACAGGTGAAAATTGTGTTTGG - Intronic
1112828649 13:103421437-103421459 AAATAAAAGAAAAATGTGTTAGG - Intergenic
1112838126 13:103541964-103541986 AAACATTTGAAAAGTATGTTGGG - Intergenic
1112884206 13:104148199-104148221 AAAAATGAGAAAAATGTGTTTGG - Intergenic
1113345454 13:109473456-109473478 AAAGAAATGATAAATGTTTTAGG - Intergenic
1114159993 14:20154615-20154637 AAAGAAATGAAAAATGTTTGAGG - Intergenic
1114339443 14:21727694-21727716 GCAGATCTTAAAAGTGTGTTTGG + Intergenic
1115283991 14:31697569-31697591 AAAAATATGAAAAGGCTGTTAGG + Intronic
1115400701 14:32956785-32956807 AAACATATCAAAAGTGATTTGGG - Intronic
1116048213 14:39770583-39770605 AAAAATAAGAAAAGTGTATGAGG - Intergenic
1116096426 14:40376202-40376224 AAAAATATGATAAGTATGTGAGG - Intergenic
1116329726 14:43580161-43580183 GAAGATAGTAAAAGTGTTTTTGG + Intergenic
1116747374 14:48837776-48837798 AAACATATGGAAAATGTGTCAGG + Intergenic
1117286699 14:54292260-54292282 AAAGATGAGAAAAGTGTACTGGG - Intergenic
1117486285 14:56200916-56200938 AAAGATTTCACAAGTTTGTTTGG + Intronic
1117649217 14:57885122-57885144 AAGGAATTGTAAAGTGTGTTGGG - Intronic
1117991027 14:61433744-61433766 AAAGATATGAAAAGATGTTTTGG + Intronic
1118881875 14:69835649-69835671 ATTGATATGATCAGTGTGTTTGG + Intergenic
1119054272 14:71403155-71403177 AAGTACATGAAAAGTCTGTTTGG - Intronic
1119058750 14:71451744-71451766 AAAAAAATGAAAAGTATGTCAGG + Intronic
1119533275 14:75378748-75378770 AAAGAATTAAAAAGTGTGTCTGG + Intergenic
1119818757 14:77595387-77595409 AAAAATGTTAAAAATGTGTTTGG + Intronic
1120272197 14:82327063-82327085 AAAGTTATTAAAAGTTTGTAAGG - Intergenic
1120572538 14:86139429-86139451 AAAGATATGATAAATATGTTAGG + Intergenic
1120600145 14:86493949-86493971 AAAGAAATGATAAGTGTTTGAGG - Intergenic
1120771953 14:88388758-88388780 AAAGATAAGAAAACTGTATTTGG + Intronic
1120991295 14:90379777-90379799 AAGGATATTAGAACTGTGTTGGG + Intergenic
1121112175 14:91320045-91320067 AAAAAAAAGAAATGTGTGTTTGG + Intronic
1121205214 14:92159190-92159212 AAGGCCATGAAAAGTCTGTTCGG + Exonic
1122456386 14:101855632-101855654 AAAGATTTGCAAAATGTTTTAGG - Intronic
1123568994 15:21582803-21582825 AAAGATTTGAAGGGAGTGTTAGG + Intergenic
1123605103 15:22018124-22018146 AAAGATTTGAAGGGAGTGTTAGG + Intergenic
1124593175 15:31071189-31071211 AAAAACTTGAAAAGTTTGTTAGG + Intronic
1124827177 15:33109038-33109060 AAAGTTATGACAAGTTTGCTAGG - Intronic
1126463415 15:48938030-48938052 AAAGATCTTAAAAGTCTCTTAGG - Intronic
1126987547 15:54330234-54330256 AAAGATTTAAAAAGAGTGCTTGG - Intronic
1127170016 15:56291536-56291558 AAAGAAATGATAAGTATGTGAGG - Intronic
1127629778 15:60817100-60817122 AAAGAAATGATAAGTCTGTGAGG - Intronic
1128559273 15:68653942-68653964 AAAGATCTGAAAAATGGATTTGG - Intronic
1202977348 15_KI270727v1_random:309893-309915 AAAGATTTGAAGGGAGTGTTAGG + Intergenic
1133950948 16:10392024-10392046 AAAGATATAAAAAGTATGAATGG + Intronic
1134120655 16:11582106-11582128 AAAGAAATGATAAGTGTTTGAGG + Intronic
1135457877 16:22614490-22614512 AATGATATAAGAAGTGTCTTAGG + Intergenic
1136265348 16:29114024-29114046 AATTATATGAAAAGTGACTTTGG - Intergenic
1136734067 16:32446810-32446832 AAAGAAATGATAAGTATGTGAGG - Intergenic
1137226632 16:46518182-46518204 AAAGAAATGAATATTATGTTTGG + Intergenic
1138317922 16:56086319-56086341 AAAAATAGGAAAAGTGTTTCAGG + Intergenic
1138930335 16:61647164-61647186 AAAGGCAAGAGAAGTGTGTTGGG + Intergenic
1139129184 16:64119511-64119533 AAAGGTATGGACAGGGTGTTGGG - Intergenic
1139212131 16:65088982-65089004 AAAGAAATGGAAAGTGCATTTGG + Intronic
1139260679 16:65590555-65590577 AAAGAAATGAAAAGTGGGGCTGG + Intergenic
1140378206 16:74462372-74462394 GAAGATATGAAAAAGGTCTTGGG + Intronic
1140861172 16:79019379-79019401 AAAGCTATGCAACGTGTGATTGG + Intronic
1140988774 16:80187735-80187757 AAATATATGAAAATTTGGTTTGG - Intergenic
1141292389 16:82731498-82731520 AAACATCTGAAAAGTATTTTGGG + Intronic
1142054154 16:87981958-87981980 AATTATATGAAAAGTGACTTTGG - Intronic
1203019012 16_KI270728v1_random:382785-382807 AAAGAAATGATAAGTATGTGAGG + Intergenic
1203037347 16_KI270728v1_random:655943-655965 AAAGAAATGATAAGTATGTGAGG + Intergenic
1144128359 17:12222919-12222941 AAACATTAGAAAAGTGTATTTGG - Intergenic
1144286436 17:13779146-13779168 AAGGACAGGAAATGTGTGTTTGG + Intergenic
1146036612 17:29412367-29412389 AAACATAGGCAAAGTGTGCTGGG - Intronic
1146152405 17:30486219-30486241 AAAGAAATGAAATGTATGCTGGG + Intronic
1146470770 17:33122629-33122651 AAAGACATGATAAGTATGTGAGG - Intronic
1147752050 17:42742044-42742066 AAAGTTAAGAAAAATGTGGTCGG - Intronic
1149058512 17:52392818-52392840 AAACATATGTAATGTGTGATAGG - Intergenic
1149153563 17:53598648-53598670 AAAAATGTGAGAAATGTGTTAGG + Intergenic
1149261565 17:54885575-54885597 AAATATATGTAAAGTGCATTAGG - Intergenic
1150172547 17:63014036-63014058 AAAAGTATGAAAAGTATGTAAGG - Intronic
1150860367 17:68795205-68795227 AAATATATGAAAAGAGTTTGGGG - Intergenic
1150962988 17:69935260-69935282 TAAGAAATGGATAGTGTGTTAGG + Intergenic
1151642821 17:75408632-75408654 GAATAGATGAAAAGTCTGTTTGG + Intergenic
1152011480 17:77721478-77721500 AATGTTATGTACAGTGTGTTAGG - Intergenic
1153084436 18:1267930-1267952 AAAGCCATGTAAAGTGTTTTAGG + Intergenic
1153460131 18:5324055-5324077 AAAGAGATGAAAACTGTGGGAGG + Intergenic
1153648350 18:7215766-7215788 AAAGAGATGATAAGTGTTTGAGG - Intergenic
1154936617 18:21064679-21064701 AAATCTATTAAAAATGTGTTAGG - Intronic
1154939495 18:21096988-21097010 AAAGATGAGAAAATTGTGTGAGG + Intronic
1155908712 18:31484217-31484239 ACAGATGTGAAATGTGTGATTGG - Intergenic
1156224826 18:35094123-35094145 AAAGAAATGATAAATGTGTGAGG + Intronic
1156396467 18:36704235-36704257 AAAGACCAGAAAAATGTGTTTGG - Intronic
1156911753 18:42418739-42418761 AAAGATATGCACAGTTAGTTAGG - Intergenic
1157118958 18:44890057-44890079 AAAAAAATGAAAAATGTGTTAGG - Intronic
1157704719 18:49795038-49795060 AAAGATATCTCAAATGTGTTTGG + Intronic
1157717751 18:49900710-49900732 AAGGACATGAAGAGTGTGTGTGG - Intronic
1158017939 18:52806897-52806919 AAAGATATGCAGAGTTGGTTAGG + Intronic
1158257019 18:55562656-55562678 ATAGATATGGAAAATGTGATTGG - Intronic
1158739330 18:60121761-60121783 AAAGAAATGATAAATGTGTGAGG - Intergenic
1159205807 18:65250461-65250483 AAAGAAATTAAAAGTATTTTTGG - Intergenic
1159386355 18:67730215-67730237 AAAGAGAAGAAAATTGTGGTGGG + Intergenic
1159795592 18:72839243-72839265 AAAGTTATAAAGAGTGGGTTTGG + Intronic
1161803177 19:6426973-6426995 AAAGTTATCAAAAGTGGGCTGGG + Intronic
1161823859 19:6548865-6548887 AAAAATATGAAAAGTGAGCTGGG + Intergenic
1162264015 19:9555235-9555257 AACGTGATGAAAAGTGTGCTTGG + Intergenic
1163311218 19:16515955-16515977 AAAGATATGAAAAATTAGCTGGG - Intronic
1163954219 19:20620385-20620407 AAAATTATGAAATGAGTGTTTGG - Exonic
1164048810 19:21566527-21566549 CAAGATATGAAAGCTGGGTTGGG + Intergenic
1165192206 19:34074418-34074440 AAAGATAAGACAAATGTATTAGG + Intergenic
1165605350 19:37098664-37098686 AAAGAAATGACAAGTGTTTGAGG - Intronic
1168570216 19:57460712-57460734 AAAGAAATGATAAGTATGTGAGG - Intronic
925152601 2:1625485-1625507 AAAGACAGGAAAGGTGTGTTTGG + Intergenic
925547003 2:5027476-5027498 AGAGACATGAAAAGAGTGTGGGG - Intergenic
925884867 2:8386459-8386481 ATAGAAATGCAAATTGTGTTTGG + Intergenic
926588052 2:14710687-14710709 AAAGAAATGATAAATGTATTAGG + Intergenic
927163345 2:20291716-20291738 AAAGACATGAAAAGGATGTAAGG - Intronic
927305578 2:21568196-21568218 AACAAAATGAAAAATGTGTTTGG + Intergenic
927363695 2:22268710-22268732 TATGATATGAAAAGTGGGTGGGG - Intergenic
928351018 2:30554847-30554869 AAAGAAATGAAAAGTATGAGAGG + Intronic
928704425 2:33932417-33932439 AATGATATGAAAAATATGTTAGG + Intergenic
929035211 2:37684178-37684200 AAAAATATTAAAAGTTTGTCAGG - Intronic
929164306 2:38865630-38865652 AAAGAAATGATAAATGTGTGAGG - Intronic
929975079 2:46625903-46625925 AAAAAAATGAAATGTGAGTTAGG - Intergenic
930794338 2:55372002-55372024 GAATTTATGAAAAGTGTTTTAGG - Intronic
931111459 2:59115647-59115669 GAAGATAGAAAAAGTGTGGTGGG - Intergenic
932474699 2:71995581-71995603 TAATATATGAGAAGTGTGTGTGG + Intergenic
933250271 2:80021700-80021722 AAAAAAATGATAAGTGTGTGAGG - Intronic
933422672 2:82070741-82070763 AAAGAAATGACAAGTGTTTGAGG - Intergenic
933622907 2:84564233-84564255 AAAGATATAAATAGTTTGATAGG + Intronic
934311672 2:91872613-91872635 AAAGAAATGATAAGTATGTGAGG + Intergenic
935452413 2:103224714-103224736 AATAATATAAAAAGTGTTTTGGG - Intergenic
935522949 2:104131616-104131638 AAAGAAATGAGAAATGTGTGAGG + Intergenic
936063593 2:109313892-109313914 AGATATTTGAAAGGTGTGTTGGG + Intronic
936074291 2:109391795-109391817 AATGACATGAAAAGTGGGTCAGG - Intronic
936980656 2:118262353-118262375 AACGAGATGAAAAGTGGTTTTGG - Intergenic
937575241 2:123412353-123412375 AAAAATTTAAAAAATGTGTTAGG - Intergenic
937686553 2:124704383-124704405 AAACATAATAAAAGAGTGTTTGG + Intronic
937704760 2:124907076-124907098 AAAAATATGAACAGAGTTTTGGG + Intronic
937765226 2:125653116-125653138 GAAGAAAGGAAAAGAGTGTTTGG - Intergenic
938237660 2:129719621-129719643 AAAGAAATGATAAGTATGTAAGG + Intergenic
938629537 2:133151525-133151547 AAAAATATGAAAAGAGTCTAGGG + Intronic
938652667 2:133400054-133400076 AAATATATAAAAATTATGTTTGG + Intronic
938907932 2:135856440-135856462 AAAAAAATAAAAAGTGTGGTTGG + Intronic
939438559 2:142211105-142211127 ATTGACATGAAGAGTGTGTTGGG + Intergenic
939658927 2:144863288-144863310 AAATATATGCAGAATGTGTTAGG - Intergenic
939893225 2:147761786-147761808 AAAGTAATGAAAAGTTTGCTGGG - Intergenic
940296396 2:152129864-152129886 AAAGAAATGAAAAATCTGTGTGG - Intronic
940678095 2:156749898-156749920 AAAGATGTGAATATTGTATTTGG + Intergenic
940851869 2:158694852-158694874 AAACATATGAAAAGTAATTTTGG - Intergenic
941207933 2:162597711-162597733 AAAGAAATGAAAAGTATGTAAGG + Intronic
941350269 2:164424064-164424086 CAAGATATGAAGACTTTGTTTGG - Intergenic
942963486 2:181861336-181861358 AAAGAGATCAAAAGTCTGCTTGG - Intergenic
943176951 2:184488700-184488722 AAAGATATGCAAAGTATGGTGGG + Intergenic
943212483 2:184985993-184986015 AAAGAAATGACAAGTGTTCTAGG - Intergenic
943385368 2:187197692-187197714 AAAGCAATGAAAAGAATGTTCGG + Intergenic
943448453 2:188019116-188019138 AAGGAGATGAAAAATTTGTTGGG + Intergenic
943922927 2:193732614-193732636 AAAGAAATGAGAAGTGTTTGAGG + Intergenic
943989715 2:194672124-194672146 ATAAATATGAAAATTTTGTTTGG + Intergenic
944086449 2:195852589-195852611 AAAGAGCTGAATAGTATGTTGGG + Intronic
944161351 2:196663715-196663737 AAAGAGGTAAAAAATGTGTTGGG - Intronic
945302781 2:208229890-208229912 AAAGTTTTTAAAAGTGTATTAGG - Intergenic
945449831 2:209980912-209980934 AAAAATATAAAAAATGTGGTAGG - Intronic
945777128 2:214118989-214119011 AAAGAAATGACAAGTGTTTGAGG + Intronic
947180410 2:227406360-227406382 AAAGATTAACAAAGTGTGTTTGG + Intergenic
947282946 2:228476585-228476607 AAAGATATGAAAGGATTTTTAGG + Intergenic
947376447 2:229501309-229501331 AAAGAAATGATAAGTATGTTAGG + Intronic
947681553 2:232038205-232038227 GAAGATAAGAGAAGTGTATTAGG + Intronic
948082692 2:235219718-235219740 ATAGATTTGAGGAGTGTGTTGGG + Intergenic
948376623 2:237525164-237525186 GAAGATCAGAAAAGTGGGTTGGG - Intronic
1169549547 20:6688182-6688204 AAGGATATGAAAAGGGTTGTAGG + Intergenic
1169794816 20:9450629-9450651 AAAGAAAAGAAAACTGAGTTAGG - Intronic
1169836080 20:9880665-9880687 AAAGAAATGATAAGTGTTTGAGG - Intergenic
1169904801 20:10591743-10591765 TTAAATATGAAAACTGTGTTTGG - Intronic
1170345884 20:15386722-15386744 AAAAAAATGAATAGGGTGTTAGG - Intronic
1170825982 20:19796097-19796119 AAAGAAAAGAAAAGTAGGTTAGG + Intergenic
1171016221 20:21544332-21544354 AAAGATATTCAGAGTGTGTTAGG + Intergenic
1171363219 20:24605074-24605096 AAAGACATGAAACCTGTGCTGGG + Intronic
1172713623 20:36946684-36946706 AAAGATGGATAAAGTGTGTTTGG + Intronic
1172840417 20:37899791-37899813 AAACATATGAAATGTTTGATTGG + Intergenic
1173308149 20:41871507-41871529 GAAGATATGAGAGGTATGTTAGG - Intergenic
1174403187 20:50287105-50287127 AATTATATGATAATTGTGTTAGG + Intergenic
1174790276 20:53471784-53471806 AAAGAAAAGAAAAGTGTCTACGG - Intronic
1174890951 20:54392155-54392177 AAGGATATAAAAATTATGTTAGG - Intergenic
1175004866 20:55671224-55671246 AAATATATGTAAAGTGGGCTAGG - Intergenic
1175177232 20:57119488-57119510 TAAAATATGAAAAATGAGTTGGG + Intergenic
1175370994 20:58491533-58491555 AAAAATATGCAAGATGTGTTTGG + Intronic
1176992646 21:15517366-15517388 AAAAATTTGGAGAGTGTGTTGGG + Intergenic
1177168883 21:17633589-17633611 GAATAGATGAAAAGTGTGTCTGG - Intergenic
1177421065 21:20858034-20858056 AAAGAAATCAAAAGTATGGTTGG + Intergenic
1177846403 21:26292951-26292973 AAAGACATGAAAAGACTTTTTGG + Intergenic
1178040642 21:28637131-28637153 AAAGATATGAATATTTTGCTTGG - Intergenic
1178091274 21:29165981-29166003 AAAGATATGACAAATGTTTGAGG - Intronic
1178101648 21:29275377-29275399 AAAGATTTAAACATTGTGTTAGG + Intronic
1178345422 21:31822282-31822304 AAAGAAATGATAAATGTGTGAGG + Intergenic
1178625258 21:34211122-34211144 AAAAATATGAAAAATGAGTCAGG - Intergenic
1180280675 22:10690879-10690901 AAAGAAATGAAAAGGGATTTGGG - Intergenic
1180576548 22:16780996-16781018 AACGAAATGATAAGTGTGTGAGG - Intergenic
1180763229 22:18224383-18224405 AAAGTGATGAAAAATGTTTTTGG + Intergenic
1180772418 22:18400164-18400186 AAAGTGATGAAAAATGTTTTTGG - Intergenic
1180806968 22:18719669-18719691 AAAGTGATGAAAAATGTTTTTGG + Intergenic
1181217923 22:21345479-21345501 AAAGTGATGAAAAATGTTTTTGG + Intergenic
1181366961 22:22385085-22385107 AAAAATATGAAAAGAGAGATGGG - Intergenic
1181373399 22:22436626-22436648 AAAAATATGAAAAGAGAGATGGG - Intergenic
1182608720 22:31528424-31528446 AAACAAAAGAAAACTGTGTTAGG + Intronic
1184985874 22:48133494-48133516 AAAGAAATGATAAGTGTTTGAGG + Intergenic
1203234257 22_KI270731v1_random:141152-141174 AAAGTGATGAAAAATGTTTTTGG - Intergenic
949613028 3:5722781-5722803 AGAGATATAAAAAATGTGTTAGG + Intergenic
949734683 3:7158363-7158385 ATAGAGATGCAAAGTTTGTTGGG - Intronic
949864816 3:8538705-8538727 AAAGAAATAAAAAATGTGATAGG - Intronic
950069052 3:10137135-10137157 AAAGATACGAAAAGTTAGCTGGG + Intergenic
950353352 3:12379611-12379633 AGAGAAATGAAAAGAGTCTTTGG - Intronic
951234322 3:20217002-20217024 AAAGAAATGACAAGTGTTTGAGG + Intergenic
951722499 3:25715672-25715694 ATATTTATGAAAAGTGTTTTTGG + Intergenic
951786768 3:26429071-26429093 TTAGATATGAAAAGTGAGTTTGG - Intergenic
951959648 3:28302424-28302446 ATATGTAAGAAAAGTGTGTTTGG + Intronic
952234838 3:31468506-31468528 AAAGCTATGAAAAGCCTGTCAGG + Intergenic
953111619 3:39946281-39946303 AAAGAAATGAACATTGTGGTGGG + Intronic
953378783 3:42450856-42450878 AAAGAAATGAGGAGTCTGTTGGG - Intergenic
953786578 3:45915894-45915916 AAAGACATTCAAAGTGGGTTAGG - Intronic
953819211 3:46189723-46189745 AAAGATATGACAACTGTGAAAGG + Intronic
954607028 3:51920031-51920053 AAAGAAATGATAAATGTTTTAGG - Intergenic
955171503 3:56569993-56570015 AAAGATACAAAAAGTAAGTTGGG - Intronic
955235952 3:57139248-57139270 AAAGATTGAAAAAGTGAGTTTGG + Intronic
956122945 3:65984296-65984318 AACTATATAAATAGTGTGTTGGG + Intronic
957027696 3:75202861-75202883 AATGAAATAAAAAGTGTATTTGG - Intergenic
957667795 3:83257310-83257332 AAAGATATGACTTATGTGTTTGG + Intergenic
957713081 3:83889378-83889400 AAAGATATGAGCAGTGTGAAAGG + Intergenic
958054921 3:88397064-88397086 AGATATATGATAAGTGTGCTTGG + Intergenic
958061590 3:88489841-88489863 AAAAGTATGAAACGTTTGTTTGG - Intergenic
958097190 3:88961491-88961513 AATAATATGCAAAGTGTCTTTGG + Intergenic
958429455 3:94020642-94020664 ATAGATATTAAAAGTTTATTCGG + Intronic
958551520 3:95619920-95619942 AAAGATATAAGAAGACTGTTAGG - Intergenic
958552092 3:95628579-95628601 AAAGACATGAAAAATGTTTGAGG + Intergenic
958593183 3:96186952-96186974 AAATATATGAAAATTGTGTTAGG - Intergenic
958603229 3:96326018-96326040 AAAAAAAAGAAATGTGTGTTAGG + Intergenic
958959683 3:100497107-100497129 AAATATTTGAAAAATGTTTTAGG + Intronic
959180475 3:102973145-102973167 AAAGAAATGATATGTGTTTTAGG - Intergenic
959778238 3:110196957-110196979 AAAGAAATTATAAGTGCGTTAGG - Intergenic
960403502 3:117232011-117232033 AAACATAAGAATATTGTGTTAGG - Intergenic
960474603 3:118108507-118108529 AAAGATAAGCAAAGTGTGTTAGG + Intergenic
960672927 3:120169456-120169478 AAAGAAATGAAAGGACTGTTGGG + Intronic
961268193 3:125665026-125665048 AAAATTACAAAAAGTGTGTTTGG + Intergenic
961268543 3:125669849-125669871 GATTCTATGAAAAGTGTGTTTGG + Intergenic
962851336 3:139310508-139310530 AAAGCTTGGCAAAGTGTGTTAGG - Intronic
963167966 3:142224798-142224820 AAAGATATGAAAAGTTATTGAGG + Intronic
963181263 3:142359167-142359189 ACAGATAAGACAAGTGTTTTGGG - Intronic
963184450 3:142397840-142397862 AAAGAAATGATAAGTGTTTGAGG + Intronic
963968212 3:151398176-151398198 AAAGCTATGAGAAGGGTGTGTGG - Intronic
964343812 3:155735692-155735714 AAAGATAAAAAAAGTATGTGAGG + Intronic
964714784 3:159710553-159710575 AAAGAAATGATAAGTATGTGAGG + Intronic
965155049 3:165040697-165040719 AAAGATATATAAAATATGTTAGG - Intronic
965479360 3:169198622-169198644 AAAGAAATGAACAGTGGGTAAGG - Intronic
965586836 3:170326420-170326442 AAAAATATAAAAAATGTGCTGGG - Intergenic
966148077 3:176834399-176834421 AAAGAAATGCAAAGTCTGATAGG - Intergenic
966284210 3:178274139-178274161 AAGGATATTTAATGTGTGTTAGG + Intergenic
966344540 3:178963979-178964001 TAATATATGAAAAGTCTGTCTGG - Intergenic
966432438 3:179846313-179846335 AAAGAAATGGTAAGTGTGTGAGG - Intronic
966513351 3:180788786-180788808 AAATATCTGTAGAGTGTGTTTGG - Intronic
966906207 3:184527667-184527689 AAAGATATGAAAAATGAGCCAGG - Intronic
967369035 3:188721947-188721969 CAATATATGAAAAGTGTTTGAGG - Intronic
967589538 3:191257274-191257296 AAAAATATGCAAAGTGTGTAAGG - Intronic
967818194 3:193816552-193816574 AAAGAAAAGAAAAGGGTGTTGGG + Intergenic
967993406 3:195148690-195148712 AGAGAGATGGAAAGTGTGCTTGG + Intronic
968037417 3:195559726-195559748 AAAGAGATAAAAAGTGTGACCGG + Intergenic
968564898 4:1306521-1306543 AAAGAAAAGAAAAGTGGGTTGGG + Intronic
969426499 4:7127485-7127507 AAGAAGATGAAAAGTGTGTGGGG - Intergenic
969832728 4:9810957-9810979 AAAGGTTGGAAAAGTTTGTTTGG - Intronic
970040316 4:11789518-11789540 AAACAGATGAAAATTGTATTAGG - Intergenic
970220426 4:13804932-13804954 AAAGAAACGAAAAATGTATTTGG - Intergenic
971289021 4:25318653-25318675 AAAGATAAGAACAGTGGTTTAGG - Intronic
973833113 4:54781683-54781705 AAAGTGATGAAAAAGGTGTTCGG + Intergenic
975108912 4:70601389-70601411 AGAAATTTGAAAAGAGTGTTAGG - Intronic
975431863 4:74302522-74302544 AAATACATGAAGAATGTGTTAGG + Exonic
975759671 4:77606857-77606879 AAAGATCTGATAAATGTCTTTGG + Intronic
976230954 4:82842364-82842386 GAAGATATGTAAGGGGTGTTAGG + Exonic
976521094 4:86027870-86027892 GAAGATATAAAAAGTCTTTTGGG + Intronic
976536704 4:86225637-86225659 TAAAATATGGAAAATGTGTTGGG - Intronic
977875792 4:102148592-102148614 AAAGAGAGAAAAAGTGTGTTGGG + Intergenic
978664013 4:111161915-111161937 AAAGAAATGACAAGTGTTTGAGG + Intergenic
979061781 4:116071194-116071216 AAAGAAATGACAAGTGTTTGAGG + Intergenic
979251039 4:118566813-118566835 AAAAACATGAAAAGTATGTGAGG - Intergenic
979391638 4:120135988-120136010 ATAGATATGAAAAATTTGTGTGG + Intergenic
979505433 4:121490380-121490402 AAAAATATGAAATGTATGTGGGG + Intergenic
979605350 4:122632654-122632676 AAAGATAAGAAAAGCATTTTTGG + Intergenic
979833133 4:125326093-125326115 TAATATATTAAAAGTATGTTTGG + Intronic
980545059 4:134249901-134249923 AAAGAAATGATAAGTGTTTGAGG - Intergenic
980884221 4:138744407-138744429 GCAGATATGAATAGTGTGGTGGG - Intergenic
981018611 4:140002034-140002056 AAAAAAATGATAAGTGTGTGAGG - Intronic
981030667 4:140122379-140122401 AAAGATATGAAAAGTTAGCTGGG - Intronic
981529824 4:145741519-145741541 AAAGATATGGAAAATTAGTTTGG + Intronic
981575495 4:146200189-146200211 AAAAAAATGATAAATGTGTTAGG + Intergenic
982286278 4:153739073-153739095 AAACATAGGAACAGTGTATTGGG - Intronic
982551523 4:156806890-156806912 AAAGATCTGAAATGTGTTCTGGG + Intronic
982951705 4:161705409-161705431 AAAGAAATGAGAAGTCTCTTAGG + Intronic
983592935 4:169435014-169435036 AAAGAAAAGAAAATAGTGTTAGG - Intronic
983901780 4:173143223-173143245 AAAGATATGAAAAGACATTTCGG - Intergenic
984503826 4:180591817-180591839 AAAAATATAAAAAGTTAGTTGGG + Intergenic
984653830 4:182296313-182296335 AAAGACATGAAAACTCTTTTAGG + Intronic
985157745 4:187009316-187009338 AAAGAAATGATAAGTGTTTGAGG + Intergenic
985320352 4:188703695-188703717 AAAGGTATTAAAATTGTATTAGG + Intergenic
985423794 4:189809703-189809725 GAAGATATGAAAAGAGCTTTAGG - Intergenic
986968251 5:13301567-13301589 AAACAAATAAAATGTGTGTTGGG + Intergenic
987084033 5:14452353-14452375 AAAGGTATGAAAAAAGTCTTTGG - Intronic
987265720 5:16252942-16252964 AAAGATATAACAATTGGGTTTGG - Intergenic
987346795 5:16985940-16985962 AAAGATGGGAAAATTGTGTGAGG + Intergenic
987615716 5:20271442-20271464 AAAGAAATGACAAGTGTTTGAGG + Intronic
987659306 5:20851782-20851804 AAATATATCAAATGTGTTTTGGG + Intergenic
987743831 5:21945121-21945143 ACAGACATGAAAAAGGTGTTGGG + Intronic
987858060 5:23447312-23447334 GAAGAGATGAAAAGTCTGTCTGG - Intergenic
987994631 5:25260876-25260898 AAAAATATGAAAAATGTGTGAGG + Intergenic
988135787 5:27170345-27170367 AAAATAATGAAAAGTGTCTTTGG - Intergenic
988764341 5:34353873-34353895 AAATATATCAAATGTGTTTTGGG - Intergenic
989006650 5:36822006-36822028 AAATATTTAAAAGGTGTGTTTGG - Intergenic
989034240 5:37152905-37152927 AAAGATATGAAAAATTTCTAAGG + Intronic
989772688 5:45163469-45163491 AAAGATATGGAAACTGTGTGAGG - Intergenic
990038063 5:51346851-51346873 AAAAATATGAAAAGTATTGTTGG - Intergenic
990054931 5:51562069-51562091 ATCTATATGACAAGTGTGTTGGG + Intergenic
990070066 5:51771308-51771330 AAAGAAATGACAAGTGTTTGAGG - Intergenic
990157195 5:52890699-52890721 AAAGAAATGATAAGTGTCTGAGG - Intronic
990528010 5:56647217-56647239 AAAATTATGCAAAGTGAGTTGGG + Intergenic
991088297 5:62668563-62668585 TAACATAAGAAAACTGTGTTTGG - Intergenic
991285191 5:64965981-64966003 GAAAATATAAAAAGAGTGTTTGG + Intronic
991680810 5:69137577-69137599 AAATATATTAAAAGTTTCTTGGG - Intergenic
992820483 5:80491125-80491147 AAAGAAATGATAAGTATGTGAGG - Intronic
993035517 5:82751812-82751834 AAAGATCTAAAAAGAATGTTGGG - Intergenic
993493147 5:88576788-88576810 AAACATAAGAAGATTGTGTTGGG + Intergenic
993617092 5:90126265-90126287 AAAGAAATTGAAAGTGTGTGTGG - Intergenic
993808760 5:92447016-92447038 GAAAATATCAAAAGTATGTTAGG - Intergenic
993835638 5:92817122-92817144 AAAGAAAGGAAAAATGTATTAGG - Intergenic
994210332 5:97081106-97081128 AAAGATTTAAAAAGAGAGTTTGG + Intergenic
995126796 5:108585153-108585175 AAAGATCTTGAATGTGTGTTTGG + Intergenic
995239153 5:109866038-109866060 AAAGATAAGAAAAATGTGGTAGG + Intronic
995272626 5:110239411-110239433 AATTATATGAAAACAGTGTTTGG + Intergenic
995600956 5:113795429-113795451 AAAGATATGAAATGTGTACATGG - Intergenic
995855596 5:116588720-116588742 AAAGAAATGATAAATGTGTAAGG + Intergenic
995958857 5:117814800-117814822 AATGATGTGAAAAGACTGTTAGG + Intergenic
995971803 5:117981512-117981534 AAAAATCTGAAAAGTATGTGAGG + Intergenic
996232699 5:121086318-121086340 AAAGAAATAAAAAGTGTTTGAGG - Intergenic
996641298 5:125757340-125757362 ATTGATGTGAAAAGTGTTTTTGG - Intergenic
996712493 5:126557284-126557306 ACAAATATGAAAAGTGTGAGAGG + Intronic
997259131 5:132452150-132452172 AAAGAAATGACAAGTGTTTAAGG + Intronic
997631646 5:135373295-135373317 AAAGACCTGAAGAGTGTGGTTGG + Intronic
997816271 5:137021520-137021542 AAATCTATGAAATGTGTGTAAGG - Intronic
998194988 5:140061036-140061058 AAAGATCTGAAAAGATTTTTAGG - Intergenic
999402049 5:151272794-151272816 AAAGATATGAACCTTGTATTAGG + Intergenic
999625398 5:153515627-153515649 AAAGAAATGACAAGTATGTGAGG + Intronic
999631220 5:153573301-153573323 AAAGATAAGAAAATTGTGTTAGG - Intronic
999686584 5:154108472-154108494 AAAAATATAAAAAGTTAGTTGGG + Intronic
999729163 5:154462832-154462854 AAAGAAAATAAAAGGGTGTTGGG - Intergenic
1000446184 5:161324144-161324166 AAAGATATGAAAAGTTAACTGGG + Intronic
1000494271 5:161959324-161959346 AAAGAAATGAAAATTATATTAGG - Intergenic
1000533075 5:162447787-162447809 AAAGAAATGATAAATGTGTGAGG - Intergenic
1000764524 5:165270312-165270334 AAAGATATTAATATTTTGTTGGG - Intergenic
1000993677 5:167937101-167937123 AAAGAACTGAAAAGTATGTGAGG - Intronic
1001179474 5:169505714-169505736 AATGATAAGAAAAGTATGCTAGG - Intergenic
1001462915 5:171934380-171934402 AAAAATTTGAAAAGTAGGTTGGG + Intronic
1001805793 5:174584975-174584997 AAACATTTTTAAAGTGTGTTTGG + Intergenic
1001850579 5:174961164-174961186 AAAGAAATGACAAGTGTTTGAGG - Intergenic
1003062118 6:2872004-2872026 AAGGAAGTGAAAAATGTGTTAGG - Intergenic
1003215145 6:4102474-4102496 AAAGAAATGAAAATTGTTTGAGG + Intronic
1004551231 6:16649705-16649727 TAAGATATTAAAAATGTTTTTGG - Intronic
1004594208 6:17083931-17083953 AAAGAAATGAAAAATGTTTGAGG - Intergenic
1004616822 6:17298736-17298758 AAAGAAATGATAAGTATGTGAGG - Intergenic
1005046806 6:21650980-21651002 AAAGATATGGAATTTGTGATTGG + Intergenic
1005897958 6:30194483-30194505 AAAGAAATGATAAGTGTTTGAGG + Intronic
1005922212 6:30412147-30412169 AAAGAGAAGAAAAGAGAGTTGGG - Intergenic
1006211442 6:32398911-32398933 AAAGAAAAAAAAAGTGGGTTAGG - Intronic
1006721548 6:36156282-36156304 AAAGATGTGAAGGGTGTGATGGG + Intergenic
1007884884 6:45216021-45216043 AAAGCGATGAAAAGTGTGGGGGG + Intronic
1008014826 6:46506658-46506680 AAAGATGTGAAAGGAGTATTAGG - Intergenic
1008069134 6:47081738-47081760 TAAAACATAAAAAGTGTGTTAGG - Intergenic
1009031196 6:58060176-58060198 AAAAGTATGAACAATGTGTTAGG + Intergenic
1009207054 6:60814638-60814660 AAAAGTATGAACAATGTGTTAGG + Intergenic
1009509398 6:64530434-64530456 AAATATATTAAAATTTTGTTTGG + Intronic
1009584348 6:65578609-65578631 AAAAAAATGATAAGTGTGTGAGG + Intronic
1009702098 6:67197626-67197648 AAAGAGATGAAAAATGTCTTTGG + Intergenic
1010042039 6:71396305-71396327 GAAGATATACAAAGTATGTTTGG - Intergenic
1010434930 6:75818047-75818069 AAAAATATGAAAAGTGAATGTGG + Intronic
1010496135 6:76535569-76535591 AAAGAAATAAAAAGTGTGAAAGG - Intergenic
1011111898 6:83847702-83847724 AAAAATAAAAAAAGAGTGTTAGG + Intergenic
1012182527 6:96172374-96172396 AATGATATGAAAAATGTATATGG - Intronic
1012688447 6:102282975-102282997 AAAAATATAAAATGTGAGTTTGG - Intergenic
1013029108 6:106313258-106313280 AATGATATGATAGGTGTGATAGG - Intronic
1013191519 6:107807670-107807692 AAATATCTAAAAAGTGAGTTAGG + Intronic
1013670390 6:112396063-112396085 AAACATAGGGAAAGTGTTTTAGG - Intergenic
1014130727 6:117829289-117829311 AAAGAAATGATAAGTGTTTGAGG + Intergenic
1014412510 6:121144240-121144262 AAAGATGTCACAAATGTGTTAGG + Intronic
1014459434 6:121678234-121678256 AATGCTATTGAAAGTGTGTTAGG - Intergenic
1014478578 6:121906296-121906318 AAATAAATAAAAAGTGTGTAAGG - Intergenic
1014858228 6:126429695-126429717 AAAGAAATGCAAATTGTATTAGG - Intergenic
1015841657 6:137483629-137483651 GAAGATATGAAAAGAGGGTTGGG + Intergenic
1015998857 6:139022692-139022714 AAAGAAATGATAAGTATGTAAGG - Intergenic
1017138906 6:151172517-151172539 ACAGATATGAAAACTGTATTAGG - Intergenic
1017254146 6:152314252-152314274 AAAGATCCTAAAAGTCTGTTGGG - Intronic
1017360285 6:153560648-153560670 ATAAATATGAAATGTGTATTTGG + Intergenic
1017490708 6:154942496-154942518 AAAGAAAAGAAAACTGAGTTTGG + Intronic
1017540005 6:155391367-155391389 AAAGATCAAATAAGTGTGTTTGG - Intergenic
1017559211 6:155608566-155608588 AAGGAAAAGAAAAGTTTGTTAGG + Intergenic
1017569898 6:155732670-155732692 AATGAAATCATAAGTGTGTTTGG - Intergenic
1017917678 6:158844976-158844998 AAATATATTCAAAGTGTGATAGG + Intergenic
1019151627 6:170010283-170010305 AAATCTATACAAAGTGTGTTGGG - Intergenic
1019228979 6:170541585-170541607 AAAGAGCTGAAAACTGTCTTAGG + Intronic
1019443458 7:1059246-1059268 AAACAAAAGAAAGGTGTGTTAGG + Exonic
1019487933 7:1297809-1297831 AAGGATATGAAAAGTTTTATTGG - Intergenic
1019792107 7:3021775-3021797 AATAATATCAAAAGTGTGTAAGG + Intronic
1020246199 7:6431473-6431495 AAAGATATGATAAATGTGGCCGG + Intronic
1020827895 7:13054618-13054640 AAAGATTTGAATAGTGTAGTGGG - Intergenic
1020972388 7:14961527-14961549 CCAGATCTGAAAAGTGTGGTTGG + Intronic
1021238894 7:18176619-18176641 ACAGCTATGAAAATTCTGTTTGG + Intronic
1021381210 7:19968880-19968902 AAAGATATGACAAGTGTTAGAGG - Intergenic
1022012114 7:26317275-26317297 CAAGATTTGAAAAGTGAGTAGGG + Intronic
1022386078 7:29900635-29900657 AAGGAAATGACAAGTGTGATTGG - Intronic
1022552720 7:31256686-31256708 AAATAGATGAAAAGTCTGTTTGG + Intergenic
1022587708 7:31631351-31631373 CAAGATATAAAATGTGTATTAGG + Intronic
1022633361 7:32107033-32107055 AAAGAAATGAAAAATGACTTTGG + Intronic
1022862388 7:34381715-34381737 AAAACTATAAAAATTGTGTTAGG - Intergenic
1023076823 7:36491665-36491687 AAAAATCAGAAAAGTGTTTTGGG - Intergenic
1023622875 7:42090820-42090842 AAATATATGAAGAGTGTTTAGGG - Intronic
1024344492 7:48299270-48299292 CATGATATTAAACGTGTGTTGGG - Intronic
1024381323 7:48699718-48699740 AAAGAAATGGAAAGTGAGATAGG + Intergenic
1024439333 7:49397826-49397848 AAAAACATTAAAAGTATGTTTGG + Intergenic
1024503970 7:50145491-50145513 AAGGATATGGAAAGAGTGTTGGG + Intronic
1025886788 7:65602325-65602347 AAAAAAATGAAAGGAGTGTTGGG - Intergenic
1026653003 7:72231994-72232016 ACAGGTGTGAAATGTGTGTTGGG + Intronic
1026730776 7:72910191-72910213 TAAAATATGAAAACTGGGTTTGG + Intronic
1026744814 7:73003355-73003377 AAAGAAAAGAAAAGGATGTTTGG - Intergenic
1027030920 7:74888017-74888039 AAAGAAAAGAAAAGGATGTTTGG - Intergenic
1027098926 7:75361732-75361754 AAAGAAAAGAAAAGGATGTTTGG + Intergenic
1027113313 7:75457979-75458001 TAAAATATGAAAACTGGGTTTGG - Intronic
1027285563 7:76642574-76642596 TAAAATATGAAAACTGGGTTTGG - Intergenic
1027703229 7:81495170-81495192 AAAGATATGAAAAATATTGTAGG - Intergenic
1027816036 7:82973237-82973259 AAATAAATGAAATGTGTGTCAGG + Intronic
1027917158 7:84339799-84339821 AAAGCTTTGAAAACTGTTTTTGG - Intronic
1027930633 7:84529681-84529703 ACATATATTAAATGTGTGTTTGG + Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028390211 7:90307271-90307293 AAAGAAATGATAAGTGTTTAAGG + Intronic
1028859115 7:95627884-95627906 AAAGAAATTATAAGTATGTTGGG + Intergenic
1029209121 7:98891144-98891166 GGAGGTATGAACAGTGTGTTGGG - Intronic
1029260988 7:99302718-99302740 AAACATATGAAAAATTAGTTGGG + Intergenic
1029400026 7:100338532-100338554 AAAGAAAAGAAAAGGATGTTTGG + Intronic
1030209012 7:106978143-106978165 AAAGAAAAGAAAAATATGTTTGG + Intergenic
1030737601 7:113068029-113068051 AAAAATATGAAAAATTAGTTGGG + Intergenic
1031087225 7:117314758-117314780 GAAGATATGAACTGTGGGTTAGG - Intronic
1031099965 7:117467469-117467491 AAAGAAAGAAAAAGTGAGTTTGG - Intronic
1031230691 7:119101652-119101674 ATAGTTATGAAAATTATGTTTGG - Intergenic
1031352068 7:120745252-120745274 AAAGAAATGGATAGTGTCTTAGG + Intronic
1031449850 7:121901826-121901848 AAAGGAATGAAAAGTGTTTGAGG - Intronic
1031532614 7:122894761-122894783 AAAGATATGAACAGTCTTCTTGG - Intergenic
1031850940 7:126862524-126862546 AAAGTTAAGAAAAGTATGTAGGG - Intronic
1031855631 7:126919613-126919635 AAAAAAATGAAAGGAGTGTTGGG + Intronic
1031939986 7:127778356-127778378 AAAAATATGAAAAGTTAGCTGGG - Intronic
1032938245 7:136758681-136758703 TAAAATATGAAGAGTGAGTTGGG + Intergenic
1032992457 7:137409123-137409145 AAAGAAATGATAAATGTGTGAGG + Intronic
1033869841 7:145738558-145738580 AAAAAAATGATAAGTGTGTATGG - Intergenic
1034518199 7:151598459-151598481 AAAGAAATGATACGTGTTTTAGG + Intronic
1034540330 7:151754352-151754374 AAAGAAAGGAAAAGTATGTGCGG - Intronic
1036957392 8:13203101-13203123 AAAGATAGGTAAAGTGTGCAAGG - Intronic
1036992643 8:13615886-13615908 AAATATATAAAAAGTCTGTTGGG + Intergenic
1037487929 8:19366275-19366297 AAAGAAATGACAAGTGTTTGAGG - Intronic
1037697605 8:21239373-21239395 AAAGAAATGATAAGTGTTTCAGG - Intergenic
1037832128 8:22195995-22196017 TGAGCTATGAAAAGAGTGTTGGG - Intronic
1038065588 8:23960336-23960358 AAATATAGAAATAGTGTGTTTGG - Intergenic
1038571771 8:28668748-28668770 CATGATATGAGAAGTATGTTGGG - Intronic
1038603476 8:28973343-28973365 ACAGATATGAAAAATTTATTTGG - Intronic
1038606730 8:29014171-29014193 CAAGTTATGAAAAGAGTTTTGGG + Intronic
1038802813 8:30764604-30764626 AAATATATGAAAAAAATGTTTGG + Intronic
1038937723 8:32271023-32271045 AAATAGATGAAAAGTGTTTTGGG + Intronic
1039010881 8:33091306-33091328 AGAGATATGACAAGTTAGTTGGG + Intergenic
1039073300 8:33665603-33665625 AAACAAAGGAAAAGTGGGTTTGG + Intergenic
1039089321 8:33811784-33811806 ACAGAAATGAAAAGTATGTAAGG + Intergenic
1039343607 8:36678829-36678851 AAAGAAAAGAAAAGTATTTTGGG + Intergenic
1039521242 8:38174183-38174205 AAAGATATGAAAAAAGGGATGGG + Intronic
1039801232 8:40956992-40957014 CAAGAAATGATAAGTGTGTGAGG - Intergenic
1040096587 8:43450421-43450443 AATGATGTGAAAAGTATGTCTGG - Intergenic
1040723520 8:50353573-50353595 TGAGATATGACAAGTGAGTTTGG + Intronic
1041661824 8:60408384-60408406 AAAGAAATGAAAAAAATGTTGGG - Intergenic
1042399334 8:68328306-68328328 AAAGATATGTAAAGTATATGTGG - Intronic
1042478152 8:69273108-69273130 CTATATATGTAAAGTGTGTTAGG + Intergenic
1043103561 8:76079568-76079590 AAAGTAATGAAAACAGTGTTTGG - Intergenic
1043158843 8:76820247-76820269 AAAAAAATAAAAAGTGTGTTTGG - Intronic
1043611506 8:82068750-82068772 AAAAATGTGAACAGTTTGTTGGG + Intergenic
1043963874 8:86449496-86449518 AAAAATATTAAAAGTATTTTGGG - Intronic
1044102987 8:88164080-88164102 AAAGAGATAAACAGTGTCTTAGG - Intronic
1045143924 8:99317346-99317368 AAAGAAATGACAAGTGTTTGAGG - Intronic
1045177025 8:99736411-99736433 AAAAATATGAAAAGTTAGCTGGG + Intronic
1045402904 8:101836285-101836307 AAAGATATACAAATTGTGTTAGG + Intronic
1045453251 8:102349743-102349765 ACAGATAAGAAAAGTATCTTGGG + Intronic
1045762792 8:105630057-105630079 ACAGATATAAAAGGTGTGGTAGG - Intronic
1045943126 8:107762546-107762568 AAAGCTATGAAGAGTGTCTGAGG - Intergenic
1046252593 8:111652166-111652188 CAATATATTAAAATTGTGTTGGG + Intergenic
1046256626 8:111706336-111706358 AAAGAAATGATAAGTGTATTGGG - Intergenic
1046414491 8:113894289-113894311 AAAAATATGTAGAGCGTGTTTGG + Intergenic
1047005196 8:120612870-120612892 AAAGATATGATAAATGTTTGAGG - Intronic
1047441489 8:124882772-124882794 AAAGAGGTGACAACTGTGTTGGG - Intergenic
1047946353 8:129884610-129884632 AAATATATCAATAGTGTTTTGGG - Intronic
1048096534 8:131301244-131301266 ATAGAAATGAAAAATGTATTGGG - Intergenic
1048202505 8:132386940-132386962 AAAGAAATGAAAAATGTTTGTGG + Intronic
1048659247 8:136577499-136577521 ACAGAGATCAAAAGTTTGTTAGG - Intergenic
1049608969 8:143543849-143543871 TAGGAAATGAGAAGTGTGTTAGG + Intergenic
1050402173 9:5267726-5267748 AAAGAAATGAAGATTGTTTTTGG - Intergenic
1050631177 9:7560442-7560464 AAATATATAAAAAGAGAGTTGGG + Intergenic
1050680919 9:8110427-8110449 AAAGACAAGATAAGTGTTTTAGG + Intergenic
1050739088 9:8799842-8799864 AAAGAAAAAAAAAGTGTGTGGGG - Intronic
1051034543 9:12727820-12727842 ACAAATAAGAAAAGAGTGTTAGG - Intergenic
1051206516 9:14694009-14694031 AAATATAAGAAAAGATTGTTTGG - Intergenic
1051510435 9:17871774-17871796 AAAAATAAGAAAAATGTATTAGG - Intergenic
1051859948 9:21613115-21613137 AAAGAAAAGAAAAGTCAGTTTGG - Intergenic
1051964913 9:22816126-22816148 AAAAAATTAAAAAGTGTGTTAGG + Intergenic
1052248707 9:26370750-26370772 AAAAAAATGAACAGTGTCTTAGG - Intergenic
1052509025 9:29390658-29390680 AAAGACATGATTAGAGTGTTAGG - Intergenic
1052902701 9:33807827-33807849 AAATAAATAAAAAGTGTATTTGG - Intergenic
1053223100 9:36327723-36327745 AAAGATAAGGAATTTGTGTTGGG + Intergenic
1054815364 9:69469438-69469460 AGAGAAATTAAAAGTGTTTTAGG + Intronic
1055312567 9:74998206-74998228 AAAGATATGAACAAGGTGATTGG - Intronic
1057795082 9:98150090-98150112 AAAAATATGAAAAATTAGTTGGG - Intronic
1057887630 9:98842506-98842528 AAATATATGAAAATTGTTTTTGG + Intronic
1058466183 9:105230926-105230948 AAAAATATGAAAAATGTGGCTGG + Intergenic
1058606704 9:106730881-106730903 AAAAACAAGAAAAGTGTGATGGG - Intergenic
1058697402 9:107571206-107571228 AAACATATGAAAAATGTGTGTGG + Intergenic
1058955010 9:109938020-109938042 AAAGGGATGAAAAGTGTGAGAGG + Intronic
1059030459 9:110687908-110687930 TTAGAAATAAAAAGTGTGTTTGG - Intronic
1059053109 9:110949960-110949982 AAAGACATGGAAAATGTGCTTGG + Intronic
1059522942 9:114961013-114961035 AAACATGTGAAAAGTGGGGTTGG - Intergenic
1062313229 9:135951102-135951124 AAAAATATAAAAAGTTAGTTAGG - Intronic
1186049437 X:5574580-5574602 AAAGATATAAGCAATGTGTTAGG + Intergenic
1186880619 X:13862497-13862519 AATGTTATGAAAATAGTGTTTGG - Intronic
1188142472 X:26568745-26568767 AAAGAAATGATAAGTGTTTGGGG - Intergenic
1188145022 X:26601183-26601205 AAAGATTTGAAAAGTTTATCAGG + Intergenic
1188372478 X:29386006-29386028 AAATTTTTAAAAAGTGTGTTGGG - Intronic
1188775140 X:34207719-34207741 TAAGTTAGGAAATGTGTGTTAGG + Intergenic
1188911953 X:35860112-35860134 AAAGAAATGACAAGTGTTTGAGG - Intergenic
1188953115 X:36400916-36400938 AAAGATAGGAAATGATTGTTGGG - Intergenic
1189946168 X:46181506-46181528 AAAGAAATGACAAGTGTTTGAGG - Intergenic
1190017738 X:46842357-46842379 AAAGACATGATAAGTGTTTGAGG + Intronic
1192117558 X:68425989-68426011 AAAAATATGAAAAGTTAGCTGGG - Intronic
1192576137 X:72244776-72244798 AAGGAGATCAAAAGTGGGTTTGG + Intronic
1193398863 X:81018849-81018871 AAAAATATAAAAAGTATGTAGGG - Intergenic
1193428900 X:81375892-81375914 ATATATATGTAAAATGTGTTTGG + Intergenic
1193568755 X:83114513-83114535 AAAGAGATTAAAAGAGAGTTGGG - Intergenic
1193703235 X:84789789-84789811 AAAAAAATGAAAAGAGTTTTGGG + Intergenic
1193836012 X:86344812-86344834 AAAGTTGTGAAATGTATGTTTGG - Intronic
1194017855 X:88647876-88647898 AAAAATATGATAGGTGTGATTGG - Intergenic
1194032444 X:88833373-88833395 AAAAATATGAAAAGAGAGATTGG - Intergenic
1194671266 X:96735979-96736001 GATGATATGAAAATTCTGTTGGG - Intronic
1194915376 X:99700921-99700943 AAAGATATGAGCAGTGTATGGGG + Intergenic
1195211869 X:102657618-102657640 ATACATATGTAAAGTGTGTGAGG + Exonic
1195769038 X:108329235-108329257 AAAGAAATGATAAGTGTTTGAGG + Intronic
1196630905 X:117938767-117938789 ACAGATAGGAAAAGTATGTGAGG - Intronic
1197302091 X:124793679-124793701 AAAGCTATGAAATATGCGTTTGG - Intronic
1197310017 X:124893433-124893455 AAAGATATGAAAAGTGTGTTTGG + Intronic
1197865059 X:131008791-131008813 ATATATATGTATAGTGTGTTGGG - Intergenic
1198123559 X:133620057-133620079 AAAAATATGAAAAATTAGTTGGG + Intronic
1198982506 X:142415550-142415572 AAAGAAAGCAAAAGTGTGCTGGG + Intergenic
1199406364 X:147466198-147466220 AAAGAAATGACAAGTGTTTGAGG + Intergenic
1199824341 X:151483585-151483607 AAAGTCAAGAAAAGTCTGTTTGG - Intergenic
1202303733 Y:23445429-23445451 AAAGATACTGAAAGTGTGTCTGG + Intergenic
1202345137 Y:23914631-23914653 AAAGAAATGATAAGTATGTGAGG - Intergenic
1202525633 Y:25755458-25755480 AAAGAAATGATAAGTATGTGAGG + Intergenic
1202567077 Y:26225164-26225186 AAAGATACTGAAAGTGTGTCTGG - Intergenic
1202600363 Y:26587897-26587919 AAAAAGATGAAGATTGTGTTTGG - Intergenic